Application of OsMYB454 gene in regulation and control of saline-alkaline tolerance of rice
By editing the OsMYB454 gene using CRISPR-Cas9, the salt tolerance of rice was regulated, solving the problem of limited growth of rice under salt and alkali stress and significantly improving the salt tolerance of rice.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-24
- Publication Date
- 2026-04-07
AI Technical Summary
Rice growth is restricted under saline-alkali stress, leading to reduced yields or even crop failure. Existing technologies are insufficient to effectively improve the salt and alkali tolerance of rice.
By knocking out or overexpressing the OsMYB454 gene, gene editing was performed using the CRISPR-Cas9 system to construct recombinant vectors and transform them into rice, thereby regulating its salt and alkali tolerance.
The OsMYB454 gene knockout lines showed significantly higher survival rates and lower salt-alkali damage levels under saline-alkali conditions, while the overexpression lines showed significantly lower survival rates and higher salt-alkali damage levels, significantly improving the salt-alkali tolerance of rice.
Smart Images

Figure CN121801925A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of rice resistance to abiotic stress technology, specifically involving the application of the OsMYB454 gene in regulating the salt and alkali tolerance of rice. Background Technology
[0002] Soil salinization has become a major obstacle to land use and crop production, causing significant negative impacts on global agricultural production. Soil salinization is caused by a combination of factors, including climate change, improper irrigation, overuse of chemical fertilizers, and geological conditions. Currently, there are over 1 billion hectares of saline-alkali land globally, with my country accounting for approximately 100 million hectares, nearly one-tenth of the world's total. Saline-alkali soil, also known as saline soil, is a general term for both saline and alkali soils. Soils with high contents of soluble salts such as sodium chloride (NaCl) and sodium sulfate (Na₂SO₄) are generally called saline soils. Saline soils have high permeability and are typically neutral in pH. Alkaline soils are characterized by high levels of exchangeable sodium in their colloids, including alkaline salts such as sodium carbonate (Na₂CO₃) and sodium bicarbonate (NaHCO₃). Alkaline soils exhibit a higher degree of alkalization. Salt and alkali stress can cause osmotic stress, ion toxicity, and secondary stress, and the high pH environment of the soil can also harm crops.
[0003] Rice ( Oryza sativa Rice (L.) is one of the world's most important food crops, and the phenomenon of yield reduction due to soil salinization is becoming increasingly serious. Rice is a moderately salt- and alkali-sensitive crop. Under salt and alkali stress, it will suffer from secondary stresses such as osmotic stress, ion stress, and oxidative damage. At the same time, the high pH soil environment will also harm rice, leading to reduced yield or even crop failure. Salt stress affects all stages of rice growth and development. During germination, a high salinity environment reduces seed water absorption and inhibits germination. During the bud stage, salt stress inhibits root development, leading to poor root growth and affecting water and nutrient absorption. During the seedling stage, salt stress reduces seedling height, root length, and root number, impacting normal growth and development. During the tillering stage, a high salinity environment reduces plant height and tiller number, resulting in fewer effective panicles. During the reproductive growth stage, salt stress inhibits heading, prolongs the heading period, and delays flowering and maturity. It also reduces photosynthetic efficiency, decreasing the number of panicles per plant and the number of grains per panicle. Salt stress negatively impacts all stages of rice growth, with the seedling stage being particularly sensitive. Seedling tolerance directly affects seedling survival rate and final yield. Therefore, studying the genetic mechanism of salt and alkali tolerance in rice seedlings and discovering major salt and alkali tolerance genes is of great theoretical significance and practical application value for breeding salt and alkali tolerant rice varieties. Summary of the Invention
[0004] The purpose of this invention is to improve the salt and alkali tolerance of rice.
[0005] The application provides application of an OsMYB454 amino acid in regulating salt tolerance and / or alkali tolerance of rice, wherein the OsMYB454 amino acid sequence is shown as SEQ ID NO. 4.
[0006] The application provides an OsMYB454 gene in regulating salt tolerance and / or alkali tolerance of rice, wherein the nucleotide sequence of the OsMYB454 gene is shown as SEQ ID NO. 3.
