Corn gene ZmGPT1 and application thereof

Abstract

The invention discloses a corn gene ZmGPT1 and application thereof, and relates to the technical field of biology. Overexpression of the gene in cruciferous plants can improve the starch content of leaves, so that growth and development of the plants are promoted, the yield of plant seeds is increased, and the gene has great significance in agricultural production.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a maize gene ZmGPT1 and its applications. Background Technology

[0002] Starch, as a core energy reserve substance in plants, directly determines their growth and development efficiency and environmental adaptability through its dynamic accumulation and decomposition processes. For most plants, starch is not only a storage form of photosynthetic products but also a key physiological indicator for coping with environmental stresses (such as drought and low temperatures), with its content directly reflecting the plant's tolerance. Precise regulation of starch metabolism is crucial for plant survival: insufficient accumulation may lead to energy shortages that prevent plants from completing their life cycle under adverse conditions; while excessive accumulation may limit the effective conversion of photosynthetic products, affecting the transition from vegetative to reproductive growth. Therefore, studying and editing genes related to plant starch biosynthesis has significant theoretical and practical value.

[0003] Plastids play a crucial role in plant starch synthesis. Specifically, transient starch produced by chloroplasts in plant leaf cells through photosynthesis gradually accumulates during the day, and at night, this temporarily accumulated starch is broken down into sugars for the plant's use. On the other hand, amylopectins are specifically responsible for the synthesis and storage of starch, especially in organs such as seeds and tubers, where large amounts of starch accumulate, providing the necessary energy reserves for plant growth, development, and reproduction. The functional state of plastids directly affects the efficiency of starch synthesis and the final yield in plants. GPT is a reverse transport protein located in the inner membrane of plastids (such as chloroplasts and amylopectins), responsible for exchanging glucose-6-phosphate (Glc6P) with inorganic phosphate (Pi) in the cytoplasm, providing the carbon skeleton and energy for starch biosynthesis and the oxidized pentose phosphate pathway (OPPP) within the plastid. While researchers have purified GPT protein from the outer membrane of maize endosperm plastids, its biological function has not yet been studied. Summary of the Invention

[0004] Based on the technical problems existing in the background art, the present invention proposes a maize ZmGPT1 gene and its application. Overexpression of this gene in cruciferous plants can increase the starch content of leaves, thereby promoting plant growth and development and increasing the yield of plant seeds.

[0005] This invention proposes an application of the maize gene ZmGPT1 in increasing the starch content of plant leaves. The starch content of plant leaves is increased by overexpressing the ZmGPT1 gene in plants. The CDS sequence of the maize gene ZmGPT1 is shown in SEQ ID NO.1.

[0006] This invention also proposes an application of the maize gene ZmGPT1 in increasing plant seed yield, by overexpressing the ZmGPT1 gene in plants to increase plant seed yield; the CDS sequence of the maize gene ZmGPT1 is shown in SEQ ID NO.1.

[0007] This invention also proposes an application of the maize gene ZmGPT1 in promoting plant growth and development, which promotes plant growth and development by overexpressing the ZmGPT1 gene in plants, including increasing the biomass of the aboveground and / or underground parts of the plant; the CDS sequence of the maize gene ZmGPT1 is shown in SEQ ID NO.1.

[0008] SEQ ID NO.1:

[0009]

[0010] In this invention, the above-ground parts of a plant refer to the stems and leaves; the underground parts of a plant refer to the roots.

[0011] In this invention, biomass refers to the dry or fresh weight of the plant.

[0012] Preferably, the method for overexpressing the ZmGPT1 gene in plants includes: constructing an overexpression vector of the CDS sequence of the maize gene ZmGPT1, and then transforming the overexpression vector into plants to overexpress the ZmGPT1 gene.

[0013] Preferably, the method for converting the overexpression vector into plants is Agrobacterium-mediated transformation.

[0014] Preferably, the plant is a cruciferous plant.

[0015] Preferably, the plant is Arabidopsis thaliana.

[0016] The beneficial effects of this invention are as follows:

[0017] This invention is the first to propose that overexpression of the maize gene ZmGPT1 in cruciferous plants (such as Arabidopsis thaliana) can increase the starch content of leaves, thereby promoting plant growth and development, increasing plant biomass, and increasing plant seed yield, which is of great significance to agricultural production. Attached Figure Description

[0018] Figure 1 The image shows the gel electrophoresis results of the ZmGPT1 CDS sequence of the maize gene.

