SiRNA duplex body and conjugate for targeted regulation and control of INHBE gene expression and application of siRNA duplex body and conjugate

Abstract

The invention discloses a siRNA duplex for targeted regulation and control of INHBE gene expression and application of the siRNA duplex in prevention and treatment of metabolism-related diseases. The present disclosure also relates to corresponding conjugates and pharmaceutical compositions. Cell and animal experiment results show that the oligonucleotide duplex can obviously inhibit the expression of the INHBE gene, and can be used for preparing medicines for preventing or treating related diseases such as atherosclerosis.

Description

[0001] This application claims priority to Chinese patent application 2025106087721, filed on May 12, 2025, and Chinese patent application 2025106147953, filed on May 13, 2025. The full text of the aforementioned Chinese patent applications is incorporated herein by reference. Technical Field

[0002] This disclosure pertains to the field of biomedicine, specifically relating to siRNA duplexes and conjugates that target and regulate INHBE gene expression and their applications in the prevention and treatment of metabolic-related diseases. Background Technology

[0003] Nucleic acid drugs, especially oligonucleotide drugs, are widely used due to their simple synthesis and high activity. Oligonucleotide drugs typically include antisense oligonucleotides (ASO), small interfering RNA (siRNA), microRNA (miRNA), and nucleic acid aptamers.

[0004] Oligonucleotides are short DNA or RNA molecules or oligomers. They can bind to their complementary oligonucleotides, DNA, or RNA in a sequence-specific manner to form double strands, or, less commonly, higher-order hybrids in some cases. Oligonucleotides can bind sequence-specifically to complementary RNA strands, inducing RNase H cleavage of target RNA after hybridization. In natural oligonucleotides, nucleotides are linked by phosphodiester bonds. Under physiological conditions, oligonucleotides are particularly sensitive to nucleases. Therefore, in the preparation of oligonucleotide drugs, natural, unmodified, or untrained oligonucleotides are easily and rapidly degraded in vivo, resulting in very limited activity and poor drug-likeness. Modifying oligonucleotides is an effective way to improve their activity, enhancing their stability to nucleases, their affinity for RNA, and better promoting endocytosis and tissue targeting, thereby effectively regulating the expression of target genes.

[0005] The basic structure of a nucleotide can generally be divided into four parts: the base, the ribose, the phosphate backbone, and the terminal. Examples of modifications to these four parts are as follows: 1) Base modification: mainly divided into three forms: purine modification, pyrimidine modification, and base substitution. Purine modification includes N6-methyladenosine, N1-methyladenosine, and 7-methylguanylic acid modification; pyrimidine modification includes 3-methyluridine, 5-methyluridine, 5-methylcytosine, N4-acetylcytidine, pseudouridine, thiouridine, propynouridine, and dihydrouridine, etc.

[0006] 2) Ribose modification: This mainly involves the modification and substitution of groups at specific positions on the ribose ring. Ribose modification includes, but is not limited to, 2'-position modification, 4'-position modification, 5'-position modification, and isomerization modification. The most common 2'-position modifications are 2'-OMe (2'-methoxy) modification and 2'-F (2'-fluoro) modification. Compared to natural oligonucleotides, oligonucleotides modified with both 2'-OMe and 2'-F exhibit higher Tm values, stronger serum stability, and better activity.

[0007] 3) Modification of the phosphate backbone: The main modification methods include, but are not limited to, modification of thiophosphates; modification via methyl phosphates, selenophosphates, methylboryl phosphates, dithiophosphates, and by replacing the bridging oxygen atoms in the phosphate diester bond linkage with sulfur atoms; and replacing the phosphate ester groups between nucleosides entirely with groups that do not contain phosphorus atoms, such as replacing P atoms with C, S, and N atoms, thereby forming guanidine, S-methylthiourea, or nitrate esters, etc.

[0008] 4) End modification: including but not limited to covalently linking specific groups to the 5' end and / or 3' end of the sense chain, phosphorylation modification of the 5' end of the antisense chain, etc.

[0009] Inhibin βE (INHBE) protein is a member of the transforming growth factor-β (TGF-β) superfamily. It is a secreted protein that is specifically expressed in hepatocytes. After being cleaved, INHBE protein dimers to form activin E, which may then inhibit lipolysis by activating specific signaling pathways (such as ALK7), thereby promoting fat accumulation.

[0010] Although drugs such as semaglutide exist for treating metabolic disorders like diabetes and obesity, semaglutide suffers from poor adherence and significant side effects. Therefore, there is a need for alternative and combination therapies for patients with INHBE gene expression-related diseases.

[0011] Furthermore, based on research on INHBE in this field, INHBE gene expression-related diseases include not only diabetes and obesity, but also conditions such as hyperlipidemia or dyslipidemia, insulin resistance or elevated or altered insulin levels during fasting or metabolic challenges, hepatic steatosis or fatty liver disease, non-alcoholic steatohepatitis, elevated blood pressure and / or hypertension, metabolic syndrome, coronary artery disease and other atherosclerotic symptoms, as well as complications associated with these diseases. Therefore, there is a clinical need for oligonucleotide drugs that can be provided for the treatment of INHBE gene expression-related diseases. Summary of the Invention

[0012] This disclosure provides siRNAs, conjugates, and their applications (e.g., applications in the preparation of drugs for treating metabolic disorders) that target and regulate INHBE gene expression. This disclosure identifies several siRNA modifiers that significantly inhibit INHBE gene expression by modifying the basic siRNA sequence, and provides corresponding siRNA conjugates.

[0013] The technical solutions disclosed herein include, but are not limited to: On the one hand, this disclosure provides an siRNA duplex comprising an oligonucleotide duplex composed of a sense strand and an antisense strand paired together.

[0014] On the other hand, this disclosure provides a conjugate for reducing the expression of INHBE, comprising the above-mentioned siRNA duplex and a conjugate group attached thereto.

[0015] On the other hand, this disclosure provides a nucleic acid protein complex comprising the double-stranded region of the above-mentioned siRNA double-stranded membrane or the antisense strand of the double-stranded region, and a nuclease.

[0016] On the other hand, this disclosure provides a recombinant vector comprising a nucleic acid molecule encoding the above-mentioned siRNA double strand.

[0017] In some embodiments, the vector backbone of the recombinant vector is selected from recombinant viroid-derived circular RNA vectors, tRNA, rRNA scaffolds, and chimeric tRNA / pre-miRNA vectors.

[0018] On the other hand, this disclosure provides a recombinant cell that synthesizes and secretes the above-mentioned siRNA double strand.

[0019] In some embodiments, the recombinant cells are selected from *Pseudomonas thiophile* and *Corynebacterium glutamicum* deficient in ribonuclease III.

[0020] On the other hand, this disclosure provides a method for preparing siRNA duplexes, including culturing the above-mentioned recombinant cells or chemical synthesis.

[0021] On the other hand, this disclosure provides a pharmaceutical composition comprising the above-described siRNA double strand, the above-described conjugate, or the above-described nucleic acid-protein complex, and a pharmaceutically acceptable carrier.

[0022] On the other hand, this disclosure provides a kit containing a box A, which includes one or more of the above-mentioned siRNA, conjugate, or pharmaceutical composition.

[0023] In some embodiments, the pillbox further includes a pillbox B, which contains one or more of the following: (1) Other drugs that reduce INHBE gene expression or compositions containing the drugs that reduce INHBE gene expression; (2) One or more of the group consisting of insulin, glucagon-like peptide-1 agonists, sulfonylureas, seglinide, biguanide, thiazolidinediones, α-glucosidase inhibitors, SGLT2 inhibitors, DPP-4 inhibitors and HMG-CoA reductase inhibitors.

[0024] On the other hand, this disclosure provides a method for inhibiting INHBE gene expression or inhibiting INHBE replication, comprising contacting one or more of the above-mentioned siRNA duplex, conjugate, pharmaceutical composition and kit with target cells.

[0025] In some implementations, the method is for non-diagnostic or non-therapeutic purposes.

[0026] In some implementations, the method is in vivo or in vitro.

[0027] On the other hand, this disclosure provides the use of the above-mentioned siRNA duplex, conjugate, recombinant vector, recombinant cell or pharmaceutical composition in the preparation of a medicament for the prevention and / or treatment of INHBE gene expression-related diseases.

[0028] The INHBE gene expression-related diseases are selected from diseases caused by INHBE protein overexpression, pathogenic mutations in the INHBE gene, abnormal INHBE protein metabolism, and abnormal interactions between INHBE and another substance.

[0029] On the other hand, this disclosure provides the above-mentioned siRNA double strand, the above-mentioned conjugate, the above-mentioned pharmaceutical composition, or the above-mentioned kit for the treatment and / or prevention of INHBE gene expression-related diseases.

[0030] On the other hand, this disclosure provides a method for treating and / or preventing INHBE gene expression-related diseases, comprising administering an effective amount of the above-mentioned siRNA duplex, the above-mentioned conjugate, or the above-mentioned pharmaceutical composition to a subject in need, or administering it to the subject in need using the above-mentioned kit.

[0031] On the other hand, this disclosure provides the above-mentioned siRNA double strand, the above-mentioned conjugate, the above-mentioned pharmaceutical composition, or the above-mentioned kit for treating metabolic diseases and cardiovascular and cerebrovascular diseases.

[0032] On the other hand, this disclosure provides a method for treating metabolic disorders and cardiovascular diseases, comprising administering an effective amount of the above-mentioned siRNA double strand, the above-mentioned nucleic acid protein composition or the above-mentioned pharmaceutical composition to a subject in need, or administering it to the subject in need using the above-mentioned kit.

[0033] Those skilled in the art will recognize that the INHBE gene expression-related diseases described in this disclosure include, but are not limited to: type 2 diabetes, hyperlipidemia or dyslipidemia (high or altered circulating levels of low-density lipoprotein cholesterol (LDL-C), triglycerides, very low-density lipoprotein cholesterol (VLDL-C), apolipoprotein B, or other lipid fractions), obesity (partial abdominal obesity), lipodystrophy (such as the inability to deposit fat locally in fat deposits (partial lipodystrophy) or the inability to deposit fat systemically (lipoatrophy)), insulin resistance, or elevated insulin levels during fasting or metabolic challenges. Elevated or altered levels of liver fat deposits or fatty liver disease and its complications (such as, for example, cirrhosis, fibrosis, or liver inflammation), non-alcoholic steatohepatitis, other types of liver inflammation, liver enzyme levels or liver injury, other markers of inflammation or fat deposits in the liver that are higher or elevated or altered, elevated blood pressure and / or hypertension, elevated blood glucose or blood glucose or hyperglycemia, metabolic syndrome, coronary artery disease and other atherosclerotic conditions, and complications of each of the above diseases or conditions, as well as any other diseases associated with INHBE gene expression and other unidentified related conditions, pathologies, or syndromes.

[0034] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of this disclosure.

[0035] The effects of this disclosure are at least as follows: (1) The basic siRNA sequence disclosed herein has a significant inhibitory effect on the INHBE gene, with an inhibition rate of over 50%.

[0036] (2) The siRNA modified by using the template modification method can achieve an inhibition rate of over 70%. Detailed Implementation

[0037] To make this disclosure easier to understand, certain terms are first defined. Furthermore, it should be noted that whenever a range of values ​​or parameters is enumerated, the purpose is to indicate that intermediate values ​​and ranges of these referenced values ​​are also intended to be part of this disclosure.

[0038] The articles “a” and “an” as used in this article refer to one or more (i.e., at least one) grammatical objects of the article. By way of example, “an element” refers to one element or more elements, such as multiple elements.

[0039] The term “including” is used here to refer to the phrase “including but not limited to” and can be used interchangeably with it.

[0040] The term “or” is used here to mean and / or the term “and / or” and is used interchangeably with it, unless the context clearly indicates otherwise.

[0041] As used herein, the term “about” or “approximately” when applied to one or more target values ​​refers to a value similar to the reference value. In some embodiments, unless otherwise stated or otherwise apparent from the context, the term “approximately” or “about” refers to a range of values ​​falling within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the reference value in any direction (unless such a number would exceed 100% of the possible value).

[0042] As used herein, “INHBE” refers to the repressor subunit βE gene or protein, and those skilled in the art can easily distinguish whether INHBE refers to a gene or a protein based on the context.

[0043] The term "INHBE gene" can refer to the wild-type INHBE gene or a mutant INHBE gene with sequence variations. Many sequence variations in the INHBE gene have been identified and can be found, for example, in NCBI dbSNP and UniProt (see, for example, ncbi.nlm.nih.gov / snp).

[0044] “G,” “C,” “A,” and “U” typically represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. “T” and “dT” are used interchangeably herein and refer to deoxyribonucleotides in which the nucleobase is thymine, such as deoxyribothymine, 2'-deoxythymidine, or thymidine. However, it should be understood that the terms “ribonucleotide,” “nucleotide,” or “deoxyribonucleotide” can also refer to a modified nucleotide (as detailed further below) or an alternative substitution. Those skilled in the art will readily recognize that guanine, cytosine, adenine, and uracil can be substituted with other parts without substantially altering the base-pairing properties of an oligonucleotide (including a nucleotide with such a substitution). For example, and not limited to, nucleotides containing inosine as a base can pair with nucleotides containing adenine, cytosine, or uracil. Therefore, nucleotides containing uracil, guanine, or adenine can be substituted in the nucleotide sequence of this disclosure with a nucleotide containing, for example, inosine. Sequences containing such substitution moieties are applicable to, but are not limited to, double-stranded ribonucleic acids, double-stranded ribonucleic acid modifications, double-stranded ribonucleic acid conjugates, pharmaceutical compositions, and methods of this disclosure.

[0045] The terms “complementary,” “fully complementary,” and “substantially complementary” are used herein to refer to base pairing between the sense and antisense strands of the siRNA, or between the antisense strand of the siRNA and the target sequence, as can be understood from the context in which they are used. In some embodiments herein, a first nucleotide sequence is considered complementary to a second nucleotide sequence if the first nucleotide sequence exhibits sequence complementarity of at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%. In one exemplary embodiment, 18 out of 20 nucleobases of the first nucleotide sequence pair with the corresponding region of the second nucleotide sequence, achieving 90% complementarity.

[0046] The terms “double-stranded ribonucleic acid,” “double-stranded RNA (dsRNA) molecule,” “dsRNA,” and “ribonucleic acid duplex” are used interchangeably to refer specifically to a complex of ribonucleic acid molecules having a double-stranded structure containing two antiparallel, complementary, or substantially complementary nucleic acid strands, with “sense” and “antisense” orientation relative to a target gene, such as the INHBE gene. In some embodiments, double-stranded ribonucleic acid (dsRNA) triggers the degradation of target RNA, such as mRNA, through a post-transcriptional gene silencing mechanism (referred to herein as RNA interference or RNAi). In this document, in some cases, “siRNA duplex” also typically refers to the technical meaning as defined above.

[0047] As is well known in the art, the terms "siRNA double strand," "double-stranded RNAi agent," "RNAi agent," "small interfering RNA," or "siRNA" refer to small interfering RNA (siRNA) molecules. It is a class of double-stranded RNA molecules, also known in the art as short interfering RNA or silent RNA. siRNA typically comprises a sense strand (also called a guest strand) and an antisense strand (also called a leader strand), each strand being 17 to 30 nucleotides in length, typically 19 to 25 nucleotides in length. The antisense strand is complementary to the target nucleic acid (suitably a mature mRNA sequence) (e.g., at least 95% complementary, e.g., completely complementary), and the sense strand is complementary to the antisense strand, such that the sense and antisense strands form a double strand or a double-stranded region. The sense and antisense strands of siRNA can form a blunt-ended double strand, or a double strand containing a 3′ overhang, which can be, for example, 1, 2, or 3 nucleotides in length, similar to the products produced by Dicer, which can form RISC substrates in vivo. Efficient extended forms of Dicer substrates have been described in US 8349809 and US 8513207, which are incorporated herein by reference. In some embodiments, both the sense and antisense strands have a 3′ overhang of 2 nucleotides. Thus, the length of the double-stranded region can be, for example, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, such as 19, 20, 21, 22, or 23 nucleotides.

[0048] Furthermore, in this document, "siRNA" sometimes also refers to "basic sequence." Specifically, "basic sequence" refers to an siRNA double helix in which each nucleotide is an unmodified nucleotide, and is also referred to as "motif," "siRNA motif," etc., throughout the document. Therefore, in this document, "siRNA," "basic sequence," "motif," and "siRNA motif" are used interchangeably, and their meanings also include the corresponding nucleotide sequence of the siRNA double helix they refer to. Those skilled in the art can clearly understand their precise technical meaning based on the context. Additionally, the 5' terminal nucleotide of the antisense strand of the motif may be linked to a 5' phosphate group or a 5' phosphate-derived group, or may not be linked to a 5' phosphate group or a 5' phosphate-derived group.

[0049] In this document, "siRNA modifier" refers to a double-stranded ribonucleic acid containing at least one modified nucleotide, and in some cases, it is also referred to as "double-stranded ribonucleic acid modifier". In this document, siRNA motifs are modified in different ways to prepare corresponding siRNA modifiers. For example, in some embodiments, the motif is modified using an alternating modification method to obtain alternatingly modified siRNA modifiers. In other embodiments, the motif is modified using a specific modification template to obtain siRNA modifiers modified with that specific modification template. In still other embodiments, the motif is modified using the off-target prevention modification method described herein to obtain off-target prevention modified siRNA modifiers. In some cases, multiple different modification methods can be used simultaneously to modify the same siRNA motif to obtain corresponding siRNA modifiers with multiple modification methods.