[0007] The application provides a recombinant vector containing an OsMYB454 gene in regulating salt tolerance and / or alkali tolerance of rice, wherein the nucleotide sequence of the OsMYB454 gene is shown as SEQ ID NO. 3.
[0008] The application provides a recombinant microbial cell containing an OsMYB454 gene in regulating salt tolerance and / or alkali tolerance of rice, wherein the nucleotide sequence of the OsMYB454 gene is shown as SEQ ID NO. 3.
[0009] It is further limited that the salt stress condition is 120 mM NaCl, and the alkali stress condition is 75 mM NaHCO3.
[0010] The application provides a recombinant vector or microbial cell containing a mutant OsMYB454 gene.
[0011] The application provides application of a mutant OsMYB454 gene, a recombinant vector or microbial cell containing the mutant OsMYB454 gene in improving salt and alkali tolerance of rice.
[0012] The application provides a breeding method for improving salt and alkali tolerance of rice, and the method is characterized in that the steps of the method are as follows: Step 1: amplifying sgRNA of the OsMYB454 gene, wherein the sgRNA sequence is shown as SEQ ID NO. 7, and then connecting the sgRNA in a pYLCRISPR / Cas9Pubi-H vector to obtain a recombinant vector; Step 2: transforming the recombinant vector obtained in step 1 into Agrobacterium to obtain a recombinant Agrobacterium; Step 3: transfecting the recombinant Agrobacterium into rice callus to culture and obtain transgenic rice.
[0013] It is further limited that the primer pair for amplifying the sgRNA in step 1 is shown as SEQ ID NO. 5 and SEQ ID NO. 6.
[0014] The application provides a method for improving the salt and alkali tolerance of rice, which comprises knocking out or mutating an OsMYB454 gene in the rice and culturing the rice under the condition of 75 mM NaHCO3 and 120 mM NaCl.
[0015] Beneficial effects: the salt and alkali damage level of the OsMYB454 gene knockout strain under salt and alkali stress is significantly lower than that of the wild type, and the salt and alkali damage level of the OsMYB454 gene overexpression strain under salt and alkali stress is significantly higher than that of the wild type. The salt and alkali damage survival rate of the OsMYB454 gene knockout strain under salt and alkali stress is significantly higher than that of the wild type, and the salt and alkali damage survival rate of the OsMYB454 gene overexpression strain under salt and alkali stress is significantly lower than that of the wild type. BRIEF DESCRIPTION OF DRAWINGS
[0016] Figure 1 It is a gel map of PCR products, and the note is: M: DNA Marker (D2000); Figure 2 It is a physical map of the pYLCRISPR / Cas9-OsMYB454 vector of the CRISPR-Cas9 experiment; Figure 3 It is a detection result map of the Asc I enzyme digestion of the pYLCRISPR / Cas9-OsMYB454 vector, and the note is: M: DNA Marker (D2000); Figure 4 It is a transgene detection result map of the T0 generation plant of gene knockout; Figure 5 It is a CRISPR-Cas9 gene mutation site situation; Figure 6 It is a physical map of the overexpression vector pCAMBIA-OsMYB454-OE; Figure 7 It is a qRT-PCR detection result map of the expression situation of the OsMYB454 gene in the rice strain overexpressing the OsMYB454 gene; Figure 8 It is a phenotype identification result map of each rice genetic material of OsMYB454 under alkali stress condition in the seedling stage; Figure 9 It is a statistical situation result map of the alkali damage level of each rice genetic material of OsMYB454 under alkali stress