[0019] Figure 2 This is the spectrum of the pEarleyGate100-3*flag vector.

[0020] Figure 3 This image shows the construction of the ZmGPT1 overexpression vector and the detection results of its overexpression level in transgenic Arabidopsis thaliana. Image a shows a schematic diagram of the ZmGPT1 overexpression vector construction method; image b shows the qRT-PCR analysis results of ZmGPT1 expression levels in transgenic and wild-type Arabidopsis thaliana; and image c shows the Western blot results of detecting ZmGPT1 expression levels in transgenic and wild-type Arabidopsis thaliana.

[0021] Figure 4 The results show the detection of starch and soluble sugar in transgenic and wild-type Arabidopsis thaliana. In the figures, a) shows the KI-I2 staining results of transgenic and wild-type Arabidopsis thaliana; b) shows the starch content detection results of leaves of transgenic and wild-type Arabidopsis thaliana; and c) shows the soluble sugar content detection results of leaves of transgenic and wild-type Arabidopsis thaliana.

[0022] Figure 5 The results show the plant morphology and seed yield of transgenic and wild-type Arabidopsis thaliana. In this data, a represents the overall aboveground morphology of the plant 45 days after transplanting, b represents the morphology of the main stem 45 days after transplanting, c represents the morphology of siliques collected after full maturity, d represents the quantitative analysis results of seed yield, and e represents the results of silique length measurement. Detailed Implementation

[0023] The technical solution of the present invention will now be described in detail through specific embodiments.

[0024] Unless otherwise specified, the methods used in the embodiments are conventional methods known to those skilled in the art, and the reagents and materials used are conventional or commercially available products.

[0025] Example 1

[0026] 2.1 Extraction of total RNA from maize

[0027] (1) Prepare the mortar and grinding rod required for grinding the sample, and transfer them to a dry heat oven at 180℃ for dry heat sterilization for 16 h for later use; prepare enzyme-free and sterile 2 mL and 1.5 mL centrifuge tubes, 1000 μL pipette tips and 200 μL yellow pipette tips; set the refrigerated centrifuge to 4℃ for pre-cooling, and place the 75% ethanol prepared with Trizol, chloroform:isoamyl alcohol (24:1), isopropanol and DEPC water on ice for pre-cooling;

[0028] (2) After the mortar is pre-cooled with liquid nitrogen, an appropriate amount of fresh kernels of B73 maize inbred line (provided by the National and Local Joint Engineering Laboratory for Crop Stress Resistance Breeding and Disaster Reduction of Anhui Agricultural University) are transferred into the mortar, ground quickly, and then quickly transferred to a 2 mL centrifuge tube. 1 mL of Trizol solution is added, and the mixture is thoroughly shaken and mixed with a vortex mixer. The mixture is then left to stand on ice for 10 min.

[0029] (3) Add 250 μL of pre-cooled chloroform:isoamyl alcohol (24:1) to the sample obtained in step (2) in a fume hood, shake vigorously for 30 seconds with a vortex mixer to mix thoroughly, and let stand on ice for 12 min.

[0030] (4) The sample obtained after step (3) is transferred to a pre-cooled 4°C refrigerated centrifuge and centrifuged at 12000 r / min for 15 min.

[0031] (5) Take 500 μL of the upper aqueous phase of the sample obtained in step (4) and transfer it to a new 1.5 mL centrifuge tube. Then add an equal volume of pre-cooled isopropanol, invert the tube to mix thoroughly, and let it stand on ice for 12 min to allow the RNA to precipitate fully. Then transfer it to a pre-cooled 4℃ refrigerated centrifuge and centrifuge at 12000 r / min for 15 min.

[0032] (6) Discard the supernatant in the fume hood, add 1 mL of pre-cooled 75% ethanol, mix by inverting, and centrifuge at 12000 r / min for 5 min.

[0033] (7) Repeat step (6) once;

[0034] (8) Discard the supernatant, centrifuge at 12000 r / min for 2 min in a centrifuge at 4℃, transfer to a pre-sterilized clean bench, and aspirate the remaining ethanol solution with a 200 μL pipette tip without RNase.

[0035] (9) Dry in a clean bench; after drying, add 50 μL of RNase-free water, mix with a pipette tip to fully dissolve the RNA, and store the RNA in a -80℃ refrigerator for later use.