[0050] In this document, "siRNA conjugate" refers to a double-stranded ribonucleic acid conjugate or a conjugate of a double-stranded ribonucleic acid modifier obtained by attaching a conjugating group to a double-stranded ribonucleic acid, a double-stranded ribonucleic acid modifier, or a conjugate of a double-stranded ribonucleic acid modifier. Preferably, "siRNA conjugate" refers to a conjugate of a double-stranded ribonucleic acid modifier.

[0051] In some instances herein, "siRNA" refers not only to the unmodified siRNA double strand (or siRNA motif) described above, but may also refer to its corresponding siRNA modifiers and / or siRNA conjugates. For example, in contexts involving, but not limited to, treatment methods and therapeutic agents, siRNA generally refers to at least one of siRNA motifs, siRNA modifiers, and / or siRNA conjugates. The specific technical meaning will be clearly understood by those skilled in the art in the context.

[0052] The term “antisense strand” refers to a strand of double-stranded ribonucleic acid (e.g., the siRNA double strand in this document) that includes a region substantially complementary to the target sequence. When used herein, the term “complementary region” refers to a region on the antisense strand that is substantially complementary to a sequence defined herein (e.g., the target sequence). When the complementary region is not perfectly complementary to the target sequence, mismatches can occur in the internal or terminal regions of the molecule. Typically, the most permissible mismatches are in terminal regions, for example, within 5, 4, 3, 2, or 1 nucleotides at the 5' and / or 3' ends.

[0053] When used herein, the term “sense chain” refers to a chain of double-stranded RNA that includes regions substantially complementary to the regions of the antisense chain (as defined herein).

[0054] The term "alternating modification" refers to a modification method in which nucleotides are modified with 2'-methoxy (2'-OMe) and 2'-fluorine (2'-F) according to the nucleotide sequence of the double-stranded RNA. For example, in the antisense strand of siRNA, odd-numbered positions (i.e., positions 1, 3, 5, 7, 11, 13, 15, 17, 19, 21, and 23) are modified with 2'-methoxy, and even-numbered positions (i.e., positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, and 22) are modified with 2'-fluorine. For the sense strand complementary to this antisense strand, the corresponding position on the antisense strand that is modified with 2'-methoxy is modified with 2'-fluorine; and the complementary pairing position on the sense strand that is modified with 2'-fluorine on the antisense strand is modified with 2'-methoxy.

[0055] For RNA interference (RNAi), the suppression of target genes is achieved by loading the antisense strand of siRNA onto the AGO2 protein and forming a silencing complex (RISC), which then cleaves the gene's transcript mRNA. Loading the RISC requires phosphorylation of the 5' end of the antisense strand. This 5' phosphorylation can occur naturally within the cell via cleavage and polyadenylation factor I subunit 1 (Clp1), or it can be achieved through chemical synthesis. The terms "natural 5' phosphorylation" or "simple and direct 5' phosphorylation" refer to siRNA antisense strand phosphorylation occurring within the cellular environment, rather than through chemical synthesis.

[0056] In this document, "conjugation group" refers to a GalNAc derivative attached to an oligonucleotide. In some cases, the conjugation group includes a targeting group (also referred to as a ligand), and optionally also includes a linker, such as a GalNAc derivative attached to the oligonucleotide via a linker (e.g., a divalent, trivalent, or tetravalent branched linker arm), or, for example, a GalNAc derivative attached to the oligonucleotide via a monovalent linker arm. In most cases, both "ligand" and "conjugation group" have meanings known in the art.

[0057] The term "inhibition" as used herein may be used interchangeably with "reduction," "silence," "downregulation," "suppression," and other similar terms, and includes any level of inhibition. In some instances, "regulation" in this document refers to "inhibition," the specific meaning of which will be readily apparent to those skilled in the art from the context.

[0058] As used herein, the phrase “inhibit INHBE expression” includes inhibiting the expression of any INHBE gene (e.g., the mouse INHBE gene, the rat INHBE gene, the monkey INHBE gene, or the human INHBE gene) and variants (e.g., naturally occurring variants) or mutants of the INHBE gene. Therefore, the INHBE gene can be a wild-type INHBE gene, a mutant INHBE gene, or a transgenic INHBE gene in the case of genetically manipulated cells, cell groups, or organisms.

[0059] "Inhibition of INHBE gene expression" includes inhibition of the INHBE gene at any level, such as at least partial inhibition of INHBE gene expression, such as inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 8%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0060] INHBE gene expression can be assessed based on the levels of any variable associated with INHBE gene expression, such as INHBE mRNA levels or INHBE protein levels. The inhibition can be assessed by a reduction in the absolute or relative level of one or more of these variables compared to a control level. A control level can be any type of control level utilized in the art, such as baseline levels before administration or levels determined from similar untreated or controlled (e.g., buffer-only control or inert agent control) subjects, cells, or samples.

[0061] In this article, in some cases, "regulation" can refer to the same meaning as "inhibition"; correspondingly, "regulating INHBE gene expression" can mean "inhibiting INHBE gene expression". Those skilled in the art will understand the specific technical meaning clearly in the context.

[0062] As used herein, "patient" or "subject" is intended to include humans or non-human animals, preferably mammals such as monkeys. Preferably, the subject or patient is a human.

[0063] As used in this article, “INHBE gene expression-related diseases” are intended to include any disease associated with the INHBE gene or protein. Such diseases can be caused, for example, by overproduction of the INHBE protein, by mutations in the INHBE gene, by abnormal cleavage of the INHBE protein, or by abnormal interactions between INHBE and other proteins or other endogenous or exogenous substances. Exemplary INHBE-related conditions include metabolic conditions associated with body fat distribution, including but not limited to: type 2 diabetes, hyperlipidemia or dyslipidemia (high or altered circulating levels of low-density lipoprotein cholesterol (LDL-C), triglycerides, very low-density lipoprotein cholesterol (VLDL-C), apolipoprotein B, or other lipid fractions), obesity (partial abdominal obesity), lipodystrophy (such as the inability to deposit fat locally in fat deposits (partial lipodystrophy) or the inability to deposit fat throughout the body (lipomatosis)), insulin resistance or higher or altered insulin levels during fasting or metabolic challenges, hepatic steatosis or fatty liver disease and its complications (e.g., cirrhosis, fibrosis, or liver inflammation), non-alcoholic steatohepatitis, other types of liver inflammation, liver enzyme levels or liver damage, higher or elevated or altered other markers of inflammation or steatosis in the liver, higher and / or hypertension, higher or hyperglycemia or blood glucose, metabolic syndrome, coronary artery disease and other atherosclerotic conditions, and complications of each of the above conditions.

[0064] As used herein, “therapeutic effective dose” is intended to include the amount of RNAi agent sufficient to achieve treatment of an INHBE-related disease (e.g., by attenuating, improving, or maintaining the existing disease or symptoms of one or more diseases) when administered to a patient. This “therapeutic effective dose” can vary depending on the RNAi agent, how it is administered, the disease and its severity, and medical history, age, weight, family history, genetic makeup, stage of the pathological process mediated by INHBE expression, the type of prior or concomitant treatment (if any), and other individual characteristics of the patient to be treated.

[0065] As used herein, “preventive effective dose” refers to an amount of RNAi agent sufficient to prevent or improve the disease or one or more symptoms of the disease when administered to a subject who has not yet experienced or exhibited symptoms of an INHBE-related disease but may be susceptible to it. Improving the disease includes slowing its progression or reducing the severity of subsequent disease development. This “preventive effective dose” can vary depending on the RNAi agent, how it is administered, the risk level for the disease, and factors such as medical history, age, weight, family history, genetic makeup, type of prior or concomitant treatment (if any), and other individual characteristics of the patient to be treated.

[0066] "Therapeutic effective amount" or "prophylactic effective amount" also includes the amount of RNAi agent that produces a desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. The RNAi agent used in the methods of this disclosure can be administered in an amount sufficient to produce a reasonable benefit / risk ratio applicable to such treatment.

[0067] As used herein, the term "sample" includes similar fluids, cells, or tissues isolated from a subject, as well as a collection of fluids, cells, or tissues present in the subject. Examples of biological fluids include blood, serum and serous fluids, plasma, cerebrospinal fluid, ocular fluid, lymph, urine, saliva, etc. Tissue samples may include samples from tissues, organs, or localized areas. For example, a sample may originate from a specific organ, a portion of an organ, or fluids or cells within those organs. In some embodiments, a sample may originate from the liver (e.g., the entire liver or segments of the liver, or certain types of cells in the liver, such as hepatocytes). In a preferred embodiment, "sample derived from a subject" means blood or plasma drawn from that subject. In other embodiments, "sample derived from a subject" means liver tissue (or a subcomponent thereof) derived from that subject.

[0068] In this article, unless otherwise specified, when referring to any nucleotide position of any strand of siRNA motif, siRNA modifier, siRNA conjugate, siRNA duplex, etc., it means the 5' to 3' orientation.

[0069] In one aspect, this disclosure provides a double-stranded siRNA that targets and regulates the expression of the INHBE gene, comprising a sense strand and an antisense strand forming a reverse complementary double-stranded region. The antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides complementary to the target sequence shown in SEQ ID NO: 907 (UUGGAGUGAAGAGACCAAGAUGAAGUUUCCCAG), or the antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotide fragments or modified fragments thereof from any of the sequences shown in SEQ ID NO: 13-24, 134-236, 238-240, 252-260.

[0070] In some implementations, the target sequence is derived from the transcript of the inhibin subunit βE (INHBE) with accession number NM_031479.5 in the NCBI database.

[0071] In some embodiments, the antisense strand comprises the sequence shown in SEQ ID NO: 906 (UCAUCUUGGUCUC). For example, the nucleotide sequence of the antisense strand is as described in any one of SEQ ID NO: 13-16 and 18-23.

[0072] In some embodiments, the antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides complementary to the target sequence as shown in SEQ ID NO: 907. For example, the nucleotide sequence of the antisense strand is as described in any one of SEQ ID NO: 13-16 and 18-23.

[0073] In some implementations, the length of the reverse complementary double-stranded region is 17 to 21 bp, for example 20 or 21 bp.

[0074] In some embodiments, the positive chain comprises at least 17, 18, or 19 consecutive nucleotide fragments or modified fragments thereof in any of the sequences shown in SEQ ID NO: 1-12, 25-127, 129-131, 243-251.

[0075] In some implementations, the justice chain includes a sequence as shown in SEQ ID NO: 905 (GAGACCAAGAUGA).

[0076] In some embodiments, the lengths of the sense strand and the antisense strand each independently comprise 19 to 23 nucleotides; preferably, the sense strand comprises 19 to 21 nucleotides and the antisense strand comprises 21 to 23 nucleotides.

[0077] In some embodiments, the siRNA duplex is an siRNA used to suppress INHBE gene expression.

[0078] In some embodiments, the siRNA duplex comprises any one or a combination of at least two of any oligonucleotide duplexes selected from the following sense and antisense strand pairings: The sense chain has a sequence as shown in SEQ ID NO: 1, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 13, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 2, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 14, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 3, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 15, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 4, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 16, or a modified sequence of the sequence or a fragment thereof; The sense chain has a sequence as shown in SEQ ID NO: 5, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 17, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 6, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 18, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 7, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 19, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 8, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 20, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 9, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 21, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 10, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 22, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 11, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 23, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 12, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 24, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 25, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 134, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 26, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 135, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 27, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 136, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 28, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 137, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 29, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 138, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 30, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 139, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 31, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 140, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 32, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 141, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 33, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 142, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 34, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 143, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 35, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 144, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 36, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 145, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 37, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 146, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 38, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 147, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 39, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 148, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 40, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 149, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 41, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 150, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 42, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 151, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 43, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 152, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 44, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 153, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 45, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 154, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 46, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 155, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 47, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 156, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 48, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 157, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 49, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 158, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 50, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 159, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 51, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 160, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 52, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 161, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 53, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 162, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 54, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 163, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 55, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 164, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 56, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 165, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 57, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 166, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 58, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 167, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 59, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 168, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 60, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 169, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 61, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 170, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 62, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 171, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 63, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 172, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 64, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 173, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 65, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 174, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 66, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 175, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 67, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 176, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 68, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 177, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 69, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 178, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 70, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 179, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 71, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 180, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 72, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 181, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 73, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 182, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 74, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 183, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 75, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 184, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 76, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 185, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 77, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 186, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 78, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 187, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 79, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 188, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 80, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 189, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 81, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 190, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 82, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 191, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 83, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 192, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 84, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 193, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 85, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 194, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 86, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 195, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 87, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 196, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 88, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 197, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 89, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 198, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 90, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 199, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 91, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 200, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 92, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 201, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 93, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 202, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 94, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 203, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 95, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 204, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 96, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 205, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 97, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 206, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 98, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 207, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 99, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 208, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 100, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 209, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 101, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 210, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 102, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 211, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 103, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 212, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 104, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 213, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 105, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 214, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 106, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 215, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 107, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 216, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 108, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 217, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 109, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 218, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 110, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 219, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 111, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 220, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 112, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 221, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 113, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 222, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 114, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 223, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 115, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 224, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 116, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 225, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 117, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 226, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 118, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 227, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 119, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 228, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 120, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 229, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 121, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 230, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 122, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 231, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 123, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 232, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 124, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 233, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 125, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 234, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 126, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 235, or a modified sequence thereof; The positive chain has a sequence as shown in SEQ ID NO: 127, or a modified sequence of the sequence; and the negative chain has a sequence as shown in SEQ ID NO: 236, or a modified sequence of the sequence; the positive chain has a sequence as shown in SEQ ID NO: 129, or a modified sequence of the sequence; and the negative chain has a sequence as shown in SEQ ID NO: 238, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 130, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 239, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 131, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 240, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 243, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 252, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 244, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 253, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 245, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 254, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 246, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 255, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 247, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 256, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 248, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 257, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 249, or a modified sequence of the sequence; and the antisense chain has a sequence as shown in SEQ ID NO: 258, or a modified sequence of the sequence; The sense chain has a sequence as shown in SEQ ID NO: 250, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 259, or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 251, or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 260, or a modified sequence thereof.

[0079] In some implementations, the positive strand differs from any of the sequences in SEQ ID NO: 1~12, 25~127, 129~131, 243~251 by 1-3 nucleotides.

[0080] In some embodiments, the antisense strand differs from any of the sequences in SEQ ID NO: 13~24, 134~236, 238~240, 252~260 by 1-3 nucleotides.

[0081] In some preferred embodiments, the nucleotide sequence of the sense strand is as shown in any one of SEQ ID NO: 1~12, and the nucleotide sequence of the corresponding antisense strand is as shown in SEQ ID NO: 13~24.

[0082] In some implementations, the number of nucleotides in the sense strand may be the same as or different from the number of nucleotides in the antisense strand.

[0083] In some implementations, the sense strand has 19 nucleotides and the antisense strand has 19 nucleotides.

[0084] In some implementations, the sense strand has 20 nucleotides and the antisense strand has 19 nucleotides.

[0085] In some implementations, the sense strand has 20 nucleotides and the antisense strand has 20 nucleotides.

[0086] In some implementations, the sense strand has 19 nucleotides and the antisense strand has 20 nucleotides.

[0087] In some implementations, the sense strand has 19 nucleotides and the antisense strand has 21 nucleotides.

[0088] In some implementations, the sense strand has 20 nucleotides and the antisense strand has 21 nucleotides.

[0089] In some implementations, the sense strand has 21 nucleotides and the antisense strand has 21 nucleotides.

[0090] In some implementations, the sense strand has 19 nucleotides and the antisense strand has 22 nucleotides.

[0091] In some implementations, the sense strand has 20 nucleotides and the antisense strand has 22 nucleotides.

[0092] In some implementations, the sense strand has 21 nucleotides and the antisense strand has 22 nucleotides.

[0093] In some implementations, the sense strand has 19 nucleotides and the antisense strand has 23 nucleotides.

[0094] In some implementations, the sense strand has 20 nucleotides and the antisense strand has 23 nucleotides.

[0095] In some implementations, the sense strand has 21 nucleotides and the antisense strand has 23 nucleotides.

[0096] In some implementations, the sense strand has 23 nucleotides and the antisense strand has 23 nucleotides.

[0097] In some implementations, the sense strand and the antisense strand each independently contain at least one modified nucleotide.

[0098] In some embodiments, at least one modified nucleotide is selected from any or a combination of at least two of the following: deoxy-nucleotides, 3'-terminal deoxy-thymidine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluorine modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, non-locked nucleotides, configuration-restricted nucleotides, restricted ethyl nucleotides, base-free nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholinyl nucleotides, aminophosphates, nucleotides containing non-natural bases, tetrahydropyran-modified nucleotides, 1,5-dehydrohexyl-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphate groups, nucleotides containing 5'-phosphate groups, and nucleotides containing 5'-phosphate mimics.

[0099] In some implementations, at least one strand contains a 3' overhang of at least one nucleotide.

[0100] In some implementations, at least one strand contains a 3' overhang of at least two nucleotides.

[0101] In some implementations, the nucleotide modification on the sense and antisense strands is a 2' position modification of the nucleotide ribose.