condition in the seedling stage; Figure 10 It is a statistical situation result map of the survival rate of each rice genetic material of OsMYB454 under alkali stress condition in the seedling stage; Figure 11Phenotypic results of various rice genetic materials of OsMYB454 under salt stress conditions during the seedling stage; Figure 12 A statistical result of the salt damage level of each rice genetic material of OsMYB454 under salt stress conditions during the seedling stage is shown in the figure. Figure 13 The results of phenotypic identification of OsMYB454 rice genetic materials under salt stress conditions are shown in the figure. Figure 14 This is a PCR procedure diagram; Figure 15 This is a diagram of the qRT-PCR procedure. Detailed Implementation
[0017] Example 1. Amplification of the OsMYB454 gene sequence Total RNA was extracted from 7-day-old Zhonghua 11 seedlings, and cDNA was obtained by reverse transcription. The cDNA was then used as a template for RT-PCR amplification of the OsMYB454 cDNA sequence. The specific procedure is as follows: Total RNA was extracted from rice using TRIzol reagent (Invitrogen, Carlsbad, CA). 1 μg of total RNA was used to obtain cDNA via reverse transcription using a reverse transcription kit manufactured by Hangzhou Xinjing Bio-Reagent Development Co., Ltd., following the product instructions. Using the cDNA as a template, the upstream primer was 5'ATGGCGGACGGATCGGACG3' (SEQ ID NO.1); the downstream primer was 5'CTACCTCCTCCCACCCCGC3' (SEQ ID NO.2). The 50uL PCR amplification system consisted of: 0.8uL FastPfu polymerase (Beijing TransGen Biotech Co., Ltd.), 0.5uL cDNA, 10uL 5×PCR buffer, 100uM dNTPs, 25uM each of forward and reverse primers, and then the reaction system was brought up to 50uL with double-distilled water.
[0018] PCR procedure such as Figure 14 As shown, after the reaction was completed, the PCR product was recovered and sequenced. The PCR fragment size was 1944 bp. The PCR gel electrophoresis results are as follows. Figure 1 As shown, sequencing revealed that the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO.3, encoding the protein sequence shown in SEQ ID NO.4.
[0019] CDS sequence: (SEQ ID NO.3) Protein sequence: (SEQ ID NO. 4) MADGSDGPDVSPAAAAAAGGGGGGEIWGTLEELLLACAVSRHGTGSWDSVAMEVQTRSPLAARPGLTPTSCRLRFRHLHRRFSVGGAAEEDDDDEEAEEGGPDASAADGWMDELRRLRVAELRREVERCDLSIGTLQTKVKRLREEREQSIHGGGGGEGKPETANGDERLSSEEPGRSCRESNSTDLKPAARAGDHSVKAEEEDEDAAAAKQQASGESVAASKESSDLRSSASLRRRRRYKPGADEDADGEEASALRPPSQSPSSSSSSQPLAALLDTFAARFGPLLERLHESQESDAYRGAIRRHVDIEMVRRRLDASPAGGGGGGAAAAEFYRDLLLLCANALVFFPRAGPERGAAAEARALVSASLRLREPKQEPGTAAAAAVAAAAGSPPAEDTRRAEGVVSVGGGGGGAGIVGSLIEKGGKPLIVCRKRSSIAKAAAAAKKEESAEKGEAAEEGEGSDDGEKKVSVSASASKDKAWGLRTKKGRGPGKNSASVGGRKMAKLSEATEAATDGSKKPDKKIAADAATPAKKRNAVDFLKRLNQGSSPSKKKKKGSPMGTRKRAAAATSPEQPQKTRKGPGRKDAGRGGSKKGGKSATPKRSVGRPPSKRGAAAATTPPPSKRAKVNRSEKTAATATAAKRGGRR*.
[0020] Example 2. Construction of OsMYB454 gene CRISPR-Cas9 expression vector The gRNA expression cassette with 1 target site was ligated to the pYLCRISPR / Cas9-MT vector backbone, and the constructed vector was pYLCRISPR / Cas9-OsMYB454 vector Figure 2). The gene editing vectors are pYLsgRNA-OsU3 and pYLCRISPR / Cas9-MT vectors, which are described in Ma XL, Zhang QY, Zhu QL, et al. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants [J]. Molecular Plant, 2015, 8(8): 1274-1284. Target site linker primer sequences are as follows: Upstream primer: 5'GGCAGGACGGCCCCGACGTGTCTC 3' (SEQ ID NO. 5); downstream primer: 5'AAACGAGACACGTCGGGGCCGTCC 3' (SEQ ID NO. 6).