[0036] 2.2 Obtaining cDNA from RNA reverse transcription

[0037] The total maize RNA obtained above was reverse transcribed using the Novizan Biotechnology Co., Ltd. Reverse Transcription Kit (312-01 / 02) to obtain cDNA. The procedure was performed according to the manufacturer's instructions, as follows:

[0038] 2.2.1 RNA template denaturation

[0039] Prepare the following mixture in an RNase-free centrifuge tube (components are shown in Table 1), gently mix with a pipette, heat at 65°C for 5 min, quickly cool on ice, and let stand on ice for 2 min.

[0040] Table 1

[0041]

[0042] 2.2.2 RNA template denaturation

[0043] Add 2 μL of 5×gDNA wiper Mix to the mixture from the previous step, and gently mix by pipetting. Incubate at 42°C for 2 min.

[0044] 2.2.3 Prepare the reverse transcription reaction system and carry out the reverse transcription reaction.

[0045] Prepare the following mixture in an RNase-free centrifuge tube (components are shown in Table 2), gently mix with a pipette, and carry out the reverse transcription reaction. The specific temperature for the reverse transcription reaction is shown in Table 3.

[0046] Table 2

[0047]

[0048] Table 3

[0049]

[0050] The product after the reverse transcription reaction is completed is cDNA. The product should be stored at -20℃ but should be used within six months. If it is to be stored for a long period of time (more than six months), it should be aliquoted and stored at -80℃. In addition, cDNA should be protected from repeated freeze-thaw cycles to avoid degradation.

[0051] 2.3 Construction of recombinant plasmids

[0052] The published maize gene ZmGPT1 CDS sequence in the database (as shown in SEQ ID NO.1, sequence source: MaizeGDB database, gene number Zm00001eb413160) was used to design primers for PCR amplification using homologous recombination. The PCR reaction system of Toyobo KOD-Plus-Neo (KFX-201) is shown in Table 4, and the PCR reaction procedure is shown in Table 5. The PCR product (the amplified maize gene ZmGPT1 CDS sequence) was detected by 1% agarose gel electrophoresis. The detection results are shown in Table 5. Figure 1 As shown ( Figure 1 Lanes 1 and 2 are two replicates of the PCR product described above.

[0053] The ZmGPT1 CDS sequence is as follows:

[0054] SEQ ID NO.1:

[0055]

[0056] The PCR primer sequences are as follows:

[0057] SEQ ID NO.2:

[0058] ZmGPT1-F:

[0059] CAGGTCGACTCTAGAGGATCCATGATACCTTCCGTGAGGCT.

[0060] SEQ ID NO.3:

[0061] ZmGPT1-R:

[0062] CGATCGGGGAAATTCGAGCTCTCACGCCTTTGCCTGAGAG.

[0063] The cloned maize gene ZmGPT1 CDS sequence was inserted into the following... Figure 2 The vector pEarleyGate100-3*flag shown is used to obtain the recombinant plasmid (pEarleyGate100-ZmGPT1-3*flag). A schematic diagram illustrating the specific construction of the pEarleyGate100-ZmGPT1-3*flag recombinant plasmid is shown below. Figure 3 As shown in 'a'.

[0064] Table 4

[0065]

[0066] Table 5

[0067]

[0068] 2.4 Transformation of recombinant plasmids into Agrobacterium

[0069] (1) Take GV3101 Agrobacterium competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd., catalog number AC1001) stored at -80℃ and let them partially melt at room temperature for a while. When they are in an ice-water mixture state, insert them into ice.

[0070] (2) Use a sterile pipette tip to draw 2 μL of the recombinant plasmid obtained in step 2.3 above and add it to 100 μL of competent cells. Gently tap the bottom of the tube to mix, and place on ice for 5 min.

[0071] (3) Place it in liquid nitrogen for quick freezing for 5 min, then heat shock it in a 37°C water bath for 5 min, and finally place it on ice for 5 min.

[0072] (4) Add 600 μL of antibiotic-free LB liquid medium and incubate at 28℃ with shaking at 200 r / min for 2-3 h;

[0073] (5) Take 100 μL of the Agrobacterium tumefaciens revived in step (4) and spread it evenly on LB solid medium (containing 50 μg / mL kanamycin and 50 μg / mL lifumycin). Incubate at 28℃ upside down for 2-3 days. Verify the resistant colonies by PCR, shake the bacteria, and amplify them to obtain Agrobacterium tumefaciens containing recombinant plasmids. Store it for later use.