[0102] In some embodiments, the modification at the 2' position of the nucleotide ribose is selected from any one or a combination of several of the following: 2'-methoxy modification, 2'-methoxyethyl modification, 2'-fluoro modification, 2'-benzyloxy modification, 2'-methylcarbonylamino modification, and 2'-pyridinemethoxy modification.

[0103] In some implementations, the 2' position of each nucleotide ribose is modified with a combination of 2'-methoxy and 2'-fluoro modifications.

[0104] In some implementations, the 2' position of each nucleotide ribose is modified by an alternating combination of 2'-methoxy and 2'-fluoro modifications.

[0105] In some implementations, the 2' position of each nucleotide ribose is modified as follows: the odd-numbered positions of the sense strand are all 2'-fluorinated, and the even-numbered positions are all 2'-methoxyinated; and the odd-numbered positions of the antisense strand are all 2'-methoxyinated, and the even-numbered positions are all 2'-fluorinated.

[0106] In some implementations, nucleotides are linked to each other by 3',5'-phosphodiester bonds.

[0107] In some implementations, nucleotides are linked to each other by 3',5'-phosphothioester bonds.

[0108] In some implementations, the siRNA duplex has alternating fluorine-oxygen modification or template modification.

[0109] In some embodiments, phosphorylation of the 5' carbon atom of the modified antisense 5'-terminal nucleotide glycoside includes, but is not limited to, the following 5'-phosphorylating groups: 5'-vinylphosphonate group (5'-E-VP); 5'-methylphosphonate group (5'-MP); 5'-C-methylphosphate group; 5'-thiophosphate group (5'-PS); 5'-phosphate group (5'-P), the structure of which is shown below: ; Where R represents hydrogen, hydroxyl, amino, or C. 1-4 Alkyl, aromatic, C 1-4 Alkoxy, C 1-4 Alkyl carbonyl amino or halogen; The bases are selected from adenine, guanine, cytosine, thymine, and uracil.

[0110] In some embodiments, the first two nucleotides at the 3' and / or 5' ends of the sense and / or antisense strands of the siRNA modifier are connected by a 3',5'-phosphothioester bond; for example, in some embodiments, a chiral pure 3',5'-phosphothioester bond is formed. In some embodiments, one, two, or three 3',5'-phosphothioester bonds may be present between the first four nucleotides at the 5' end of the sense and / or antisense strands, and one, two, or three 3',5'-phosphothioester bonds may be present between the first four nucleotides at the 3' end of the antisense strand.

[0111] In some implementations, the antisense chain is modified in any of the following ways:

[0112]

[0113] And / or, the chain of justice is modified in one of the following ways:

[0114] Wherein, 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; PS indicates that the nucleotide at the 5' end is connected to the adjacent nucleotide on its right by a 3',5'-thiophosphate bond; and EVP represents 5'-vinyl-(E)-phosphonate.

[0115] In some implementations, the antisense chain is modified by modification method A, and the justice chain is modified by modification method a; The antisense chain is modified by modification method B, and the justice chain is modified by modification method a. The antisense chain is modified by modification method C, and the justice chain is modified by modification method a. The antisense chain is modified by modification method C, and the justice chain is modified by modification method b. The antisense chain is modified by modification method D, and the justice chain is modified by modification method b. The antisense chain is modified by modification method E, and the justice chain is modified by modification method b. The antisense chain is modified by modification method F, and the justice chain is modified by modification method b. The antisense chain is modified by modification method G, and the justice chain is modified by modification method b; or The antisense chain is modified by the modification method H, and the justice chain is modified by the modification method b.

[0116] In some implementations, the antisense chain is modified in any of the following ways:

[0117]

[0118] And / or, the chain of justice is modified in one of the following ways:

[0119] Wherein, 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; PS indicates that the nucleotide at the 5' end is connected to the adjacent nucleotide on its right by a 3',5'-thiophosphate bond; and EVP represents 5'-vinyl-(E)-phosphonate.

[0120] In some implementations, the antisense chain is modified by modification A', and the justice chain is modified by modification a'; The antisense chain is modified by modification method B', and the justice chain is modified by modification method a'. The antisense chain is modified by the modification method C', and the justice chain is modified by the modification method a'. The antisense chain is modified by modification method C', and the justice chain is modified by modification method b'. The antisense chain is modified by the modification method D', and the justice chain is modified by the modification method b'. The antisense chain is modified by modification method E', and the justice chain is modified by modification method b'. The antisense chain is modified by the modification method F', and the justice chain is modified by the modification method b'. The antisense chain is modified by the modification method G', and the justice chain is modified by the modification method b'; or The antisense chain is modified by the modification method H', and the justice chain is modified by the modification method b'.

[0121] In some embodiments, the siRNA double strand is selected from any one or a combination of at least two of the following:

[0122]

[0123]

[0124]

[0125]

[0126]

[0127] In some embodiments, the siRNA duplex comprises any one or a combination of at least two of the oligonucleotide duplexes formed by the pairing of sense and antisense strands shown in Tables 5 and 12.

[0128] In some embodiments, the antisense strand and / or the sense strand employs a modifying group at any of the second to eleventh positions from the 5' end, or at least two of these positions. The modifying group is selected from UNA, GNA, or DNA, wherein the structures of UNA and GNA are as follows: ; The bases are selected from adenine, guanine, cytosine, thymine, and uracil.

[0129] In some preferred embodiments, the 7th position, or the 7th and 11th positions of the antisense strand, are replaced with DNA, while the nucleotides in the sense strand at the complementary pairing position with the 7th position of the antisense strand are also replaced with DNA.

[0130] This disclosure provides siRNA duplexes selected from any oligonucleotide duplexes formed by pairing sense and antisense strands as shown in Table 5, or a combination of at least two of them.

[0131] In some preferred embodiments, the siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes composed of sense and antisense strand pairings: The sense chain has a sequence as shown in SEQ ID NO: 261 or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 391 or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 262 or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 392 or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 263 or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 393 or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 264 or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 394 or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 265 or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 395 or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 266 or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 396 or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 267 or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 397 or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 268 or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 398 or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 269 or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 399 or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 270 or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 400 or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 271 or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 401 or a modified sequence thereof; The sense chain has a sequence as shown in SEQ ID NO: 272 or a modified sequence thereof; and the antisense chain has a sequence as shown in SEQ ID NO: 401 or a modified sequence thereof.

[0132] This disclosure also provides siRNA duplexes selected from any oligonucleotide duplexes formed by pairing sense and antisense strands as shown in Table 12, or a combination of at least two of them.

[0133] This disclosure provides an siRNA conjugate comprising a double-stranded siRNA as described herein and a conjugating group attached to the double-stranded siRNA.

[0134] The double-stranded ribonucleic acid (BRNA) and its modified form disclosed herein can optionally be linked to one or more conjugation groups. The conjugation group can be attached to the sense strand, antisense strand, or both strands at the 3' end, 5' end, or both ends. For example, the conjugation group is attached to the 3'-end or 5'-end of the sense strand. In a preferred embodiment, the conjugation group is attached to the 3' end of the sense strand. In one embodiment, the conjugation group has any GalNAc structure.

[0135] In some embodiments, the conjugating group is one or more GalNAc derivatives attached using divalent or trivalent branched connecting arms.

[0136] Typically, the conjugation group comprises at least one pharmaceutically acceptable target group, or further comprises a linker, and the siRNA, the linker, and the target group are sequentially linked. In some embodiments, there are 1-6 target groups. In some embodiments, there are 2-4 target groups. In some embodiments, there are 3 target groups. The conjugation group can be covalently or non-covalently linked to the siRNA molecule, and the linking site can be at the 3' or 5' end of the siRNA's sense strand, at the 5' end of the antisense strand, or within the siRNA's internal sequence. In some embodiments, the linking site is at the 3' end of the siRNA's sense strand.

[0137] In some implementations, the pharmaceutically acceptable targeting group may be a conventional ligand in the field of siRNA delivery, such as the various ligands described in WO2009082607A2, which are incorporated herein by reference in their entirety.

[0138] In some embodiments, each ligand is independently selected from a ligand capable of binding to a cell surface receptor. In some embodiments, at least one ligand is capable of binding to a hepatocyte surface receptor. In some embodiments, at least one ligand is capable of binding to a mammalian cell surface receptor. In some embodiments, at least one ligand is capable of binding to a human hepatocyte surface receptor. In some embodiments, at least one ligand is capable of binding to the liver surface desialylate glycoprotein receptor (ASGPR). The types of these ligands are well known to those skilled in the art, and their function is generally to bind to specific receptors on the surface of target cells, mediating the delivery of ligand-linked siRNA to the target cells.

[0139] In some embodiments, the pharmaceutically acceptable targeting group in the siRNA conjugate can be galactose or N-acetylgalactosamine, wherein the galactose or N-acetylgalactosamine molecule can be monovalent, divalent, trivalent, or tetravalent. That is, after the siRNA molecule forms an siRNA conjugate with a conjugate group containing a galactose or N-acetylgalactosamine molecule as a targeting group, the molar ratio of the siRNA molecule to the galactose or N-acetylgalactosamine molecule in the siRNA conjugate is 1:1, 1:2, 1:3, or 1:4. In some embodiments, when the siRNA is linked to a conjugate group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.

[0140] The targeting group can be linked to the siRNA molecule via a suitable adapter. Those skilled in the art can select a suitable adapter based on the specific type of the targeting group. For details on these adapters, the types of targeting groups, and the connection methods with siRNA, please refer to the disclosure of WO2015006740A2, which is incorporated herein by reference in its entirety.

[0141] In some embodiments, the structural formula of the conjugating group is, for example: , Wherein, X is a hydroxyl protecting group or H, the hydroxyl protecting group being selected from acetyl, benzoyl or isobutyryl; Y is an amine protecting group or H, the amine protecting group being selected from formyl, acetyl, propionyl, n-butyryl or isobutyryl; n is an integer from 0 to 20; q, r and s are each independently an integer from 1 to 7.

[0142] In some embodiments, the structure of the conjugating group is, for example: .

[0143] In some embodiments, the conjugating group is, for example:

[0144] Where X is oxygen, -N(Y)-, or sulfur; Y is C 1-4 Alkyl or C 6-10 Aryl; R1 is oxygen or sulfur; R2 represents hydrogen, -NH2, or C. 1-4 Alkyl, C 6-10 Aryl, C 1-4 Alkoxy or halogen; A is -(CH2) a -、-(CH2CH2O) b -、-((CH2) c NHCO) d -or-((CH2) c CONH) d - where a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5; B is -(CH2) e -, where e is an integer between 0 and 7; L is either -CONH- or -NHCO-; X1 is -(CH2) f -or-(CH2CH2O) f CH2-, f is an integer from 1 to 5; X2 is -(CH2) g - g is an integer from 1 to 6; X3 is oxygen or sulfur; Y1 is either 0 or 1; Y2 is 0, 1, or 2; When Y3 is 1, X4 is CH2; when Y3 is 2, X4 is CH; when Y3 is 3, X3 is carbon. m is an integer between 0 and 4; n is an integer between 0 and 4.

[0145] In some embodiments, the conjugating group has, for example, any of the following structures: , , ,or .

[0146] In some embodiments, the siRNA conjugates of this disclosure may have any of the following structures: , , , ,or .

[0147] In some embodiments, the conjugating group has, for example, the following structure:

[0148] Where X is oxygen, -N(Y)-, or sulfur; Y is C 1-4 Alkyl or C 6-10 Aryl; R1 is oxygen or sulfur; R2 represents hydrogen, -NH2, or C. 1-4 Alkyl, C 6-10 Aryl, C 1-4 Alkoxy or halogen; A is -(CH2) a -、-(CH2CH2O) b -、-((CH2) c NHCO) d -or-((CH2) c CONH) d - where a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5; B is -(CH2) e -, where e is an integer between 0 and 7; L is either -CONH- or -NHCO-; X1 is -(CH2) f -or-(CH2CH2O) f CH2-, f is an integer from 1 to 5; X2 is -(CH2) g - g is an integer from 1 to 6; X3 is oxygen or sulfur; Y1 is either 0 or 1; Y2 is 0, 1, or 2; When Y3 is 1, X4 is CH2; when Y3 is 2, X4 is CH; when Y3 is 3, X3 is carbon. m is an integer between 0 and 4; n is an integer between 0 and 4; q is an integer between 0 and 4.

[0149] In some embodiments, the conjugating group has, for example, any of the following structures: , , , ,or .

[0150] In some embodiments, the siRNA conjugates of this disclosure have, for example, any of the following structures: , , , ,or .

[0151] In some implementations, either or both of the sense and antisense strands of the siRNA duplex may be linked to conjugation groups G4, G5, G6, G7, G101, G102, G103, G105, or G106.

[0152] In some embodiments, either or both of the sense chain and antisense chain are connected to the conjugation group G5.

[0153] In some embodiments, the conjugation group is attached to the 3' end of the positive chain.

[0154] In some embodiments, the siRNA conjugate comprises any one or a combination of at least two of any oligonucleotide duplexes selected from the sense and antisense strand pairings shown in Tables 5, 12 and 16.

[0155] In some preferred embodiments, the siRNA conjugate is selected from any one or a combination of at least two of the siRNA conjugates formed by the pairing of sense and antisense strands shown in Table 16.

[0156] This disclosure also provides a nucleic acid protein complex comprising the double-stranded region of the aforementioned siRNA double strand or siRNA conjugate or the antisense strand of the double-stranded region, and a nuclease.

[0157] In this disclosure, the term "nucleic acid-protein complex" refers to the RNA-induced silencing complex (RISC) formed by the binding of siRNA to Argonaute protein (AGO). The siRNA is then unwound into a sense strand and an antisense strand. The sense strand is degraded, and the antisense strand (guide strand) RISC binds to a target mRNA homologous to the siRNA via base pairing. The RISC functions as a nuclease; the siRNA guides the RISC to cleave the homologous single-stranded mRNA, causing the mRNA to lose its function, i.e., it cannot be translated to produce protein, thus silencing the gene.

[0158] This disclosure also provides a recombinant vector comprising a nucleic acid molecule encoding a double-stranded siRNA as described herein.

[0159] In some embodiments, the vector backbone of the recombinant vector is selected from recombinant viroid-derived circular RNA vectors, tRNA, rRNA scaffolds, and chimeric tRNA / pre-miRNA vectors.

[0160] This disclosure also provides a recombinant cell comprising the aforementioned siRNA double strand or recombinant vector.

[0161] In some embodiments, the recombinant cells are selected from *Pseudomonas thiophile* and *Corynebacterium glutamicum* deficient in ribonuclease III.

[0162] As used herein, a “recombinant vector” is preferably a vector comprising a regulatory sequence operatively linked to a nucleotide sequence encoding the positive strand of a nucleic acid molecule contained herein. A “recombinant cell” is a cell in which at least one recombinant vector capable of expressing a nucleic acid molecule or at least one strand of such nucleic acid molecule has been introduced.

[0163] This disclosure also provides a method for preparing the siRNA described herein, the method comprising culturing the aforementioned recombinant cells and / or obtaining the siRNA by chemical synthesis.

[0164] This disclosure also provides a pharmaceutical composition comprising the siRNA duplex or siRNA conjugate of this disclosure, and a pharmaceutically acceptable carrier.

[0165] In one embodiment, a pharmaceutical composition comprising an iRNA as described herein and a pharmaceutically acceptable carrier is provided herein. Pharmaceutical compositions comprising siRNA duplexes or siRNA conjugates can be used to treat diseases or conditions associated with the expression or activity of the INHBE gene, such as metabolic disorders. Such pharmaceutical compositions are formulated based on delivery models. One example is a composition formulated for systemic administration via parenteral delivery, such as subcutaneous injection (SC).

[0166] Pharmaceutical compositions comprising the siRNA duplexes or siRNA conjugates of this disclosure may be, for example, solutions with or without a buffer solution or compositions containing a pharmaceutically acceptable carrier. Such compositions include, for example, aqueous or crystalline compositions, liposome formulations, micellar formulations, emulsions, and gene therapy carriers.

[0167] In the methods disclosed herein, the siRNA duplex or siRNA conjugate can be administered in a solution. A free siRNA can be administered in a non-buffered solution, such as physiological saline or water. Alternatively, the free siRNA can also be administered in a suitable buffered solution. The buffer solution may include acetate, citrate, alcohol-soluble gluten, carbonate, or phosphate, or any combination thereof. In a preferred embodiment, the buffer solution is phosphate-buffered saline (PBS). The pH and volumetric molar osmotic concentration of the buffer containing the iRNA agent can be adjusted to suit its administration to the subject.

[0168] In some embodiments, the buffer solution further comprises a reagent for controlling the molar osmotic pressure concentration of the solution, such that the molar osmotic pressure concentration is maintained at a desired value, such as the physiological value in human plasma. Solutes that can be added to the buffer solution to control the molar osmotic pressure concentration include (but are not limited to) proteins, peptides, amino acids, non-metabolitic polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the reagent for controlling the molar osmotic pressure concentration of the solution is a salt. In some embodiments, the reagent for controlling the molar osmotic pressure concentration of the solution is sodium chloride or potassium chloride.

[0169] The pharmaceutical compositions disclosed herein can be administered at a dose sufficient to inhibit the expression of the INHBE gene. Typically, the suitable dose of the siRNA disclosed herein is in the range of about 0.001 to about 200.0 mg per kilogram of body weight per day, usually in the range of about 1 to 50 mg per kilogram of body weight per day. For example, RNAi agents (e.g., siRNA duplexes) can be administered at doses of about 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3. 3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18. 5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 mg / kg.