[0021] gRNA expression cassette sequence with 1 target site: (SEQ ID NO. 7) TTCAGAGGTCTCTCTCGCACTGGAATCGGCAGCAAAGGaaggaatctttaaacatacgaacagatcacttaaagttcttctgaagcaacttaaagttatcaggcatgcatggatcttggaggaatcagatgtgcagtcagggaccatagcacaagacaggcgtcttctactggtgctaccagcaaatgctggaagccgggaacactgggtacgttggaaaccacgtgtgatgtgaaggagtaagataaactgtaggagaaaagcatttcgtagtgggccatgaagcctttcaggacatgtattgcagtatgggccggcccattacgcaattggacgacaacaaaggctagtattagtaccacctcggctatccacatagatcaaagctggtttaaaagagttgtgcagatgatccgtggcaGGACGGCCCCGACGTGTCTCgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttcaaGAGCTTGGAGTGGATGGACCCGGTCGAGACCCACGCT; The plasmid was extracted by using a kit, and was cut by Asc I enzyme. The results are shown in Figure 3 The vector plasmid was cut out about 564 bp, which was a U3-gRNA (564 bp) expression cassette tandem size, proving that the CRISPR / Cas9 knockout vector was successfully constructed.
[0022] Example 3. Obtaining and identifying of OsMYB454 gene CRISPR-Cas9 transgenic plants The recombinant expression vector pYLCRISPR / Cas9-OsMYB454 constructed with the OsMYB454 gene obtained according to Example 2 was introduced into the normal Zhonghua 11 rice variety using the Agrobacterium EHA105-mediated genetic transformation method (Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, 1994, Plant Journal 6:271-282). After the transgenic plants grew, the leaves were cut to extract the DNA of the T0 generation plants, and PCR detection was performed using primers Hyg-F / R. The results, as shown in Figure 4 Figure 1, showed that the band size of 289 bp was a positive plant, and the negative plant could not amplify the band.
[0023] Hyg-F: ACGGTGTCGTCCATCACAGTTTGCC (SEQ ID NO. 8); Hyg-R: TTCCGGAAGTGCTTGACATTGGGGA (SEQ ID NO. 9); The target region sequence of the positive plant was amplified using sequencing primers MYB454-F / R to identify whether a gene mutation occurred near the target point and what kind of mutation occurred. The positive plants with effective mutations in the OsMYB454 gene were selected, and seeds were collected from individual plants until homozygous plants were detected in the T2 generation. MYB454-F: CCCCTGAGAAACGCGAAATT (SEQ ID NO. 10); MYB454-R: AGAGGACCCCCGTTAATTAC (SEQ ID NO. 11).
[0024] Results: The target sequence of CRISPR-Cas9 was selected from the obtained multiple OsMYB454 gene mutant lines, and two were used for subsequent experiments. The two selected OsMYB454 gene mutant lines were named CR-4 and CR-7, respectively, and were used for subsequent experiments.
[0025] The CRISPR line produced a mutation near the target point that hindered the normal function of the gene. The OsMYB454 gene of the CR-4 line had a 2-base insertion and a 14-base deletion at the target position, and the OsMYB454 gene of the CR-7 line had a 7-base deletion at the target position. Figure 5 .