[0074] 2.5 Obtaining Transgenic Arabidopsis

[0075] Arabidopsis thaliana belongs to the Brassicaceae family, Angiosperms, and Dicotyledons. Its advantages include small plant size and high seed production. The Arabidopsis genome is the smallest known plant genome. It is a self-pollinating plant with highly homozygous genes. In maize breeding, Arabidopsis thaliana, a model plant in the same family, is often used as the initial research subject because the two share similar morphological and structural characteristics and exhibit similar molecular regulatory mechanisms in many developmental processes.

[0076] 2.5.1 Sterilization treatment of Arabidopsis thaliana seeds

[0077] Take an appropriate amount of Colombian wild-type Arabidopsis thaliana seeds (provided by the National-Local Joint Engineering Laboratory for Crop Stress Resistance Breeding and Disaster Reduction of Anhui Agricultural University) into a 2 mL centrifuge tube and place it in a plastic box. Then take a 100 mL beaker, add 1.5 mL of concentrated hydrochloric acid and 50 mL of disinfectant (the disinfectant is an aqueous solution of sodium hypochlorite and sodium hydroxide, with the concentration of sodium hypochlorite being 6 wt% and the concentration of sodium hydroxide being 1 wt%), place it in the same plastic box, seal the plastic box, let it stand for 15 h, and then take it out in an ultra-clean workbench for later use.

[0078] 2.5.2 Cultivation of wild-type Arabidopsis thaliana

[0079] (1) Sterilized Arabidopsis thaliana seeds were evenly sown on 1 / 2MS solid medium and placed vertically in an artificial climate chamber for growth. The growth conditions were controlled as follows: 25℃, 16 h-light / 8 h-dark light.

[0080] (2) Mix vermiculite and nutrient soil in a volume ratio of 1:1, divide into small square basins (7 cm × 7 cm × 10 cm), place the square basins in a tray, add tap water to the bottom of the tray, and let the nutrient soil and vermiculite slowly soak and moisten.

[0081] (3) When the Arabidopsis thaliana grows to 10-12 days and the root length is about 8 cm, open the culture dish, use tweezers to gently transplant the Arabidopsis thaliana into the nutrient soil prepared in step (2), and cover it with plastic wrap to prevent the seedlings from losing water.

[0082] (4) After a week, when the seedlings are growing steadily, remove the plastic wrap to allow them to grow normally. Water and fertilize them at appropriate times to prevent pests and diseases. Infect them when Arabidopsis thaliana flowers.

[0083] 2.5.3 Agrobacterium infection in Arabidopsis thaliana

[0084] (1) After activating the Agrobacterium tumefaciens bacterial culture containing recombinant plasmid, take 500 μL to 100 mL of liquid LB medium containing antibiotics (kanamycin, rifampin) to expand the culture, and culture at 28℃ and 220 rpm in the dark for 36-48 h.

[0085] (2) Collect the bacterial culture in a 50 mL centrifuge tube, centrifuge at 5000 rpm at room temperature for 5 min, and discard the supernatant;

[0086] (3) Add 40 mL of 5% sucrose solution to fully suspend the bacterial cells and mix well;

[0087] (4) Centrifuge at 5000 rpm at room temperature for 5 min, and discard the supernatant;

[0088] (5) Collect the bacterial culture in a 50 mL centrifuge tube, centrifuge at 5000 rpm at room temperature for 5 min, and discard the supernatant;

[0089] (6) Add 30 mL of Arabidopsis thaliana transformation buffer (containing 5 g of sucrose and 40 μL of silwet-L77 surfactant per 100 mL), fully suspend the bacterial cells and mix well;

[0090] (7) Use a Pasteur dropper to draw a certain amount of suspension and drip it onto the stigma of Arabidopsis thaliana that is about to flower. After the infection is completed, cover the infected plant with a black plastic bag, water and fertilize in time to prevent pests and diseases, and remove the black plastic bag after 16 hours.

[0091] (8) Stop watering when most of the siliques of the infected Arabidopsis thaliana mature and turn yellow, and harvest the T0 generation transgenic seeds one after another.