[0170] The pharmaceutical composition can be administered once daily, or multiple times at different time intervals from 1 to 365 days, or the siRNA can be administered two, three, or more sub-dose at appropriate intervals within a year, or even administered via continuous infusion or delivery using a controlled-release formulation. In this case, the amount of siRNA contained in each sub-dose must be correspondingly less to achieve the total daily dose. Dosage units can also be compounded for delivery over several days, for example using conventional sustained-release formulations that provide sustained siRNA release over a timeframe of several days. Sustained-release formulations are well known in the art and are particularly useful for delivering reagents at specific sites, thus allowing their use with the reagents disclosed herein. In this embodiment, the dosage unit comprises a corresponding plurality of daily doses.

[0171] In other embodiments, a single dose of the pharmaceutical composition can be administered continuously, with subsequent doses given at intervals of no more than 3, 4, or 5 days, or at intervals of no more than 1, 2, 3, or 4 weeks. In some embodiments of this disclosure, a single dose of the pharmaceutical composition of this disclosure is given weekly. In other embodiments of this disclosure, a single dose of the pharmaceutical composition of this disclosure is given every two months.

[0172] Those skilled in the art will understand that certain factors can influence the dosage and timing required to effectively treat a subject, including (but not limited to) the severity of the disease or condition, previous treatments, the subject's overall health and / or age, and other pre-existing conditions. Furthermore, treating a subject with a therapeutically effective dose of the composition may comprise a single treatment or a series of treatments. As described elsewhere herein, the effective dose and in vivo half-life of the individual siRNAs covered by this disclosure can be estimated using conventional methods or based on in vivo testing using suitable animal models.

[0173] Depending on whether local or systemic treatment is desired and depending on the area to be treated, the pharmaceutical compositions of this disclosure can be administered in a variety of ways. Administration can be local (e.g., via a skin patch); pulmonary; such as by inhalation or blowing in a powder or aerosol, including via a nebulizer; intratracheal; intranasal; epidermal; and percutaneous, oral, or parenteral administration. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subdermal, for example, via an implanted device; or intracranial, such as administration within the brain parenchyma, intrasheath, or ventricle.

[0174] The siRNA used in the compositions and methods of this disclosure can be formulated for delivery in membrane-bound molecular assemblages, such as liposomes or micelles. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids disposed in at least one lipid bilayer (e.g., one or more lipid bilayers), having an outer membrane formed of a lipophilic material and an aqueous portion located within. This lipophilic material separates the aqueous interior from the aqueous exterior, which typically does not include the siRNA composition (although in some instances it may include it). Liposomes are useful for the transfer and delivery of active ingredients to sites of action. Because the liposome membrane is structurally similar to a biological membrane, when a liposome is applied to a tissue, the liposome bilayer fuses with the cell membrane bilayer. As the liposome fuses with the cell, the aqueous contents, including the siRNA, are delivered into the cell, where the siRNA can specifically bind to a target RNA and can mediate RNA interference (RNAi). In some cases, these liposomes are also specifically targeted, for example, to guide the siRNA to a specific cell type.

[0175] Liposomes containing RNAi agents can be prepared by various methods. In one example, the lipid component of the liposome is dissolved in a detergent to form micelles. For example, the lipid component can be an amphiphilic cationic lipid or a lipid conjugate. The detergent can have a high critical micelle concentration and can be nonionic. Exemplary detergents include bile salts, CHAPS, octyl glucoside, deoxycholate, and lauroyl sarcosine. The RNAi agent formulation is then added to micelles containing the lipid component. The cationic groups on the lipid interact with the RNAi agent and condense around the RNAi agent to form liposomes. After condensation, the detergent is removed, for example by dialysis, to obtain the liposomal formulation of the RNAi agent.

[0176] RNAi agents, such as the siRNA duplexes disclosed herein, can be completely encapsulated in lipid formulations (e.g., LNPs or other nucleic acid-lipid particles).

[0177] As used herein, the term "LNP" refers to a stable nucleic acid-lipid particle. An LNP contains a cationic lipid, a non-cationic lipid, and a lipid that prevents the particle from accumulating (e.g., a PEG-lipid conjugate). LNPs are extremely useful for synthetic applications because they exhibit prolonged cycle life after intravenous (iv) injection and accumulate at distal sites (e.g., at sites physically separate from the administration site).

[0178] In one embodiment, the mass ratio of lipids to the drug is about 1:1 to about 50:1, about 1:1 to about 25:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1.

[0179] In some preferred embodiments, the lipid nanoparticles include cationic lipids, neutral lipids, structural lipids, and polymer-conjugated lipids.

[0180] In some preferred embodiments, the cationic lipid is a compound of formula (I), or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein G1 is C 1～6 Alkylene; G2 is C 2～8 Alkylene; G3 is C 1～3 Alkylene; L1 is C 6～15 Straight-chain alkyl; L2 is C 12～25 Branched alkyl groups. For example, YK-009 with the structure of formula (II) (see patent CN114044741B).

[0181] (I) (II).

[0182] In some preferred embodiments, the cationic lipid is a compound of formula (II), or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein: G1 is C 2~8 Alkylene; G2 is C 2~8 Alkylene; L1 is -C(O)O- or -OC(O)-; L2 is -C(O)O- or -OC(O)-; R1 is C 6~25 Straight-chain or branched alkyl; R2 is C 6~25 Straight-chain or branched alkyl; G3 is HO(CH2)2- or HO(CH2)3-; G4 is HO(CH2)2- or HO(CH2)3-; L is (CH2)2- or -(CH2)3- or -(CH2)4-. For example, YK-401 with formula (II-I), YK-402 with formula (II-II), YK-407 with formula (II-III), etc. (see patent CN115784921B, the entire contents of which are incorporated herein by reference, including, in particular, the general formula and specific compounds therein).

[0183] (II) (II-I) (II-II) (II-III).

[0184] In some preferred embodiments, the cationic lipid is a compound of formula (III), or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein: G1 is C 1~6 Alkylene; G2 is C 2~8 Alkylene; R1 is C 6~20 Straight-chain or branched alkyl; R2 is C 12~25 Branched alkyl groups; G3 is: HO(CH2)2N(CH3)(CH2)2-, HO(CH2)2N(CH2CH3)(CH2)2-, (HO(CH2)2)2N(CH2)2-, CH3O(CH2)2N(CH3)(CH2)2-, (CH3)2N(CH2)3SC(O)O(CH2)2-, (CH3)2N(CH2)3SC(O)-, CH3NH(CH2)2N(CH3)(CH2)2-, or CH3CH2NH(CH2)2-. For example, YK-201 with formula (III-I) structure, YK-202 with formula (III-II) structure, etc. (see patent CN115677518B, the entire contents of which are incorporated herein by reference, including, in particular, the general formula and specific compounds therein).

[0185] (III) (III-I) (III-II).

[0186] In some preferred embodiments, the cationic lipid is a compound of formula (IV), or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein G1 is C 1~8 Alkylene; G2 is C 2~8 Alkylene; R1 is C 6~25 Straight-chain or branched alkyl; R2 is C 12~25 Straight-chain or branched alkyl group; G3 is: HO(CH2)2N(R3)CH2CH(OH)CH2-, where R3 is -CH3, -CH2CH3, or -CH2CH2OH. For example, YK-305 with formula (IV-I) and YK-310 with formula (IV-II) (see patent CN115745820B, the entire contents of which are incorporated herein by reference, including, in particular, the general formula and specific compounds therein).

[0187] (IV) (IV-I) (IV-II).

[0188] In some preferred embodiments, the cationic lipid is a compound of formula (V), or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein G 1 and G 2 Each is independently unsubstituted C6-C 10 Alkylene; G 3 For unsubstituted C1-C 12 Alkylene; R 1 and R 2 Each independently is C6-C 24 Alkyl or C6-C 24 alkenyl; R 3 OR 5 N, -C (=O) OR 4 -OC(=O)R 4 or -NR 5 C(=O)R 4 ;R 4 For C1-C 12 hydrocarbon group; and R 5 It is an H or C1-C6 hydrocarbon group; for example, ALC0315 of formula (VI) (see patent CN108368028B, the entire contents of which are incorporated herein by reference, including, in particular, the general formula and specific compounds therein). (V) (VI).

[0189] In some preferred embodiments, the cationic lipid is a compound of formula (VI), or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein R4 is selected from -(CH2). n Q and -(CH2) n CHQR; Q is selected from the following groups: -OR, -OH, -O(CH2). nN(R)2, -OC(O)R, -CX3, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)2R, -N(H)S(O)2R, -N(R)C(O)N(R)2, -N(H)C(O)N(R)2, -N(H)C(O)N(H)(R), -N(R)C(S)N(R)2, -N(H)C(S)N(R)2, -N(H)C(S)N(H)(R), -N(R)S(O)2R8 and heterocycles; n is 1, 2 or 3; for example, SM102 of formula (VI-I) (see patent application CN110520409A, the entire contents of which are incorporated herein by reference, including, in particular, the general formula and specific compounds therein).

[0190] (VI) (VI-I).

[0191] In some preferred embodiments, the cationic lipid is a compound of formula (VII), or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer (see patent CN102625696B, DLIN-MC3-DMA, the entire contents of which are incorporated herein by reference, including, in particular, the general formula and specific compounds therein).

[0192] (VII) (DLIN-MC3-DMA).

[0193] In some preferred embodiments, the cationic lipid is selected from any one or a combination of at least two of the group consisting of YK-009, YK-401, YK-305, ALC0315, SM102 and DLIN-MC3-DMA.

[0194] In some preferred embodiments, the molar ratio of the cationic lipid to the neutral lipid is 1:1 to 10:1.

[0195] In some preferred embodiments, the molar ratio of the cationic lipid to the structural lipid is 1:1 to 5:1.

[0196] In some preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is (25~65):(5~25):(25~70):(0.5~5).

[0197] In some preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is (25~65):(5~25):(25~45):(0.5~5).

[0198] In some more preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is 50:10:38.5:1.5 or 49:10:39.5:1.5.

[0199] In some preferred embodiments, the neutral lipid is selected from any one or a combination of at least two of the group consisting of phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, sterols and their derivatives.

[0200] In some preferred embodiments, the neutral lipid is selected from any or a combination of at least two of the following: 1,2-dilinoleoyl-sn-glycerol-3-phosphate choline (DLPC), 1,2-dimyristoyl-sn-glycerol-3-phosphate choline (DMPC), 1,2-dioleoyl-sn-glycerol-3-phosphate choline (DOPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphate choline (DPPC), 1,2-distearateoyl-sn-glycerol-3-phosphate choline (DSPC), 1,2-diundecanoyl-sn-glycerol-3-phosphate choline (DUPC), 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphate choline (POPC), 1,2-di-O-octadecenyl-sn-glycerol-3-phosphate choline (18:0 Diether 1,2-Dilinoleoyl-sn-glycerol-3-phosphate choline (OChemsPC), 1-hexadecyl-sn-glycerol-3-phosphate choline (C16 Lyso PC), 1,2-dilinoleoyl-sn-glycerol-3-phosphate choline, 1,2-disarachidonicoyl-sn-glycerol-3-phosphate choline, 1,2-bis(docohexanoyl-sn-glycerol-3-phosphate choline), 1,2-dioleoyl-sn-glycerol-3-phosphate ethanolamine (DOPE), 1,2-diphydanyl-sn-glycerol-3-phosphate ethanolamine (ME) 16.0PE), 1,2-distearyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinoleoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinolenoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-diarachidonicoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-bis(docosahexaenoicoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dioleoyl-sn-glycerol-3-phosphate-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoyl 1-Steayl-2-oleoyl-stearoyl-ethanolamine (POPE), 1-stearoyl-2-oleoyl-stearoyl-ethanolamine (DSPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl-phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), and mixtures thereof.

[0201] In some preferred embodiments, the neutral lipid is DOPE and / or DSPC.

[0202] In some preferred embodiments, the structural lipid is selected from any or at least a combination of the following: cholesterol, nonsterols, sitosterol, ergosterol, campesterol, stigmasterol, brassosterol, tomatine, ursolic acid, α-tocopherol, and corticosteroids.

[0203] In some preferred embodiments, the structural lipid is cholesterol.

[0204] In some preferred embodiments, the polymeric conjugated lipid is selected from any or a combination of at least two of the following: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol.

[0205] In some preferred embodiments, the polymeric conjugated lipid is selected from any or a combination of at least two of the following: distearate phosphatidylethanolamine polyethylene glycol 2000 (DSPE-PEG2000), dimyristoylglycerol-3-methoxy polyethylene glycol 2000 (DMG-PEG2000), and methoxy polyethylene glycol bis(tetradecyl acetamide) (ALC-0159).

[0206] Examples of pharmaceutical compositions disclosed herein include, but are not limited to, aqueous formulations, emulsion formulations, and liposome-containing formulations. These compositions can be derived from a variety of components, including, but not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semi-solids. For example, formulations targeting the liver are preferred when treating liver conditions such as liver cancer.

[0207] The pharmaceutical formulations disclosed herein (which can be conveniently presented in unit dosage forms) can be prepared using conventional techniques well known in the pharmaceutical industry. Such techniques include steps such as combining the active ingredients with the drug carrier or excipient. Generally, these formulations are prepared by uniformly and finely combining the active ingredients with a liquid carrier or a finely dispersed solid carrier, or both, and, if necessary, shaping the product.

[0208] The compositions disclosed herein can be formulated into any of a number of possible dosage forms, including, but not limited to, tablets, capsules, gelatin capsules, liquid syrups, soft capsules, suppositories, and enemas. The compositions disclosed herein can also be formulated as suspensions in aqueous, non-aqueous, or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension, such substances including, for example, sodium carboxymethyl cellulose, sorbitol, and / or dextran. The suspension may also contain stabilizers.

[0209] Some compositions of this disclosure also incorporate a carrier compound into the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid or its analogue that is inert (i.e., not biologically active in itself) but is considered a nucleic acid in vivo, for example by reducing the bioavailability of biologically active nucleic acids by degrading them or promoting their removal from circulation. Co-administration of nucleic acids and carrier compounds (generally in excess of the latter) can result in a significant reduction in the amount of nucleic acid recovered from the liver, kidneys, or other external circulation reservoirs, presumably due to competition for a common receptor between the carrier compound and the nucleic acid. For example, when co-administered with polyinosinic acid, dextran sulfate, polycytidine, or 4-acetamido-4'-isothiocyanate 2,2'-disulfonic acid, the recovery of partially thiophosphorylated dsRNA in liver tissue can be reduced (Miyao et al., DsRNA Research and Development, 1995, 5, 115-121; Takakura et al., DsRNA & Nucleic Acid Drug Development, 1996, 6, 177-183).

[0210] Compared to carrier compounds, a "drug carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent, or other pharmaceutically inert medium used to deliver one or more nucleic acids to animals. The excipient can be liquid or solid, and when combined with nucleic acids and other components of a particular pharmaceutical composition, the excipient is selected to provide desired volume, consistency, etc., with reference to the intended manner of administration. Typical drug carriers include, but are not limited to, binders (e.g., pregelatinized corn starch, polyvinylpyrrolidone, or hydroxypropyl methylcellulose); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylate, or dicalcium phosphate); lubricants (e.g., magnesium stearate, talc, silica, colloidal silica, stearic acid, metal stearates, hydrogenated vegetable oils, corn starch, polyethylene glycol, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulfate, etc.).

[0211] Pharmaceutically acceptable organic or inorganic excipients that are suitable for non-parenteral administration, do not react toxically with nucleic acids, and are suitable for formulation of the compositions disclosed herein may also be used. Suitable pharmaceutically acceptable carriers include, but are not limited to: water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl cellulose, polyvinylpyrrolidone, etc.

[0212] Formulations for topical administration of nucleic acids may include sterile or non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohol, or nucleic acid solutions in liquid or solid oil matrices. These solutions may also include buffers, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration and not toxic to nucleic acids may be used.

[0213] Suitable pharmaceutically acceptable excipients include, but are not limited to: water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl cellulose, polyvinylpyrrolidone, etc.

[0214] This disclosure also provides methods for treating and / or preventing diseases and / or conditions that can be regulated by downregulating INHBE gene expression. The diseases and / or conditions mentioned include, but are not limited to, type 2 diabetes, hyperlipidemia or dyslipidemia (high or altered circulating levels of low-density lipoprotein cholesterol (LDL-C), triglycerides, very low-density lipoprotein cholesterol (VLDL-C), apolipoprotein B or other lipid fractions), obesity (especially abdominal obesity), lipodystrophy (such as the inability to deposit fat locally in fat deposits (partial lipodystrophy) or the inability to deposit fat throughout the body (lipoatrophy)), insulin resistance or higher or altered insulin levels during fasting or metabolic challenges, hepatic steatosis or fatty liver disease and its complications (such as, for example, cirrhosis, fibrosis or liver inflammation), non-alcoholic steatohepatitis, other types of liver inflammation, liver enzyme levels or liver damage, higher or elevated or altered other markers of inflammation or steatosis in the liver, higher and / or hypertension, higher or hyperglycemia or blood glucose, metabolic syndrome, coronary artery disease and other atherosclerotic conditions, and complications of each of the above conditions, as well as any other diseases associated with elevated INHBE levels and other unidentified related conditions, pathologies or syndromes.