[0026] Example 4. Construction of an OsMYB454 overexpression vector The cDNA was used as a template, and the primer sequences were as follows: upstream primer 5'ActagggtctcGCACCATGGCGGACGGATCGGAC 3' (SEQ ID NO. 12); downstream primer 5'ActagggtctcTCGCCCCTCCTCCCACCCCGC 3' (SEQ ID NO. 13); In the experiment, the overexpression fusion vector of the gene was constructed based on the CaMV 35S bidirectional driving pCAMBIA-1302 vector. After analyzing the vector sequence and the CDS sequence of the OsMYB454 gene, NcoI and BstEII were used as enzyme digestion sites to design overexpression amplification primers with vector enzyme digestion site homologous ends, and the recombinant expression vector pCAMBIA-OsMYB454-OE was obtained Figure 6 The recombinant expression vector pCAMBIA-OsMYB454-OE constructed above was introduced into the normal Zhonghua 11 variety by the Agrobacterium EHA105 mediated genetic transformation method (Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, 1994, Plant Journal 6: 271-282). After the transgenic plants grew, the leaves were cut to extract DNA, and primers were designed to perform PCR to screen positive plants into which the OsMYB454 gene was introduced, and seeds were collected from single plants until homozygous plants were detected in the T2 generation. The homozygous lines germinated on the MS medium (formula see Table 1) were identified by qRT-PCR for the expression amount of the OsMYB454 gene in each line. At the same time, we also detected the expression amount of OsMYB454 in the wild type and the overexpression lines. The specific operation is as follows: take 7-day-old seedlings of the OsMYB454 overexpression lines and the wild type, extract total RNA according to the method in step 1, and reverse transcribe to obtain cDNA. Take the cDNA as a template, take ACTIN1 gene as an internal reference, and use the Q-PCR kit (Takara Premix ExTaqT MII) produced by Dalian Baosheng Engineering Company to perform qRT-PCR. Two lines of the constructed overexpression OsMYB454 gene rice lines were selected and named OE-1 and OE-2 for subsequent experiments.
[0027] The qRT-PCR primer sequence of OsMYB454 is: upstream primer 5' GGAAGCAAGAAGCCCGACAAGAA 3' (SEQ ID NO. 14); downstream primer 5' ACGGCGACGAGCCCTGGTTTAG 3' (SEQ ID NO. 15). The qRT-PCR primer sequence of ACTIN1 gene is: upstream primer 5' TGGTCGTACCACAGGTATTGTGTT 3' (SEQ ID NO. 16); downstream primer 5' AAGGTCGAGACGAAGGATAGCAT 3' (SEQ ID NO. 17).
[0028] The qRT-PCR system is: 10 μM LP 0.25 μl, 10 μM RP 0.25 μl, cDNA 0.3 μl, double distilled water 4.2 μl, SYBR Green reagent 5 μl. The qRT-PCR procedure is shown in Figure 15 . The results are shown in Figure 7 , the content of OsMYB454 gene in the rice strain overexpressing OsMYB454 gene is higher than that in the wild type, and the overexpression of OsMYB454 gene is successful.
[0029] Table 1. Preparation of MS medium The formula of MS medium is as follows (1L):
[0030] Example 5. Evaluation of the alkali tolerance of the transgenic strain Full seeds were selected from wild type Zhonghua 11 and the transgenic strain, and were cultured in water for 3 days in a constant temperature incubator at 30°C, and were sowed in 96-well plates, one seed per well, and were cultured in water using Yoshida nutrient solution. The germinated seeds were transferred to an artificial climate chamber and were cultured under the conditions of 14 h light / 10 h darkness and a temperature of 25°C / 23°C. When they grew to two leaves and one heart, they were treated with Yoshida nutrient solution containing 75 mM NaHCO3 for 7 days, and the alkali injury level of the treatment group was determined. Then the Yoshida nutrient solution containing NaHCO3 was replaced with normal Yoshida nutrient solution, and the growth was recovered for 5 days, and the survival rate was determined. The test was repeated 3 times.
[0031] According to the standards of the International Rice Research Institute (IRRI), salinity damage is classified into levels 1, 3, 5, 7, and 9. (Gregorio GB, Senadhira D, Mendoza R D. Screening rice for salinity tolerance, vol 22, IRRI discussion paper series [J]. IRRI Discussion Papers, 1997.) Survival rate (%) = Number of surviving seedlings / Total number of seedlings.