[0092] 2.5.4 Screening of transgenic positive lines of Arabidopsis thaliana

[0093] After disinfection and vernalization, T0 generation transgenic Arabidopsis seeds (OE-ZmGPT1) were evenly sown on 1 / 2 MS solid medium containing 50 mg / L glufosinate and placed vertically in an artificial climate chamber for growth. The growth conditions were controlled as follows: 25℃, 16 h-light / 8 h-dark light. After 7-10 days of growth in the greenhouse, Arabidopsis seedlings that grew normally on the plate were identified as transgenic positive seedlings and transplanted into nutrient soil. Through the above method, three transgenic Arabidopsis positive seedlings (OE-ZmGPT1) were obtained and designated as OE-4, OE-6, and OE-12, respectively.

[0094] When the transgenic positive Arabidopsis seedlings are about to flower, take 1-2 leaves from each plant, extract DNA for qRT-PCR verification, and extract protein for proteomic analysis.

[0095] (a) qRT-PCR validation

[0096] (1) Following the methods in 2.1 and 2.2, total RNA was extracted from the young leaves of the transgenic Arabidopsis thaliana (OE-ZmGPT1) and the control group (WT group), respectively. Then, the same amount of total RNA was used for reverse transcription to obtain cDNA from the transgenic Arabidopsis thaliana (OE-ZmGPT1) and the control group (WT group).

[0097] (2) Design of qPCR primers for ZmGPT1: Specific primers ZmGPT1-qF and ZmGPT1-qR were designed based on the cDNA sequence of ZmGPT1.

[0098] SEQ ID NO.4:

[0099] ZmGPT1-qF: GCACATTCCTGTACTCTCAGGC

[0100] SEQ ID NO.5:

[0101] ZmGPT1-qR:CCAACAAACAAGAACGAAACAGC

[0102] (3) The maize Ubi1 gene (the sequence of the Ubi1 gene is shown in SEQ ID NO.6, the sequence source is MaizeGDB database, the gene number is GRMZM2G409726) was used as an internal reference gene for quantitative PCR reaction.

[0103] The specific steps are as per the instructions for the Nanjing Novizan qPCR SYBR Green Master Mix (Q111). The qPCR reaction system is shown in Table 6, and the qPCR reaction procedure is shown in Table 7.

[0104] Table 6

[0105]

[0106] Table 7

[0107]

[0108] (4) After the operation is complete, export the C values ​​of each reaction well from the computer. T Value, using C T Data analysis is performed using the value comparison method.

[0109] Figure 3 In the figure, b represents the qRT-PCR analysis results of ZmGPT1 expression levels in the transgenic and wild-type Arabidopsis thaliana, and the results were tested using one-way ANOVA (n=3). The qRT-PCR results show that, compared with wild-type (WT) Arabidopsis thaliana, the expression level of the ZmGPT1 gene was significantly increased in the three transgenic Arabidopsis thaliana lines (OE-4, 6, and 12).

[0110] (II) Extraction of endogenous total protein from Arabidopsis thaliana:

[0111] (1) Take the tender leaves of the above-mentioned transgenic Arabidopsis thaliana (OE-ZmGPT1) and wild-type (WT) Arabidopsis thaliana, put them into 2 mL centrifuge tubes, add steel balls, liquid nitrogen, and quick freeze;

[0112] (2) Vibrate and grind the blades until they are powdery;

[0113] (3) Add protein extraction buffer (1 g tissue / 1 mL) and continue to mix thoroughly; the components of the protein extraction buffer are shown in Table 8.

[0114] (4) Place the mixture on ice for 30 minutes, and mix it by inverting it every 5 minutes during this period.

[0115] (5) Centrifuge at 8000 rpm and 4℃ for 15 min;

[0116] (6) Take 50 μL and add 10 μL of 6×protein loading buffer. Mix thoroughly and boil in a metal bath at 98°C for 10 minutes to obtain the endogenous total protein sample for later use.

[0117] Table 8

[0118]

[0119] (III) Protein Gel Electrophoresis Experiment:

[0120] The endogenous total protein extracted in step (II) was used for protein gel electrophoresis. The specific steps are as follows:

[0121] (1) Clip the front and back plates of the washed and dried protein glue plate together to ensure that the lower edges of the front and back plates are flush.

[0122] (2) Prepare 10% separating gel and 4% stacking gel using Shanghai Sangon PAGE Gel Rapid Preparation Kit (Catalog No.: C631100), insert a clean and dry comb, wait for the stacking gel to solidify, remove the comb, load the sample and run the gel.