[0215] The siRNA disclosed herein can be administered to a subject using any route of administration known in the art, including (but not limited to) subcutaneous, intravenous, intramuscular, intraocular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, cerebrospinal, and any combination thereof. In a preferred embodiment, these agents are administered subcutaneously.

[0216] In another embodiment, siRNA is administered in combination with another therapeutic agent. The siRNA and the other therapeutic agent may be administered in combination in the same composition, for example, parenterally, or the other therapeutic agent may be administered as part of a separate composition or by another method described herein.

[0217] Examples of other therapeutic agents include those known for treating INHBE-related diseases or conditions. For example, other therapeutic agents include: administering one or more siRNAs of this disclosure to a subject; administering a non-INHBE RNAi therapeutic agent to a subject; and inducing behavioral changes in a subject. In some embodiments, the non-INHBE RNAi therapeutic agent is selected from any one or a combination of at least two of the following: insulin, glucagon-like peptide-1 agonists, sulfonylureas, seglitinide, biguanides, thiazolidinediones, alpha-glucosidase inhibitors, SGLT2 inhibitors, DPP-4 inhibitors, HMG-CoA reductase inhibitors, and statins.

[0218] In one embodiment, the iRNA agent is given to the patient, and then another therapeutic agent is given to the patient (or vice versa). In another embodiment, the iRNA agent and another therapeutic agent are given simultaneously.

[0219] In another aspect, this disclosure provides a kit comprising a box A, which includes one or more of the aforementioned siRNA duplexes, siRNA conjugates, nucleic acid-protein complexes, or pharmaceutical compositions.

[0220] In some embodiments, the pillbox further includes a pillbox B, which contains one or more of the following: (1) Other drugs that reduce INHBE gene expression or compositions containing the drugs that reduce INHBE gene expression; (2) One or more of the following groups: insulin, glucagon-like peptide-1 agonist, sulfonylurea, seglinide, biguanide, thiazolidinedione, α-glucosidase inhibitor, SGLT2 inhibitor, DPP-4 inhibitor, HMG-CoA reductase inhibitor, and statins.

[0221] The “other drugs that reduce INHBE gene expression or compositions containing the drugs that reduce INHBE gene expression” mentioned herein refer to drugs that do not contain the siRNA duplexes, siRNA conjugates or drug compositions provided in this disclosure.

[0222] This disclosure also provides the use of the aforementioned siRNA duplexes, siRNA conjugates, recombinant vectors, recombinant cells, or pharmaceutical compositions in the preparation of medicaments for the prevention and / or treatment of INHBE gene expression-related diseases.

[0223] In some implementations, the INHBE gene expression-related diseases are selected from the following disease types: type 2 diabetes, hyperlipidemia or dyslipidemia (high or altered circulating levels of low-density lipoprotein cholesterol (LDL-C), triglycerides, very low-density lipoprotein cholesterol (VLDL-C), apolipoprotein B or other lipid fractions), obesity (especially abdominal obesity), lipodystrophy (such as the inability to deposit fat locally in fat deposits (partial lipodystrophy) or the inability to deposit fat throughout the body (lipoatrophy)), insulin resistance or higher or altered insulin levels during fasting or metabolic challenges, hepatic steatosis or fatty liver disease and its complications (e.g., cirrhosis, fibrosis or liver inflammation), non-alcoholic steatohepatitis, other types of liver inflammation, liver enzyme levels or liver damage, higher or altered or elevated other markers of inflammation or steatosis in the liver, higher and / or hypertension, higher or hyperglycemia or blood glucose, metabolic syndrome, coronary artery disease and other atherosclerotic conditions, and complications of each of the above conditions.

[0224] This disclosure also provides a method for reducing INHBE gene expression or inhibiting INHBE replication for non-preventive and / or therapeutic purposes, the method comprising administering one or more of the aforementioned siRNA, conjugates, pharmaceutical compositions, and kits to a sample.

[0225] The term "non-preventive and / or therapeutic" as used in this article refers to reducing INHBE gene expression or inhibiting INHBE replication for research purposes, such as in a laboratory setting.

[0226] This disclosure also provides the siRNA, conjugates, pharmaceutical compositions and / or kits described herein for the prevention and / or treatment of INHBE gene expression-related diseases.

[0227] This disclosure also provides methods for treating and / or preventing diseases and conditions that can be regulated by downregulating INHBE gene expression. For example, treatment of metabolic conditions associated with body fat distribution, including but not limited to: type 2 diabetes, hyperlipidemia or dyslipidemia (high or altered circulating levels of low-density lipoprotein cholesterol (LDL-C), triglycerides, very low-density lipoprotein cholesterol (VLDL-C), apolipoprotein B or other lipid fractions), obesity (especially abdominal obesity), lipodystrophy (such as the inability to deposit fat locally in fat deposits (partial lipodystrophy) or the inability to deposit fat throughout the body (lipomatosis)), insulin resistance or higher or altered insulin levels during fasting or metabolic challenges, hepatic steatosis or fatty liver disease and its complications (e.g., cirrhosis, fibrosis or liver inflammation), non-alcoholic steatohepatitis, other types of liver inflammation, liver enzyme levels or liver damage, higher or altered or elevated other markers of inflammation or steatosis in the liver, higher and / or hypertension, higher or hyperglycemia or blood glucose, metabolic syndrome, coronary artery disease and other atherosclerotic conditions, and complications of each of the above conditions.

[0228] In some embodiments, the method includes administering a therapeutic and / or preventative effective amount of the siRNA, conjugate, and / or pharmaceutical composition described in this disclosure to a subject in need, or administering it to the subject in need using a kit as described in this disclosure.

[0229] The RNAi agents disclosed herein can be administered to a subject using any route of administration known in the art, including (but not limited to) subcutaneous, intravenous, intramuscular, intraocular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, cerebrospinal, and any combination thereof. In a preferred embodiment, these agents are administered subcutaneously.

[0230] In another embodiment, siRNA is administered in combination with an additional therapeutic agent. The siRNA and the additional therapeutic agent may be administered in combination in the same composition, for example, parenterally, or the additional therapeutic agent may be administered as part of a separate composition or by another method described herein.

[0231] Other examples of therapeutic agents include those known to treat metabolic disorders or cardiovascular diseases, including but not limited to insulin, glucagon-like peptide-1 agonists (e.g., exenatide, liraglutide, duraglutide, semaglutide, and pramlintide), sulfonylureas (e.g., chlorpropamide, glipizide), stiglinide (e.g., repaglinide, nateglipizide), biguanides (e.g., metformin), thiazolidinediones (e.g., rosiglitazone, troglitazone), and alpha-glucosidase inhibitors (e.g., acarbose and megglitazone). SGLT2 inhibitors (e.g., dapagliflozin), DPP-4 inhibitors (e.g., linagliptin), or HMG-CoA reductase inhibitors, such as statins like atorvastatin (Lipotor), fluvastatin (Lescol), lovastatin (Mevacor), lovastatin extended release (Altoprev), pitavastatin (Livalo), pravastatin (Pravachol), rosuvastatin (Crestor), and simvastatin (Zocor).

[0232] In one embodiment, the siRNA agent is given to the patient, and then another therapeutic agent is given to the patient (or vice versa). In another embodiment, the siRNA agent and another therapeutic agent are given simultaneously.

[0233] The present disclosure is further illustrated below by way of embodiments, but these embodiments are not intended to limit the scope of the present disclosure. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected in accordance with the product instructions.

[0234] Unless otherwise specified, all reagents and raw materials used in this disclosure are commercially available.

[0235] The nucleotide abbreviations for this article are as follows: A = Adenosine-3'-phosphate Am = 2'-methoxyadenosine-3'-phosphate Ams = 2'-methoxyadenosine-3'-thiophosphate Af = 2'-Fluoroadenosine-3'-phosphate Afs = 2'-Fluoroadenosine-3'-Thiophosphate G = Guanosine-3'-phosphate Gm = 2'-methoxyguanosine-3'-phosphate Gms = 2'-methoxyguanosine-3'-thiophosphate Gf=2'-Fluoroguanosine-3'-phosphate Gfs = 2'-Fluoroguanosine-3'-Thiophosphate C=cytidine-3'-phosphate Cm = 2'-methoxycytidine-3'-phosphate Cms = 2'-methoxycytidine-3'-thiophosphate Cf = 2'-Fluorocytidine-3'-phosphate Cfs = 2'-Fluorocytidine-3'-Thiophosphate U = uridine-3'-phosphate Um = 2'-methoxyuridine-3'-phosphate Ums = 2'-methoxyuridine-3'-thiophosphate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-thiophosphate AmsEVP = 5'-vinyl-(E)-phosphonate-2'-methoxyadenosine-3'-thiophosphate UmsEVP = 5'-vinyl-(E)-phosphonate-2'-methoxyuridine-3'-thiophosphate Agna = Adenosine-diol nucleic acid Cgna = Cytidine-diol nucleic acid Ggna = Guanosine-diol nucleic acid Tgna = Thymidine-diol nucleic acid Ugna = uridine-diol nucleic acid Examples of the code rules for siRNA motifs (or motifs), siRNA modifications, siRNA conjugates, etc., in this article are as follows: The siRNA motif is an unmodified siRNA.

[0236] Sequences with alternating modifications of 2'-methoxy (2'-OMe) and 2'-fluorine (2'-F) are prefixed with "-AL" after the motif number. For example, alternating modifications are designated as si075-AL, si751-AL, etc.

[0237] For siRNA modifiers modified using templates disclosed herein, such as DV25P~DV29P, DV32P~DV34P, DV41P~DV43P, and DV25SP~DV43SP, the corresponding designation rule is as follows: the name of the corresponding template is added after the motif. For example, for the motif si751, the modifier obtained after modification with the DV25P template is designated as si751-DV25P.

[0238] For siRNA conjugates, the name of the conjugate group, such as "G103" or "G101", is added to the end of the corresponding modifier's designation. For example, the modifier si751-DV25P linked to the conjugate group G101 has the designation si751-DV25PG101. Some conjugates, in addition to the modification of the template, may further have anti-off-target modifications (e.g., d7B or d7B11). The designation of such conjugates containing both a template and an anti-off-target modification is to sequentially add the corresponding template name and the anti-off-target modification name after the designation of the corresponding motif, and then add the name of the conjugate group, such as "G103" or "G101", to the end.

[0239] Examples of siRNA double-stranded (motif, modification, conjugate) designations in this disclosure

[0240] Example

[0241] In the following examples, the p-values ​​for inter-group comparisons were <0.05, indicating statistical significance.

[0242] Other objects, features, and advantages of this disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific embodiments (although illustrating specific implementations of this disclosure) are given for illustrative purposes only, as various changes and modifications that can be made within the spirit and scope of this disclosure will become apparent to those skilled in the art upon reading this detailed description.

[0243] Unless otherwise specified, the experimental techniques and methods used in this embodiment are conventional techniques and methods. For example, experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in the embodiments are commercially available.

[0244] Those skilled in the art will understand that, in the various embodiments of this disclosure, when the test substance in the experiment is an siRNA conjugate, it includes, but is not limited to, inhibition rate, IC50. 50 IC 40 The experimental data and results can reflect the inhibition rate and IC50 of the corresponding siRNA modifier of the siRNA conjugate. 50 IC 40 This presents no obstacle to understanding for those skilled in the art.

[0245] Example 1: Inhibition of the INHBE gene by siRNA motifs

[0246] In this embodiment, siRNA motifs as shown in Table 1 were designed and synthesized based on the INHBE mRNA sequence (NM_031479.5), and transfected into Huh7 cells via lipid nanoparticles (LNP). The inhibitory effect of each siRNA motif on the INHBE gene was detected by qPCR, and siRNA motifs with better inhibitory effects were screened out.

[0247] 1. Experimental Materials

[0248] Test samples: siRNA motifs in Table 1.

[0249] Cell type: Huh7 liver cancer cell line (Guangzhou Darui Biotechnology, DR-Cell-01).

[0250] Drug solvent: sterile enzyme-free water, Gibco Opti-MEM.

[0251] 2. Synthesis of siRNA motifs

[0252] Instruments and reagents: CYTiva 192 P model DNA / RNA automated synthesizer, with cross-linked polystyrene beads as the solid carrier, model Primer support 5G Unylinker 350 (Cytiva manufacturer).

[0253] Preparation method: Based on a monomer concentration of 0.15 M, the following nucleotide monomer solutions were prepared with acetonitrile: DMT-A-2'-O-TBDMS phosphoramide monomer (Formula 1), DMT-C-2'-O-TBDMS phosphoramide monomer (Formula 2), DMT-G-2'-O-TBDMS phosphoramide monomer (Formula 3), and DMT-U-2'-O-TBDMS phosphoramide monomer (Formula 4).

[0254] Formula 1 Formula 2 Formula 3 Formula 4 Nucleoside monomers are linked sequentially from 3' to 5' along the nucleotide arrangement using a solid-phase phosphorous acid method. Each linkage of a nucleoside monomer involves four steps: deprotection, coupling, oxidation or sulfidation, and hydroxyl protection. Specifically, when two nucleotides are linked using a phosphate ester, the linkage of the subsequent nucleoside monomer involves these four steps. When two nucleotides are linked using a phosphate thioester, the linkage of the subsequent nucleoside monomer involves these four steps.

[0255] Prepared using the following steps: A solid support was loaded into the designated position of the synthesizer, and the corresponding product was obtained after several synthesis cycles. The synthesis cycle included (1) deprotection, (2) coupling, (3) oxidation / sulfidation and (4) hydroxyl protection. The cycle process and the reagents used are described below: (1) Deprotection The DMT protecting group was removed using a 3% dichloroacetic acid toluene solution as a deprotecting agent, followed by washing with acetonitrile.

[0256] (2) Coupling

[0257] The acetonitrile solution of each nucleotide monomer was coupled using 0.25 M 5-ethylthiotetrazole as an activator, followed by rinsing with acetonitrile.

[0258] (3) Oxidation / sulfidation

[0259] Oxidation: Oxidation was performed using a 0.05 M iodine pyridine / water (90 / 10) solution as the oxidant, followed by rinsing with acetonitrile.

[0260] Vulcanization: Vulcanization was carried out using a pyridine solution of 3% hydroxanthin as a vulcanizing agent, followed by rinsing with acetonitrile.

[0261] (4) Hydroxyl protection

[0262] Hydroxyl protection was performed using a 10% acetic anhydride tetrahydrofuran solution (CAP A) tetrahydrofuran / pyridine / N-methylimidazole 74 / 10 / 16 (v / v / v) (CAP B) as the hydroxyl protecting agent, followed by rinsing with acetonitrile.

[0263] Repeat the above steps in a cyclical manner according to the set nucleotide arrangement order to obtain a product with a specific sequence arrangement of the sense strand or the antisense strand.

[0264] (5) Use 3% dichloroacetic acid toluene solution as a deprotection agent to remove the DMT protecting group of the last nucleotide, and then wash with acetonitrile.

[0265] (6) Ammonolysis and purification

[0266] The reacted solid support was transferred to a reactor, and concentrated ammonia (25-28%, mass percentage) was added. After ammonolysis was maintained at 60°C for 12 h, the system was cooled to room temperature, and the mixture was filtered. The filter cake was washed with a mixture of purified water and ethanol. The filtrates were combined, passed through a chromatography column, concentrated, and lyophilized to obtain the 2'-O-TBDMS protected product.

[0267] (7) Remove TBDMS

[0268] DMSO and triethylamine hydrofluoric acid were added to the obtained product, and the reaction was carried out at 60°C for 2 hours. Then, ammonium acetate aqueous solution was added to the reaction solution, and the mixture was shaken to mix. Anhydrous ethanol was added, and the mixture was shaken to mix. Crystallization was carried out at -20°C for 8-12 hours. After centrifugation, the supernatant was discarded, and the precipitate was washed with anhydrous ethanol to obtain the unmodified single-chain product.

[0269] (8) Annealing

[0270] The sense and antisense strands of the obtained siRNA motif were mixed in a 1:1 molar ratio, heated to 95°C and held for 3 minutes, and then slowly cooled to room temperature to form a double strand of the siRNA motif.

[0271] Synthesize the siRNAs listed in Table 1 using the methods described above.

[0272] Table 1: siRNA motifs

[0273]

[0274]

[0275] 3. Experimental Methods

[0276] The experimental method for the inhibitory effect of siRNA motifs on the INHBE gene is the same as that provided in other embodiments of the present invention, that is, the final siRNA concentration per well is 0.07 nM, the only difference being that the test sample is an siRNA motif.

[0277] 4. Experimental Results

[0278] The inhibition rate of INHBE mRNA expression by the basic sequence is shown in Table 2 below.

[0279] Table 2

[0280] Example 2: Inhibition of the INHBE gene by DV29P template-modified siRNA

[0281] 2.1 Design and synthesis of siRNA modifiers based on DV29P template

[0282] To improve the inhibition efficiency and stability of the sequence, the siRNA motif in Example 1 was modified using DV29P or DV29SP templates (the modification types are shown in Tables 3 and 4 below). The sequences of the siRNA modified with DV29P or DV29SP templates are shown in Table 5.