[0032] The alkali tolerance of each strain during the seedling stage was determined, such as... Figure 8 As shown, the alkali damage levels of CR-4 and CR-7 knockout lines under alkali stress were significantly lower than those of the wild type, while the alkali damage levels of overexpression lines under alkali stress were significantly higher than those of the wild type. Figure 9 The survival rate of alkali stress under alkali stress was significantly higher in CR-4 and CR-7 knockout lines than in wild-type lines, while the survival rate of alkali stress under alkali stress was significantly lower in overexpression lines than in wild-type lines. Figure 10 WT represents wild-type rice Zhonghua 11 (as a control), CR-4 represents a transgenic rice line with the OsMYB454 gene knocked out, rendering it unable to function properly, CR-7 represents another transgenic rice line with the OsMYB454 gene knocked out, rendering it unable to function properly, OE-1 represents a transgenic rice line with overexpression of the OsMYB454 gene, and OE-2 represents another transgenic rice line with overexpression of the OsMYB454 gene.
[0033] Example 6. Evaluation of salt tolerance of transgenic lines Seeds with plump kernels were selected from wild-type Zhonghua 11 and transgenic lines, and hydroponically cultured in a 30℃ incubator for 3 days. One seed was then sown in each well of a 96-well plate and cultured hydroponically in Yoshida nutrient solution. Germinated seeds were transferred to an artificial climate chamber and cultured under 14 h light / 10 h darkness conditions and 25℃ / 23℃ conditions. When the seeds reached the two-leaf stage, they were treated with Yoshida nutrient solution containing 120 mM NaCl for 7 days, and the salt damage level of the treatment group was measured. The NaCl-containing Yoshida nutrient solution was then replaced with normal Yoshida nutrient solution, and after 5 days of recovery, the survival rate was measured. All experiments were performed in triplicate.
[0034] The results are as follows Figure 11-13As shown, the salt tolerance of each strain at the seedling stage was determined, and the salt injury level of the CR-4 and CR-7 knockout strains under salt stress was significantly lower than that of the wild type, while the salt injury level of the overexpression strains under salt stress was significantly higher than that of the wild type. The salt injury survival rate of the CR-4 and CR-7 knockout strains under salt stress was significantly higher than that of the wild type, while the salt injury survival rate of the overexpression strains under salt stress was significantly lower than that of the wild type.
Claims
1. The application of OsMYB454 amino acid in regulating the salt tolerance and / or alkali tolerance of rice, characterized in that, The amino acid sequence of OsMYB454 is shown in SEQ ID NO.
4.
2. The OsMYB454 gene plays a role in regulating the salt tolerance and / or alkali tolerance of rice, characterized by: The nucleotide sequence of the OsMYB454 gene is shown in SEQ ID NO.
3.
3. A recombinant vector containing the OsMYB454 gene regulates the salt tolerance and / or alkali tolerance of rice, characterized in that... The nucleotide sequence of the OsMYB454 gene is shown in SEQ ID NO.
3.
4. Recombinant microbial cells containing the OsMYB454 gene regulate the salt tolerance and / or alkali tolerance of rice, characterized in that... The nucleotide sequence of the OsMYB454 gene is shown in SEQ ID NO.
3.
5. The application according to any one of claims 1-4, characterized in that, The salt stress condition was 120 mM NaCl, and the alkali stress condition was 75 mM NaHCO3.
6. Recombinant vectors or microbial cells containing the mutant OsMYB454 gene.
7. Application of mutant OsMYB454 gene, recombinant vectors containing mutant OsMYB454 gene, or microbial cells in improving the salt and alkali tolerance of rice.
8. A breeding method for improving the salt and alkali tolerance of rice, characterized in that, The steps of the method are as follows: Step 1: Amplify the sgRNA of the OsMYB454 gene, the sgRNA sequence of which is shown in SEQ ID NO.7, and then ligate it into the pYLCRISPR / Cas9Pubi-H vector to obtain the recombinant vector; Step 2: Transform the recombinant vector obtained in Step 1 into Agrobacterium to obtain recombinant Agrobacterium; Step 3: Transfect recombinant Agrobacterium into rice callus and culture to obtain transgenic rice.
9. The breeding method according to claim 8, characterized in that, The primer pair for amplifying sgRNA in step 1 is shown in SEQ ID NO.5 and SEQ ID NO.
6.
10. A method for improving the salt and alkali tolerance of rice, characterized in that, The OsMYB454 gene in rice was knocked out or mutated, and the rice was cultured under conditions of 75 mM NaHCO3 and 120 mM NaCl.