[0123] (3) Clamp the protein gel in the electrophoresis tank, add 1×Tris-Gly buffer to the inner and outer tanks, and add the sample to the gel wells with a pipette. Add 10 μL of the endogenous total protein sample obtained in step (II) to each well of the 1.0 mm protein gel plate.

[0124] (4) Cover the electrophoresis tank, connect the power cord to the electrophoresis apparatus, turn on the electrophoresis apparatus, perform electrophoresis at 120 V for 20 minutes, then adjust the voltage to 100 V until the blue gel is loaded to the bottom of the gel and stop the gel running. Then perform Coomassie brilliant blue staining or membrane transfer hybridization.

[0125] (iv) Western blot (immunoblotting, protein blotting) experiment:

[0126] (1) Open the transfer clamp and place it flat on the table. Lay a sponge and filter paper moistened with transfer buffer on the black panel. Take out the SDS-PAGE protein gel from step (3) and spread it flat on the filter paper. Then lay the PVDF membrane activated with methanol on the protein gel. Lay the moistened filter paper and sponge flat on it in order and close the transfer clamp.

[0127] (2) Pour transfer buffer into the transfer tank, immerse the transfer clamp from step (1) into the transfer buffer, adjust the electrophoresis current to 15 mA, and transfer the membrane for 16 h.

[0128] (3) Sealing: Take out the PVDF membrane, wash it with TBST for 5 min and then transfer it into a clean plastic box. Add 5% skim milk powder sealing solution to the box to immerse the PVDF membrane and incubate at room temperature for 2 h.

[0129] (4) Primary antibody incubation (flag-tagged antibody): Take out the membrane and wash it in TBST for 5 min. Dilute the primary antibody (Abcam, catalog number ab205606) in TBST buffer, and then immerse the membrane in antibody TBST buffer and incubate at room temperature for 2 h or at 4°C for 16 h.

[0130] (5) Secondary antibody incubation: Take out the membrane and wash it 4 times in TBST for 15 min each time. Dilute the anti-mouse IgG (full molecular weight) - peroxidase (goat anti) secondary antibody (Merck Sigma-Aldrich, catalog number A4416) in TBST buffer, and then immerse the membrane in antibody TBST buffer and incubate at room temperature for 2 h or at 4°C for 16 h.

[0131] (6) Take out the membrane and wash it 4 times in TBST buffer. Then, spread the ECL reaction solution (purchased from Shanghai Sangon Biotech Co., Ltd., catalog number RPN3244) evenly on the membrane and place it in the Tianneng chemiluminescence instrument for exposure and image taking.

[0132] The results of the above Western blot experiments are as follows: Figure 3 As shown in c in the figure. The results showed that, compared with wild-type Arabidopsis, the level of ZmGPT1-flag fusion protein was significantly increased in the three transgenic Arabidopsis lines (OE-4, 6, and 12), indicating that the protein can be normally expressed in the transgenic lines.

[0133] 2.6 Determination of starch content in leaves of transgenic plants

[0134] (1) Take transgenic Arabidopsis thaliana (OE-4, 6, 12) and wild-type (WT) Arabidopsis thaliana seedlings that have been sown for 3 weeks and put them into 90% ethanol. Mix them gently every 5 minutes. Replace the 90% ethanol after 1 hour. Repeat the operation until the Arabidopsis thaliana leaves are completely decolorized.

[0135] (2) Immerse the right side of the decolorized Arabidopsis thaliana in a KI-I2 solution (2% KI, 1% I2) for iodine staining for 1 min, observe and photograph the results. Figure 4 As shown in 'a';

[0136] (3) Leaf tissues from transgenic Arabidopsis thaliana (OE-ZmGPT1) and the control group (WT group) three weeks after sowing were collected to determine the starch and soluble sugar content. Starch content was determined according to the instructions provided with the Solarbio Starch Content Assay Kit (catalog number: BC0705), and soluble sugar content was determined according to the instructions provided with the Solarbio Soluble Sugar Assay Kit (catalog number: BC0035). The starch content test results are as follows: Figure 4 As shown in b, a one-way ANOVA was used for the test, n=3; the soluble sugar content test results are as follows. Figure 4 As shown in c, a one-way ANOVA was used to test the variance, with n=3.