[0283] Table 3: Examples of DV29P Decoration Templates

[0284] Table 4: Examples of DV29SP Decoration Templates

[0285] Table 5: Sequences of siRNA modifiers modified with DV29P or DV29SP templates

[0286]

[0287]

[0288]

[0289]

[0290]

[0291]

[0292] Instruments and reagents: CYTiva 192 P model DNA / RNA automated synthesizer, with cross-linked polystyrene beads as the solid carrier, model Primer support 5G Unylinker 350 (Cytiva manufacturer).

[0293] Preparation method: The following nucleotide monomer solutions were prepared with acetonitrile at a monomer concentration of 0.15 M: DMT-A-OMe phosphorus amide monomer (Formula 5), ​​DMT-C-OMe phosphorus amide monomer (Formula 6), DMT-G-OMe phosphorus amide monomer (Formula 7), DMT-U-OMe phosphorus amide monomer (Formula 8), DMT-AF phosphorus amide monomer (Formula 9), DMT-CF phosphorus amide monomer (Formula 10), DMT-GF phosphorus amide monomer (Formula 11), and DMT-UF phosphorus amide monomer (Formula 12).

[0294] When synthesizing the base at the 5' end of the antisense chain (the last base), a monomer containing a phosphonic acid group at the 5' end is used, such as vinyl-(E)-phosphonate-A-OMe phosphorous amide monomer (Formula 13) or vinyl-(E)-phosphonate-U-OMe phosphorous amide monomer (Formula 14).

[0295]

[0296] Nucleoside monomers are linked sequentially from 3' to 5' along the nucleotide arrangement using a solid-phase phosphorous acid method. Each linkage of a nucleoside monomer involves four steps: deprotection, coupling, oxidation or sulfidation, and hydroxyl protection. Specifically, when two nucleotides are linked using a phosphate ester, the linkage of the subsequent nucleoside monomer involves these four steps. When two nucleotides are linked using a phosphate thioester, the linkage of the subsequent nucleoside monomer involves these four steps.

[0297] Prepared using the following steps: A solid support was loaded into the designated position of the synthesizer, and the corresponding product was obtained after several synthesis cycles. The synthesis cycle included (1) deprotection, (2) coupling, (3) oxidation / sulfidation and (4) hydroxyl protection. The cycle process and the reagents used are described below: (1) Deprotection The DMT protecting group was removed using a 3% dichloroacetic acid toluene solution as a deprotecting agent, followed by washing with acetonitrile.

[0298] (2) Coupling

[0299] The acetonitrile solutions of each nucleotide monomer were coupled using 0.25M 5-ethylthiotetrazole as an activator, followed by rinsing with acetonitrile.

[0300] (3) Oxidation / sulfidation

[0301] Oxidation: Oxidation was performed using a 0.05 M iodine pyridine / water (90 / 10) solution as the oxidant, followed by rinsing with acetonitrile.

[0302] Vulcanization: Vulcanization was carried out using a pyridine solution of 3% hydroxanthin as a vulcanizing agent, followed by rinsing with acetonitrile.

[0303] (4) Hydroxyl protection

[0304] Hydroxyl protection was performed using a 10% acetic anhydride tetrahydrofuran solution (CAP A) tetrahydrofuran / pyridine / N-methylimidazole 74 / 10 / 16 (v / v / v) (CAP B) as the hydroxyl protecting agent, followed by rinsing with acetonitrile.

[0305] Repeat the above operations, cycling through the nucleotides in the set order, to obtain the sense or antisense strand product with a specific sequence arrangement.

[0306] (5) Use 3% dichloroacetic acid toluene solution as a deprotection agent to remove the DMT protecting group of the last nucleotide, and then wash with acetonitrile.

[0307] (6) Ammonolysis and purification

[0308] The solid support was transferred to the reactor, and concentrated ammonia (25-28%, mass percentage) was added. After maintaining ammonolysis at 60°C for 12 hours, the system was cooled to room temperature, and the mixture was transferred to a filter press. The filter cake was washed with a mixture of purified water and ethanol. The filtrates were combined, passed through a chromatography column, concentrated, and lyophilized to obtain the product.

[0309] (7) Annealing

[0310] The purified sense and antisense strands were mixed in a 1:1 ratio, heated to 95°C and held for 3 minutes, and then slowly cooled to room temperature to form a double strand.

[0311] 2.2 Suppression of the INHBE gene

[0312] The siRNA modified by the DV29P template synthesized in section 2.1 was transfected into Huh7 cells via lipid nanoparticles (LNPs), and its inhibitory effect on the INHBE gene was detected by qPCR.

[0313] (1) Experimental materials

[0314] Test samples: siRNA modifiers listed in 2.1.

[0315] Cell type: Huh7 cell line

[0316] Drug solvent: sterile enzyme-free water, Gibco Opti-MEM.

[0317] (2) Experimental methods

[0318] The inhibition of INHBE gene mRNA expression in the Huh7 cell line by the samples was detected by qRT-PCR.

[0319] (2.1) Cell Culture

[0320] Take the passaged Huh7 cell line, and culture the logarithmically growing cells in 10% fetal bovine serum DMEM medium (supplemented with 100× penicillin and 10× streptomycin at 10 μL / mL). Place the medium in a cell culture incubator at 37℃ with 5% CO2, and change the medium once a day. Digest the cells with 0.25% trypsin, centrifuge at 800 r / min for 3 min, discard the supernatant, and add fresh medium for passage.

[0321] (2.2) Cell transfection

[0322] Transfection mixture preparation: Mix Lipofectamine RNAiMAX (Invitrogen, 13778150) and Opti-MEM at a volume ratio of 2:98 and vortex to mix.

[0323] siRNA dilution: Use Opti-MEM to dilute the siRNA sample to a suitable concentration to prepare the siRNA solution to be tested.

[0324] Transfection reagent preparation: Add 65 μL of Opti-MEM diluted 0.84 nM or 0.36 nM siRNA solution to 65 μL of transfection mixture at a 1:1 volume ratio. Vortex mix and let stand at room temperature for 15 min to obtain lipid nanoparticles (LNPs). Take 12.5 μL for encapsulation efficiency detection.

[0325] Blank control group transfection reagent: Add 65 μL of the prepared transfection mixture to 65 μL of Opti-MEM. Vortex mix and let stand at room temperature for 15 min.

[0326] Add 100 μL of the prepared transfection reagents at different siRNA concentrations to each well of a pre-mixed 500 μL cell suspension (containing 1.0 × 10⁶ cells per mL). 5 Add 500 μL of cell suspension (containing 1.0 × 10⁶ cells per ml) to a 24-well cell culture plate to achieve a final siRNA concentration of 0.07 nM or 0.03 nM per well. 5 (1 cell). After mixing using the cross-hatching method, place in a 37°C, 5% CO2 cell culture incubator and incubate for 40 h.

[0327] (2.3) INHBE mRNA detection

[0328] 1) RNA extraction

[0329] a. Remove the culture medium from the 12-well plate, add 0.5 mL of 1×PBS to each well to wash the cells, and then remove the PBS. Add 0.5 mL of TRIzol reagent to each well, pipette the cells to lyse them thoroughly, and transfer them to a 1.5 mL RNase-free EP tube. Incubate at room temperature for 5 min.

[0330] b. Add 0.1 mL of chloroform to each tube, shake vigorously for 15 seconds, and let stand at room temperature for 5 min. Centrifuge at 4℃, 12000 × g for 15 min, and transfer 200 μL of the supernatant to a new EP tube.

[0331] c. Add an equal volume of isopropanol, gently mix the liquid in the tube by inverting it, let it stand at -20℃ for 10 min, centrifuge at 4℃, 12000 × g for 15 min, and discard the supernatant.

[0332] d. Add 0.5 mL of 75% ethanol, gently wash the RNA precipitate, centrifuge at 12000 × g for 5 min at 4℃, and aspirate the supernatant. Repeat the washing once, centrifuge at 12000 × g for 1 min at 4℃, and remove any residual ethanol with a micropipette tip.

[0333] e. Allow the residual ethanol to air dry at room temperature for 2–3 min, then add 40 μL of RNase-free ddH2O to dissolve.

[0334] 2) RNA concentration detection

[0335] RNA concentration was detected using nanodrop. A 2 μL RNase-free ddH2O solution was used as a blank control, and 2 μL of RNA sample was used for each test. Sample concentrations were recorded.

[0336] 3) INHBE mRNA reverse transcription

[0337] The reverse transcription reagent (Takara, RR092A), RNA solution, and water were mixed in a volume ratio of 2:5:3 and reacted in a PCR instrument at 37°C for 15 min, 85°C for 5 s, and finally maintained at 4°C. The cDNA obtained after the reaction was diluted 5-fold with sterile, enzyme-free water.

[0338] 4) Quantitative detection of INHBE mRNA

[0339] In a 15 mL centrifuge tube, add qPCR reagent (Takara, RR420W), upstream primer, and downstream primer in a volume ratio of 5:0.1:0.1 and mix well. Label this solution A.

[0340] The primer sequences are as follows: hGAPDH-F: 5'-CTGGGCTACACTGAGCACC-3' (SEQ ID NO: 521) hGAPDH-R: 5'-AAGTTGTCGTTGAGGGCAATG-3' (SEQ ID NO: 522) INHBE-F: 5'-TGTGTCCCTACTGCCCGAA-3' (SEQ ID NO: 523) INHBE-R: 5'-CCATATCTGGCACATCCGTCTT-3' (SEQ ID NO: 524) Label a 1.5 mL EP tube, add diluted cDNA and water at a volume ratio of 1:3.8 and mix well. Label this solution as solution B.

[0341] Add 5.2 μL of solution A and 4.8 μL of solution B to each well of a 96-well PCR plate. Cover with sealing film, centrifuge at 3000 rpm for 1 min, and then analyze using the PCR instrument.

[0342] This step is performed on ice, maintaining low-temperature conditions.

[0343] Place the plate into the qPCR instrument and run it according to the following procedure: Pre-denaturation: 95℃, 30 sec; Cyclic reaction: 95℃, 5 sec; 60℃, 34 sec; 40 cycles; Melting curves: 95℃, 15 sec; 60℃, 60 sec; 95℃, 15 sec.

[0344] The running time is approximately 2 hours. Analyzing the experimental results, the following formula is used to calculate 2. -ΔΔCt : ΔCT = Average Ct value of target gene INHBE - Average Ct value of internal reference gene hGAPDH; ΔΔCT = ΔCT (test sample group) - ΔCT (RNAiMAX control group); Relative expression level of target gene mRNA = 2 -ΔΔCt The average Ct value was automatically calculated using Quant Studio 5 software under default settings. The RNAiMAX control group is the group that did not contain siRNA, compared to the test sample group.

[0345] (2.4) Calculate the inhibition rate

[0346] The formula for calculating the INHBE mRNA expression rate (%) is as follows: Expression rate = Relative expression level of target gene INHBE mRNA × 100%; INHBE gene expression inhibition rate (%) = 100% - expression rate.

[0347] (3) Experimental Results

[0348] In this embodiment, the inhibition rate was the average of three experiments. The inhibition rates of each sequence on the expression of INHBE mRNA in Huh7 cells are shown in Table 6.

[0349] Experimental results showed that some sequences modified with templates DV29P or DV29SP inhibited the expression of INHBE mRNA in Huh7 cells to varying degrees. Among them, si079-DV29SP, si791-DV29P, si075-DV29P, and si751-DV29P showed inhibition rates exceeding 60%.

[0350] Table 6

[0351] (4) siRNAs with similar sequences may have significantly different activities.

[0352] Table 7: Comparison of the inhibition rates of INHBE by siRNA modification sequences with similar base sequences

[0353] As can be seen from Table 7, some siRNAs with similar sequences have very different inhibitory effects on the expression of INHBE mRNA.

[0354] At a concentration of 0.03 nM: The sequence si028-DV29P differs from the sequence si029-DV29P only in the last two bases, but the inhibition rate of si029-DV29P is 63.4% higher than that of si029-DV29P.

[0355] The sequence si033-DV29SP differs from the sequence si034-DV29P only in the last two bases, but the inhibition rate of si033s-DV29P is 30.0% higher than that of si034-DV29P.

[0356] The sequence si045-DV29P differs from the sequence si046-DV29P only in the last base, but the inhibition rate of si045-DV29P is 30.9% lower than that of si046-DV29P.

[0357] Example 3: Inhibition of the INHBE gene by siRNA modified with a modified template

[0358] In this embodiment, the motif in Embodiment 1 is modified using multiple modification templates, including DV25P, DV26P, DV27P, DV29P, DV32P, DV34P, DV25SP, DV26SP, DV27SP, DV29SP, DV32SP, DV34SP, DV41P~DV43P or DV41SP~DV43SP, etc.

[0359] Natural 5'-terminal phosphorylation or simple direct 5'-terminal phosphorylation can lead to intracellular dephosphorylation. Direct 5'-terminal phosphorylation of oligonucleotide chains can result in 90% dephosphorylation after 2 hours of circulation in the blood and complete disappearance after 24 hours. The 5'-terminal phosphorylation design (5'-E-VP) utilizes E-vinylphosphonate to replace the bridging oxygen, resulting in improved phosphorylation efficiency and stability. The modified templates DV25P-DV27P, DV29P, DV32P, DV34P, DV41P-DV43P, DV25SP-DV27SP, DV29SP, DV32SP, DV34SP, and DV41SP-DV43SP all contain a 5'-vinylphosphonate group at the 5' end of their antisense strands.

[0360] 1. Experimental Materials

[0361] Test sample: The sequences listed in Table 12 were obtained by modifying the basic sequences si075, si751, si753, si791, si014, si076, si077, si078, si080, si752, si079, si047, si754, si755, si756, si792, si141, si761, si771, si781, and si801 in Example 1 with different templates (DV25P, DV26P, DV27P, DV32P, DV34P, DV41P, DV42P, DV43P, DV22S).

[0362] Cell type: Huh7 cell line

[0363] Drug solvent: sterile enzyme-free water, Gibco Opti-MEM

[0364] Sequence synthesis: The siRNA sequence was synthesized according to the method in Example 1.

[0365] The rules for modifying this template are as follows: (1) For compounds with 23 and 21 bases in the sense and antisense chains respectively, the antisense chain shall be modified in any of the ways shown in Table 8 below: Table 8: Antisense Chain Modification

[0366]

[0367] The chain of justice can be modified using any of the methods shown in Table 9 below: Table 9: Justice Chain Modification

[0368] Wherein, 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; PS indicates that the nucleotide at the 5' end is connected to the adjacent nucleotide on its right by a 3',5'-thiophosphate bond; and EVP represents 5'-vinyl-(E)-phosphonate.

[0369] The siRNA template modified with modification mode A for the antisense strand and modification mode a for the sense strand was named DV25P.

[0370] The siRNA template modified with modification mode B for the antisense strand and modification mode a for the sense strand was named DV26P.

[0371] The siRNA template modified with modification mode C for the antisense strand and modification mode a for the sense strand was named DV27P.

[0372] The siRNA template modified with modification method C for the antisense strand and modification method b for the sense strand was named DV29P.

[0373] The siRNA template modified with modification mode D for the antisense strand and modification mode b for the sense strand was named DV32P.

[0374] The siRNA template modified with modification method E for the antisense strand and modification method b for the sense strand was named DV34P.

[0375] The siRNA template modified with modification method F for the antisense strand and modification method b for the sense strand was named DV41P.

[0376] The siRNA template modified with modification mode G for the antisense strand and modification mode b for the sense strand was named DV42P.

[0377] The siRNA template modified with modification mode H on the antisense strand and modification mode b on the sense strand was named DV43P.

[0378] The antisense strand uses modification mode I, and the sense strand uses modification mode c. The siRNA modification template is DV22.

[0379] (2) For compounds with 20 and 22 bases in the sense and antisense chains respectively, the antisense chain shall be modified in any of the ways shown in Table 10 below: Table 10: Antisense Chain Modification

[0380]

[0381] Wherein, 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; PS indicates that the nucleotide at the 5' end is connected to the adjacent nucleotide on its right by a 3',5'-thiophosphate bond; and EVP represents 5'-vinyl-(E)-phosphonate.

[0382] The chain of justice can be modified using any of the methods shown in Table 11 below: Table 11: Justice Chain Modification

[0383] Wherein, 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; PS indicates that the nucleotide at the 5' end is connected to the adjacent nucleotide on its right by a 3',5'-thiophosphate bond; and EVP represents 5'-vinyl-(E)-phosphonate.

[0384] The siRNA template modified with A' on the antisense strand and a' on the sense strand was named DV25SP. The siRNA template modified by the antisense strand using modification mode B' and the sense strand using modification mode a' was named DV26SP. The siRNA template modified with C' on the antisense strand and a' on the sense strand was named DV27SP. The siRNA template modified with C' for the antisense strand and b' for the sense strand was named DV29SP.

[0385] The siRNA modification template with modification mode D' on the antisense strand and modification mode b' on the sense strand was named DV32SP.

[0386] The siRNA modification template for the antisense strand, modified by method E', and the sense strand, modified by method b', was named DV34SP.

[0387] The siRNA modification template for the antisense strand, modified by F', and the sense strand, modified by b', was named DV41SP.

[0388] The siRNA template modified with G' on the antisense strand and b' on the sense strand was named DV42SP.

[0389] The siRNA template modified with H' on the antisense strand and b' on the sense strand was named DV43SP.

[0390] The siRNA modification template for the antisense strand using modification mode I' and the sense strand using modification mode c' is DV22S.

[0391] The template-modified siRNAs are detailed in Table 12 below, and the synthesis methods for each sequence are described in the corresponding content above.

[0392] Table 12: Sense and antisense strand sequences of siRNA modifiers

[0393]

[0394]

[0395]

[0396]

[0397]

[0398]

[0399]

[0400]

[0401] 2. Experimental Methods

[0402] The inhibitory effect of the test samples on the expression of INHBE gene mRNA in the Huh7 cell line was detected by qRT-PCR.

[0403] 2.1 Cell Culture

[0404] Take the passaged Huh7 cell line, and culture the logarithmically growing cells in 10% fetal bovine serum DMEM medium (supplemented with 100 μL / mL penicillin and streptomycin), and place them in a cell culture incubator at 37℃ with 5% CO2, changing the medium once a day. Digest with 0.25% trypsin for passage, centrifuge at 1000 r / min for 5 min, discard the supernatant, and add fresh culture medium for passage.

[0405] 2.2 Cell transfection

[0406] Transfection mixture preparation: Mix Lipofectamine RNAiMAX and Opti-MEM at a ratio of 2:98 and vortex thoroughly.

[0407] siRNA dilution: Use Opti-MEM to dilute the siRNA sample to a suitable concentration to prepare the siRNA solution to be tested.

[0408] Transfection reagent preparation: Add 60 μL of Opti-MEM diluted siRNA solution to 60 μL of transfection mixture at a 1:1 (v / v) ratio, vortex to mix, and let stand at room temperature for 15 min to obtain lipid nanoparticles (LNPs). Take 12.5 μL for encapsulation efficiency detection.

[0409] Blank control group transfection reagent: Add 60 μL of the prepared transfection mixture to 60 μL of Opti-MEM. Vortex mix and let stand at room temperature for 15 min.

[0410] Add 100 μL of the prepared transfection reagents at different siRNA concentrations to each well of a pre-mixed 500 μL cell suspension (containing 1.0 × 10⁶ cells per mL). 5 The siRNA was divided into 24-well cell culture plates (each containing 100 cells) to achieve a final concentration of 0.02 nM or 0.07 nM per well. After mixing using the cross-hatching method, the plates were incubated at 37°C in a 5% CO2 cell culture incubator for 40 h.

[0411] 2.3 INHBE mRNA detection

[0412] The steps are the same as "(2.3) INHBE mRNA detection" in Example 2.

[0413] 2.4 Calculation of inhibition rate

[0414] Refer to the calculation method in Example 2.

[0415] 2.5 IC 50 experiment

[0416] IC 50 The siRNA modifiers were serially diluted, starting at 1.0 nM and then 4-fold diluted to obtain eight concentration points (1.0 nM, 0.25 nM, 0.0625 nM, 15.6 pM, 3.9 pM, 0.977 pM, 0.244 pM, and 0.061 pM). The inhibition rates of each modifier at each concentration were measured, plotted, and IC50 was calculated. 50 .

[0417] 3. Experimental Results

[0418] (1) After three repeated experiments, the inhibition rate of each modified sequence on the INHBE gene of Huh7 cells is shown in Table 13.

[0419] Activity assay results showed that modification with templates DV25P–DV27P, DV29P, DV32P, DV34P, DV41P–DV43P, DV25SP–DV27SP, DV29SP, DV32SP, DV34SP, and DV41SP–DV43SP significantly inhibited the INHBE gene, achieving an inhibition rate of over 40% at a concentration of 20 pM.

[0420] Table 13

[0421] (2) The same siRNA sequence exhibits certain activity differences after being modified with different templates.

[0422] Table 14: Inhibition rate of INHBE mRNA by si079 sequences with different modified templates (0.02 nM)

[0423] As shown in Table 14, the same siRNA sequence exhibits certain activity differences after being modified with different templates. For example, the si079 modified with template DV25SP showed a 10.6% higher inhibition rate than the modified si079 modified with template DV41SP.

[0424] (3) IC 50 experiment

[0425] Sixteen template modification sequences were selected, including si751-DV25P, si791-DV26P, si047-DV34SP, si791-DV27P, si079-DV25SP, si079-DV27SP, si079-DV29SP, si047-DV26SP, si079-DV34SP, si751-DV27P, si047-DV29SP, si791-DV29P, si047-DV25SP, si014-DV25P, si014-DV34P, and si014-DV32P, for IC testing. 50 Experiments were conducted to determine the IC50 of each sequence. 50 Concentration. Experimental results are shown in Table 15.

[0426] Table 15: IC of each modification sequence 50 Experimental results

[0427] In the table above, N / A indicates that the upper limit of the inhibition rate is too low to fit the IC. 50 .

[0428] As can be seen from Table 15, the IC values ​​of these 16 sequences are... 50 The values ​​ranged from 0.0004 nM to 0.0240 nM, indicating that INHBE gene expression could be effectively inhibited even at low concentrations.

[0429] Example 4: Inhibition of target genes and potential off-target genes by siRNA conjugates with anti-off-target modifications

[0430] Existing technologies include modifications such as replacing the 6th or 7th nucleotide of the siRNA antisense strand with ethylene glycol nucleic acid (GNA), which can disrupt the seed region of the antisense strand, thereby significantly reducing off-target effects and hepatotoxicity. Furthermore, studies have found that replacing all base pairs of the sense and antisense strands at positions 1-8, starting from the 5' end of the siRNA antisense strand, with corresponding DNA can significantly reduce the off-target effects of siRNA without affecting its activity.

[0431] Therefore, in this embodiment, to reduce off-target effects, further off-target modifications are performed based on the disclosed modifiers. Specifically, the nucleotide at position 7 or positions 7 and 11 of the antisense strand is replaced with DNA, and the nucleotide at the complementary pairing position with position 7 of the antisense strand in the sense strand is also replaced with DNA to reduce off-target effects. The code names and specific technical meanings used are as follows: d7B11 anti-target: The 7th and 11th nucleotides of the antisense strand are replaced with DNA, and the nucleotides at the complementary pairing position of the 7th nucleotide of the sense strand are also replaced with DNA.

[0432] d7B anti-target: The nucleotide at position 7 of the antisense strand is replaced with DNA, and the nucleotide at the complementary pairing position of the nucleotide at position 7 of the antisense strand in the sense strand is also replaced with DNA.

[0433] Table 16: Examples of siRNA conjugates with or without anti-off-target modifications disclosed herein

[0434]

[0435] The synthesis methods for the modified sense strand and modified antisense strand in this embodiment are the same as those in Example 2. Furthermore, the conjugation groups G101, G103, etc. mentioned above in this disclosure are connected to the 3' end of the siRNA sense strand. The method for connecting the conjugation groups can refer to the methods given in the prior art.

[0436] The method for inhibiting the INHBE gene using the siRNA conjugate in this embodiment is the same as that in Examples 2 and 3, except that the test sample is the siRNA conjugate disclosed herein.

[0437] Experimental results showed that, at concentrations ranging from 40 pM to 25 nM, the modifiers employing anti-off-target modification significantly inhibited the target gene INHBE. Furthermore, the inhibition rate of the modifiers against potential off-target genes was significantly lower than that against the target gene. This indicates that anti-off-target modification does not affect the inhibitory effect of the template-modified modifiers of this disclosure on the target gene, but it can suppress off-target effects of some sequences.

[0438] (1) Different modified sequences all have a significant inhibitory effect on the INHBE gene.

[0439] The inhibition rates of the INHBE gene by all tested samples are shown in Table 17.

[0440] All template-modified sequences significantly inhibited INHBE at a concentration of 25 nM. For example, the template-modified sequence si079-DV25SPG101 achieved an inhibition rate of 81.0%.

[0441] Table 17: Repression rate of INHBE gene by template modification and the use of off-target prevention modification sequences

[0442] After template modification and subsequent off-target design, the expression of the INHBE gene was significantly inhibited. For example, when the si079 sequence was modified with the template DV25SP and then designed to prevent off-target effects, the inhibition rate of the si079-DV25SPd7B11G101 sequence reached as high as 76.9%.

[0443] (2) After using any one or more of the various modification methods disclosed herein, and then carrying out the off-target design, there is a significant off-target effect on some off-target genes, reducing the inhibitory effect on off-target genes.

[0444] As shown in Table 18, the experimental results are as follows: The template modification sequence disclosed herein employs an off-target prevention design, which can reduce the inhibitory effect on off-target genes, i.e., it has an off-target prevention effect. Using the modified template sequence of this disclosure with an off-target prevention design, the inhibition rate of off-target genes can be reduced by up to 26.7%.

[0445] Table 18: Inhibition rate of template modification sequences and their off-target prevention modifications on off-target genes

[0446] 1) Only template decoration design is used.

[0447] Some of the template-modified sequences exhibit certain off-target effects. For example, the modified sequence si079-DV25SPG101 showed an inhibition efficiency of 54.4% against the potential off-target gene MTFR1; the modified sequence si751-DV27PG101 showed an inhibition efficiency of 80.1% against the potential off-target gene SYT12.

[0448] 2) It also adopts a design to prevent missing the target (represented by "d7B" or "d7B11" in the serial number).

[0449] Sequences that simultaneously employ template modification and off-target protection modifications significantly reduce the inhibition rate of off-target genes, demonstrating a clear off-target protection effect. For example, si079-DV25SPd7B11G101 reduced the inhibition rate of MTFR1 by 26.7%; si751-DV27Pd7BG101 reduced the inhibition rate of SYT12 by 15.2%.

[0450] Summarize: 1. Template modification followed by off-target design significantly inhibits INHBE gene expression. For example, when the si079 sequence is modified with the template DV25SP and then designed to prevent off-target effects, the inhibition rate of the si079-DV25SPd7B11G101 sequence reaches as high as 76.9%.

[0451] 2. After using any one or more of the various modification methods disclosed in this invention, and then performing off-target design, there is a significant off-target effect on some off-target genes, reducing the inhibitory effect on off-target genes.

[0452] 1) Some of the modified sequences have certain off-target effects. For example, the modified sequence si079-DV25SPG101 has an inhibition efficiency of 54.4% against the potential off-target gene MTFR1; the modified sequence si751-DV27PG101 has an inhibition efficiency of 80.1% against the potential off-target gene SYT12.

[0453] 2) Sequences that simultaneously employ template modification and off-target prevention modification significantly reduce the inhibition rate of off-target genes, demonstrating a clear off-target prevention effect. For example, si079-DV25SPd7B11G101 reduced the inhibition rate of MTFR1 by 26.7%; si751-DV27Pd7BG101 reduced the inhibition rate of SYT12 by 15.2%.

[0454] Example 5: Inhibitory effect of the sequence modified using the template disclosed herein on INHBE mRNA in mouse liver.

[0455] In this embodiment, the modifiers from Example 4 were used. Transgenic mice expressing the human INHBE gene were used to detect the inhibitory effect of each modifier on INHBE in the liver at different time points by qPCR.

[0456] 1. Experimental Materials

[0457] Test drug: The modification in Example 4, see Table 16.

[0458] Media: saline

[0459] Experimental animals: 6-8 week old, SPF grade hINHBE transgenic male mice, weighing between 18g and 28g, were divided into groups of 10 mice each.

[0460] 2. Experimental Methods

[0461] Dosage design and grouping

[0462] Grouping and administration: After acclimatization, mice were randomly divided into a negative control group (solvent control group) and a test drug group, with 10 mice in each group. The drug was administered via a single subcutaneous injection (sc / once) at a dose of 1 mg / kg, a volume of 5 mL / kg, and a concentration of 0.2 mg / mL. The day of administration was designated as day 0.

[0463] Animal grouping information is detailed in Table 19 below: Table 19: Grouping Information

[0464] detection indicators

[0465] (1) General observation

[0466] Observe once a day from one week before administration until the end of the trial.

[0467] Observation content: Observe the animal's death or near death, mental state, behavior, fecal characteristics, and the supply of feed and water at the cage.

[0468] Animals tested: All animals in the negative control group and the test drug group.

[0469] (2) Measurement of body weight and food intake

[0470] Record the curves of mouse body weight and food intake changes. Record mouse body weight and food intake (non-fasting body weight) on the day of administration (D0) and once a week after administration.

[0471] (3) Detection of INHBE mRNA expression in the liver

[0472] Testing time: Day 14, Day 28

[0473] Method for detecting INHBE mRNA levels: qPCR.

[0474] Animals tested: Five animals from the negative control group and the test drug group were tested each time.

[0475] (4) Data processing and statistical analysis

[0476] Experimental data are expressed as mean ± standard deviation (Mean ± SD) and analyzed using GraphPad Prism 10 software. Statistical analysis was performed using two-way ANOVA and post-hoc tests. Homogeneity of variance was assessed using the LSD test, and unequal variances were assessed using Dunnett's T3. p < 0.05 was considered statistically significant.

[0477] 3. Experimental Results

[0478] The specific experimental results are shown in Table 20.

[0479] It can be seen that it can significantly inhibit the expression of INHBE mRNA in the liver. For example, si079-DV25SPd7B11G101 achieved an inhibition rate of 89.9% on day 14.

[0480] (1) The sequence disclosed herein has a significant inhibitory effect on INHBE mRNA expression in the liver. For example, si079-DV25SPd7B11G101 achieved an inhibition rate of 89.9% on day 14.

[0481] Table 20: Inhibition rate of different sequences on hepatic INHBE mRNA

[0482] As shown in Table 20, the conjugates formed by the various sequences and GalNAc compounds significantly inhibited the expression of INHBE mRNA in the liver. For example, the inhibition rates of si079-DV25SPd7B11G101 on day 14 and day 21 were 89.9% and 22.2%, respectively.

[0483] This indicates that the sequence designed in this disclosure, modified with the template of this disclosure, or simultaneously employing an off-target design, conjugated with a GalNAc compound, can be efficiently delivered to the animal liver and significantly inhibit INHBE gene expression.

[0484] Example 6: Inhibitory effect of sequences modified with the template of this disclosure on mouse weight gain.

[0485] In this embodiment, some of the modifiers from Example 4 were used to establish a DIO (diet-induced obesity) model using transgenic mice expressing the human INHBE gene. Body weight and body fat percentage were detected at different time points, and the inhibitory effect of each modifier on INHBE in the liver at different time points was detected by qPCR.

[0486] 1. Experimental Materials

[0487] Test drug: The modifiers in Example 4 include si079-DV25SPd7B11G101, si752-DV25SPd7B11G101, si791-DV26Pd7BG101, si047-DV26SPG101, si079-DV25SPG101, si791-DV29PG101, si079-DV29SPG101, and si079-DV25SPd7BG101. The sequences of the modifiers are shown in Table 16.

[0488] The positive chain sequence AC004285 is derived from Table 5C of US20250075214A1. Its positive chain sequence is: 5'-(NAG37)s-(invAb)s-Cm-Um-Gm-Gm-Cm-Um-Um-Am-Uf-Am-Cf-Uf-Um-Um-Cm-Um-Um-Am-Am-Um-Ams-(invAb)-3' (SEQ ID NO. 908), and its negative chain sequence is 5'-Ums-Afs-Um-Um-Af-Am-Gm-Am-Am-Am-Gm-Uf-Am-Uf-Am-Af-Gm-Cm-Cm-Amss-Gm-3' (SEQ ID NO. 909). The meanings of NAG37 and invAb are found in the patent document, and the meanings of the letters s, f, and m are the same as the corresponding meanings defined in other parts of this disclosure.

[0489] Media: saline

[0490] Experimental animals: 6-8 week old, SPF grade hINHBE transgenic male mice, weighing between 18g and 28g, were divided into three groups: control group (n=15 per group), 1 mpk dose group (n=8 per group), and 3 mpk dose group (n=9 per group).

[0491] 2. Experimental Methods

[0492] Dosage design and grouping

[0493] Grouping and administration: After acclimatization, subjects were randomly divided into a negative control group and a test drug group based on body weight and body fat percentage. Administration was via a single subcutaneous injection at a dose of 1 mg / kg or 3 mg / kg, a volume of 5 mL / kg, and a concentration of 0.2 mg / mL or 0.6 mg / mL. The day of administration was designated as day 0.

[0494] Grouping information is detailed in Table 21 below: Table 21: Grouping Information

[0495] detection indicators

[0496] (1) General observation

[0497] Observe once a day from one week before administration until the end of the trial.

[0498] Observation content: Observe the animal's death or near death, mental state, behavior, fecal characteristics, and the supply of feed and water at the cage.

[0499] Animals tested: All animals in the negative control group and the test drug group.

[0500] (2) Measurement of body weight, body fat and food intake

[0501] Record the curves of mouse body weight and food intake changes. Record mouse body weight (non-fasting body weight) and food intake twice a week on the day of administration (D0) and after administration. Record mouse body fat percentage once a week.

[0502] (3) Detection of INHBE mRNA expression in the liver

[0503] Testing time: D28 (4 weeks after the first dose), D55 (2 weeks after the second dose)

[0504] Method for detecting INHBE mRNA levels: qPCR.

[0505] Animals tested: 3–5 animals from the negative control group and the test drug group were tested each time.

[0506] (4) Data processing and statistical analysis

[0507] Experimental data are expressed as mean ± standard deviation (Mean ± SD) and analyzed using GraphPad Prism 10 software. Statistical analysis was performed using two-way ANOVA and post-hoc tests. Homogeneity of variance was assessed using the LSD test, and unequal variances were assessed using Dunnett's T3. p < 0.05 was considered statistically significant.

[0508] 3. Experimental Results

[0509] The results of liver INHBE mRNA expression measurement are shown in Table 22.

[0510] It can be seen that these sequences can significantly inhibit INHBE mRNA expression in the liver. For example, si079-DV25SPd7B11G101, administered at 1 mg / kg, showed inhibition rates of 46.6% and 84.9% on days 28 and 55, respectively.

[0511] (1) The sequence disclosed herein has a significant inhibitory effect on INHBE mRNA expression in the liver. For example, si079-DV25SPd7B11G101, administered at 1 mg / kg, showed inhibition rates of 46.6% and 84.9% on day 28 and day 55, respectively.

[0512] Table 22: Inhibition rate of different sequences on hepatic INHBE mRNA

[0513] (2) The sequences disclosed herein have a significant inhibitory effect on the growth of body weight and body fat in DIO mice (as shown in Table 23). For example, si791-DV26Pd7BG101 administered at 1 mg / kg or 3 mpk showed a 12.7% and 22.7% reduction in body weight and body fat, respectively, on day 21 compared with the saline control group.

[0514] Table 23: Percentage reduction in weight and body fat by different sequences

[0515] As shown in Table 23, the conjugates formed by the conjugates of each sequence with GalNAc compounds have a significant inhibitory effect on weight and body fat gain. For example, si791-DV26Pd7BG101, administered at 1 mg / kg or 3 mpk, reduced body weight and body fat by 12.7% and 22.7% respectively on day 21 compared to the saline control group.

[0516] This demonstrates that the sequence designed in this disclosure, modified with the template of this disclosure, or simultaneously employing an anti-off-target design, conjugated with GalNAc compounds, can be efficiently delivered to the animal liver and significantly inhibit weight and body fat gain.

[0517] This disclosure presents a series of siRNAs designed based on the INHBE mRNA sequence, which are modified using a specific set of modification templates, and some sequences are designed to prevent off-target effects. Results show that using multiple modification sequences, the inhibition rate can reach over 70%. Furthermore, the modified sequences, conjugated with GalNAc compounds, can be efficiently delivered to the animal liver, significantly inhibiting INHBE gene expression, body weight, and body fat growth.

Claims

1. A siRNA double strand, characterized in that, The siRNA double strand comprises a sense strand and an antisense strand forming an inverse complementary double-stranded region. The antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides complementary to the target sequence as shown in SEQ ID NO: 907, or the antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotide fragments from any of the sequences shown in SEQ ID NO: 13-24, 134-236, 238-240, or 252-260.

2. The siRNA double strand as described in claim 1, characterized in that, The positive chain comprises at least 17, 18, or 19 consecutive nucleotide fragments in any of the sequences shown in SEQ ID NO: 1~12, 25~127, 129~131, 243~251.

3. The siRNA double strand as described in claim 1, characterized in that, The siRNA duplex satisfies one or more of the following conditions: (1) The length of the reverse complementary double-stranded region is 17~21 bp; (2) The lengths of the sense strand and the antisense strand each independently comprise 19-23 nucleotides; (3) At least one strand contains a 3' overhang of at least one or at least two nucleotides; and, (4) The siRNA double strand is an siRNA used to suppress the expression of the INHBE gene.

4. The siRNA double strand as described in claim 1, characterized in that, The siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes composed of sense and antisense strand pairings: The nucleotide sequence of the sense strand is shown in SEQ ID NO: 1; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 13; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 2; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 14; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 3; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 15; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 4; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 16; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 5; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 17; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 6; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 18; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 7; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 19; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 8; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 20; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 9; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 21; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 10; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 22; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 11; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 23; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 12; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 24; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 25; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 134; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 26; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 135; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 27; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 136; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 28; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 137; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 29; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 138; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 30; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 139; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 31; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 140; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 32; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 141; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 33; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 142; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 34; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 143; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 35; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 144; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 36; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 145; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 37; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 146; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 38; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 147; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 39; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 148; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 40; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 149; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 41; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 150; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 42; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 151; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 43; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 152; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 44; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 153; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 45; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 154; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 46; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 155; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 47; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 156; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 48; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 157; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 49; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 158; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 50; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 159; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 51; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 160; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 52; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 161; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 53; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 162; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 54; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 163; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 55; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 164; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 56; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 165; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 57; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 166; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 58; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 167; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 59; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 168; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 60; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 169; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 61; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 170; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 62; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 171; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 63; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 172; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 64; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 173; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 65; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 174; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 66; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 175; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 67; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 176; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 68; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 177; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 69; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 178; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 70; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 179; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 71; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 180; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 72; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 181; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 73; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 182; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 74; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 183; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 75; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 184; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 76; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 185; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 77; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 186; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 78; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 187; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 79; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 188; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 80; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 189; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 81; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 190; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 82; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 191; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 83; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 192; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 84; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 193; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 85; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 194; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 86; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 195; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 87; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 196; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 88; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 197; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 89; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 198; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 90; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 199; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 91; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 200; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 92; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 201; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 93; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 202; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 94; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 203; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 95; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 204; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 96; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 205; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 97; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 206; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 98; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 207; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 99; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 208; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 100; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 209; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 101; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 210; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 102; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 211; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 103; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 212; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 104; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 213; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 105; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 214; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 106; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 215; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 107; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 216; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 108; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 217; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 109; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 218; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 110; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 219; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 111; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 220; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 112; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 221; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 113; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 222; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 114; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 223; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 115; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 224; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 116; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 225; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 117; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 226; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 118; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 227; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 119; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 228; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 120; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 229; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 121; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 230; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 122; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 231; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 123; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 232; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 124; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 233; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 125; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 234; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 126; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 235; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 127; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 236; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 129; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 238; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 130; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 239; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 131; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 240; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 243; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 252; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 244; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 253; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 245; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 254; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 246; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 255; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 247; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 256; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 248; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 257; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 249; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 258; The nucleotide sequence of the sense strand is shown in SEQ ID NO: 250; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 259; and The nucleotide sequence of the sense strand is shown in SEQ ID NO: 251; and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:

260.

5. The siRNA double strand as described in claim 1, characterized in that, The sense or antisense strand comprises at least one modified nucleotide, wherein the at least one modified nucleotide is selected from any or a combination of at least two of the following: deoxy-nucleotides, 3'-terminal deoxy-thymidine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluorine modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, non-locked nucleotides, configuration-restricted nucleotides, restricted ethyl nucleotides, base-free nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl- Modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholinonucleotides, aminophosphates, nucleotides containing non-natural bases, tetrahydropyran-modified nucleotides, 1,5-dehydrohexyl-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphate groups, nucleotides containing 5'-phosphates, and nucleotides containing 5'-phosphate mimics.

6. The siRNA double strand as described in claim 5, characterized in that, The nucleotide modifications on the sense and antisense strands are 2' position modifications of the nucleotide ribose.

7. The siRNA double strand as described in claim 6, characterized in that, The 2'-position modification of the nucleotide ribose is selected from any one or a combination of several of 2'-methoxy, 2'-methoxyethyl, 2'-fluoro, 2'-benzyloxy, 2'-methylcarbonylamino, and 2'-pyridinemethoxy.

8. The siRNA double strand as described in claim 7, characterized in that, The 2' position of the nucleotide ribose is modified with an alternating combination of 2'-methoxy and 2'-fluoro compounds.

9. The siRNA double strand as described in claim 8, characterized in that, The 2' position of the nucleotide ribose is modified as follows: the odd-numbered positions of the sense strand are all 2'-fluorinated, and the even-numbered positions are all 2'-methoxyinated; and the odd-numbered positions of the antisense strand are all 2'-methoxyinated, and the even-numbered positions are all 2'-fluorinated.

10. The siRNA double strand as described in claim 1, characterized in that, Nucleotide monomers are linked to each other by 3',5'-phosphodiester bonds or 3',5'-thiophosphodiester bonds.

11. The siRNA double strand as described in claim 1, characterized in that, The 3',5'-phosphodiester bonds between nucleotides at the sequence ends of the siRNA double strand contain thiomodification and form chiral pure 3',5'-thiophosphodiester bonds; Preferably, the first to fourth nucleotides at the 5' end of the sense strand and / or the antisense strand contain one, two, or three 3',5'-phosphothioester bonds, and the first to fourth nucleotides at the 3' end of the antisense strand contain one, two, or three 3',5'-phosphothioester bonds.

12. The siRNA double strand as described in claim 1, characterized in that, Phosphorylation of the 5' carbon atom of the modified antisense 5'-terminal nucleotide glycoside, wherein the phosphorylation of the 5' carbon atom is selected from the following 5'-phosphorylating groups: 5'-vinylphosphonate group (5'-E-VP); 5'-methylphosphonate group (5'-MP); 5'-C-methylphosphate group; 5'-thiophosphate group (5'-PS); and 5'-phosphate group (5'-P), the structures of which are shown below: ； Where R represents hydrogen, hydroxyl, amino, or C. 1-4 Alkyl, aromatic, C 1-4 Alkoxy, C 1-4 Alkyl carbonyl amino or halogen; The bases are selected from adenine, guanine, cytosine, thymine, and uracil.

13. The siRNA double strand as described in claim 1, characterized in that, The siRNA duplex has the following modifications: The antisense chain has any of the following modifications: And / or, the chain of justice is modified in one of the following ways: Wherein, 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; PS indicates that the nucleotide at the 5' end is connected to its adjacent nucleotide to the right by a 3',5'-thiophosphate bond; EVP represents 5'-vinyl-(E)-phosphonate; or, The antisense chain has any of the following modifications: And / or, the chain of justice is modified in one of the following ways: Wherein, 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; PS indicates that the nucleotide at the 5' end is connected to the adjacent nucleotide on its right by a 3',5'-thiophosphate bond; and EVP represents 5'-vinyl-(E)-phosphonate.

14. The siRNA double strand as described in claim 13, characterized in that: The antisense chain is modified by modification method B, and the justice chain is modified by modification method a. The antisense chain is modified by modification method C, and the justice chain is modified by modification method a. The antisense chain is modified by modification method C, and the justice chain is modified by modification method b. The antisense chain is modified by modification method D, and the justice chain is modified by modification method b. The antisense chain is modified by modification method E, and the justice chain is modified by modification method b. The antisense chain is modified by modification method F, and the justice chain is modified by modification method b. The antisense chain is modified by modification method G, and the justice chain is modified by modification method b; or The antisense chain is modified by modification method H, and the justice chain is modified by modification method b. or, The antisense chain is modified by modification method B', and the justice chain is modified by modification method a'. The antisense chain is modified by the modification method C', and the justice chain is modified by the modification method a'. The antisense chain is modified by modification method C', and the justice chain is modified by modification method b'. The antisense chain is modified by the modification method D', and the justice chain is modified by the modification method b'. The antisense chain is modified by modification method E', and the justice chain is modified by modification method b'. The antisense chain is modified by the modification method F', and the justice chain is modified by the modification method b'. The antisense chain is modified by the modification method G', and the justice chain is modified by the modification method b'; or The antisense chain is modified by the modification method H', and the justice chain is modified by the modification method b'.

15. The siRNA double strand according to any one of claims 1-14, characterized in that, The siRNA duplex comprises any one or a combination of at least two of the oligonucleotide duplexes formed by pairing sense and antisense strands as shown in Tables 5 and 12.

16. The siRNA double strand as described in claim 1, characterized in that, The antisense strand and / or the sense strand are modified with a modifying group at any position from the second to the eleventh position starting from the 5' end of the nucleotide, wherein the modifying group is selected from UNA, GNA, and DNA, wherein the structures of UNA and GNA are as follows: ； The bases are selected from adenine, guanine, cytosine, thymine, and uracil; Preferably, the 7th position, or the 7th and 11th positions of the antisense strand, is replaced with DNA, and the nucleotides in the sense strand that are complementary to the 7th position of the antisense strand are also replaced with DNA.

17. A siRNA conjugate, characterized in that, The conjugate comprises a double-stranded siRNA as described in any one of claims 1-16, and a conjugate group attached thereto.

18. The conjugate as claimed in claim 17, characterized in that, The conjugation group is attached to the 3'-end or 5'-end of the positive strand of the oligonucleotide; and / or, the conjugation group is a GalNAc derivative attached using a divalent or trivalent branched linker arm.

19. The conjugate as claimed in claim 17, characterized in that, The conjugating group is: ， Wherein, X is a hydroxyl protecting group or H, the hydroxyl protecting group being selected from acetyl, benzoyl or isobutyryl; Y is an amine protecting group or H, the amine protecting group being selected from formyl, acetyl, propionyl, n-butyryl or isobutyryl; n is an integer from 0 to 20; q, r and s are independently integers from 1 to 7.

20. The conjugate as claimed in claim 19, characterized in that, The conjugating group is: 。 21. The conjugate as claimed in claim 17, characterized in that, The conjugating group is: Where X is oxygen, -N(Y)-, or sulfur; Y is C 1-4 Alkyl or C 6-10 Aryl; R1 is oxygen or sulfur; R2 represents hydrogen, -NH2, or C. 1-4 Alkyl, C 6-10 Aryl, C 1-4 Alkoxy or halogen; A is -(CH2) a -、-(CH2CH2O) b -、-((CH2) c NHCO) d -or-((CH2) c CONH) d - where a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5; B is -(CH2) e -, where e is an integer between 0 and 7; L is either -CONH- or -NHCO-; X1 is -(CH2) f -or-(CH2CH2O) f CH2-, f is an integer from 1 to 5; X2 is -(CH2) g - g is an integer from 1 to 6; Y1 is either 0 or 1; Y2 is 0, 1, or 2; When Y3 is 1, X3 is CH2; when Y3 is 2, X3 is CH; when Y3 is 3, X3 is carbon. m is an integer between 0 and 4; n is an integer between 0 and 4.

22. The conjugate as claimed in claim 21, characterized in that, The conjugating group is G4, G5, G6, or G7, and its structure is shown below: ， ， ， 。 23. The conjugate as claimed in claim 17, characterized in that, The conjugate has any of the following structures: ， ， ， ,and 。 24. The conjugate as claimed in claim 17, characterized in that, The conjugating group is: ， Where X is oxygen, -N(Y)-, or sulfur; Y is C 1-4 Alkyl or C 6-10 Aryl; R1 is oxygen or sulfur; R2 represents hydrogen, -NH2, or C. 1-4 Alkyl, C 6-10 Aryl, C 1-4 Alkoxy or halogen; A is -(CH2) a -、-(CH2CH2O) b -、-((CH2) c NHCO) d -or-((CH2) c CONH) d - where a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5; B is -(CH2) e -, where e is an integer between 0 and 7; L is either -CONH- or -NHCO-; X1 is -(CH2) f -or-(CH2CH2O) f CH2-, f is an integer from 1 to 5; X2 is -(CH2) g - g is an integer from 1 to 6; X3 is oxygen or sulfur; Y1 is either 0 or 1; Y2 is 0, 1, or 2; When Y3 is 1, X4 is CH2; when Y3 is 2, X4 is CH; when Y3 is 3, X3 is carbon. m is an integer between 0 and 4; n is an integer between 0 and 4; q is an integer between 0 and 4.

25. The conjugate as claimed in claim 24, characterized in that, The conjugating group is G101, G102, G103, G105, or G106: ， ， ， ,or 。 26. The conjugate as claimed in claim 25, characterized in that, The conjugate has any of the following structures: ， ， ， ,or 。 27. The conjugate as claimed in claim 17, characterized in that, The siRNA duplex comprises any one or a combination of at least two of the oligonucleotide duplexes formed by pairing sense and antisense strands as shown in Tables 5, 12 and 16. Wherein, any one or both of the sense chain and the antisense chain are connected to the conjugation group G4, G5, G6, G7, G101, G102, G103, G105 or G106.

28. The conjugate as claimed in claim 27, characterized in that, The conjugation group is attached to the 3' end of the positive chain.

29. A nucleic acid-protein complex, characterized in that, The nucleic acid protein complex comprises the double-stranded region of the siRNA double-stranded structure as described in any one of claims 1-16, and a nuclease; or, the nucleic acid protein complex comprises the antisense strand of the double-stranded region of the siRNA double-stranded structure as described in any one of claims 1-16, and a nuclease.

30. The nucleic acid-protein complex according to claim 29, characterized in that, The nuclease is an AGO protein.

31. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises a double-stranded siRNA as described in any one of claims 1-16, a conjugate as described in any one of claims 17-28, or a nucleic acid-protein complex as described in claims 29 or 30, and a pharmaceutically acceptable carrier.

32. Use of the siRNA duplex as described in any one of claims 1-16, the conjugate as described in any one of claims 17-28, the nucleic acid-protein complex as described in claim 29 or 30, or the pharmaceutical composition as described in claim 31 in the preparation of a medicament for the prevention and / or treatment of diseases related to INHBE gene expression.

33. The use of the siRNA double strand as described in any one of claims 1-16, the conjugate as described in any one of claims 17-28, the nucleic acid-protein complex as described in claim 29 or 30, or the pharmaceutical composition as described in claim 31 in the preparation of a medicament for the prevention and / or treatment of diabetes, obesity, including, for example, hyperlipidemia or dyslipidemia, insulin resistance or higher or altered insulin levels during fasting or metabolic challenges, hepatic steatosis or fatty liver disease, non-alcoholic steatohepatitis, elevated blood pressure and / or hypertension, metabolic syndrome, coronary artery disease and other atherosclerotic symptoms, and complications related to these diseases.

Images