[0137] Depend on Figure 4It is evident that, compared with the wild type (CK), the transgenic Arabidopsis lines (ZmGPT1-OE4, ZmGPT1-OE6, ZmGPT1-OE12) that overexpressed the maize gene ZmGPT1 showed a significant increase in leaf starch content, demonstrating that overexpression of the maize gene ZmGPT1 has the effect of increasing the starch content of cruciferous plant leaves.

[0138] 2.7 Cultivation of transgenic Arabidopsis thaliana

[0139] (I) Seed pretreatment and sowing

[0140] 1. Seed disinfection: Select wild-type (WT) seeds of Arabidopsis thaliana and overexpression lines OE-4, OE-6, and OE-12, soak them in 75% ethanol for 1 minute, rinse them 3 times with sterile water; then soak them in 1% sodium hypochlorite solution with gentle shaking for 10 minutes, rinse them 5-6 times with sterile water to remove residual disinfectant.

[0141] 2. Vernalization treatment: After sterilization, spread the seeds evenly in a petri dish containing 1 / 2 MS solid medium, seal it and place it in a refrigerator at 4°C for 3 days in the dark to break seed dormancy and ensure uniform germination;

[0142] 3. Sowing and Seedling Cultivation: After vernalization, the culture dishes were transferred to an artificial climate chamber, and the conditions were set as follows: light intensity 120 μmol·m⁻². -2 ・s -1 The photoperiod was 16 hours of light / 8 hours of darkness, the temperature was 22±1℃, and the relative humidity was 60%~70%. After 7 days of cultivation, seedlings with uniform growth were selected and transplanted into sterilized nutrient soil (a mixture of peat moss, vermiculite, and perlite in a mass ratio of 2:1:1), with 3 seedlings per pot. They were then cultivated under the same climate chamber conditions, with regular watering (twice a week, watering thoroughly until water seeps into the bottom of the pot) to avoid waterlogging.

[0143] (II) Growth cycle management and sample collection

[0144] 1. Management during the vegetative growth period: The vegetative growth period is 2-4 weeks after transplanting. Regularly observe the plant shape and leaf morphology to ensure a stable growth environment and avoid interference from pests and diseases.

[0145] 2. Management during the reproductive growth period: After the plant bolts, record the flowering time, maintain stable light and temperature to ensure successful pollination; before the siliques mature, avoid water stress to prevent poor seed development;

[0146] 3. Sample Collection

[0147] Late vegetative growth stage (45 days after transplanting): Collect photos of the whole plant and plant stems;

[0148] Late reproductive growth stage (when the siliques are fully mature, about 60 days after transplanting): Harvest the whole plant's siliques, dry them, thresh them, and use them for seed weighing.

[0149] The plant morphology and seed yield of the above-mentioned wild-type and transgenic Arabidopsis thaliana after culture are as follows: Figure 5 As shown in Figures, a represents the overall morphology of the aboveground parts of the plant 45 days after transplanting, b represents the morphology of the stem 45 days after transplanting, c represents the morphology of the siliques collected after full maturity, d represents the quantitative analysis results of seed yield, and e represents the silique length measurement results. Observation of the overall morphology of Arabidopsis plants after 45 days of growth, as shown in a, reveals that the plant height and number of branches of the heterologously transformed ZmGPT1 Arabidopsis are significantly increased compared to the WT plants, indicating that overexpression of the ZmGPT1 gene promotes plant growth. Observation of the main stem of Arabidopsis, as shown in b, shows that the main stem of the heterologously transformed ZmGPT1 Arabidopsis is thicker than that of the wild type. Furthermore, observation of the pods on the main stem at the same location, as shown in c, shows that the pods of the OE lines are longer than those of the wild type. Quantitative analysis results of the seed weight and pod length of individual Arabidopsis plants in d and e indicate that the seed weight and silique length of individual plants in the three overexpressing Arabidopsis lines are significantly higher than those of the WT line. These results indicate that overexpression of the ZmGPT1 gene not only promotes the growth and development of Arabidopsis thaliana but also significantly increases seed yield per plant. This is because overexpression of the ZmGPT1 gene provides sufficient carbon source for its reproductive growth and seed development: during the vegetative growth stage, ZmGPT1 gene overexpression accumulates a large amount of starch in organs such as leaves. This starch can be transported to floral organs and siliques during the reproductive growth stage, providing sufficient carbon and energy for pollen development, pollination and fertilization, and seed filling. On the one hand, it promotes an increase in the number and length of siliques, improving the seed setting rate; on the other hand, it ensures the synthesis and accumulation of nutrients such as starch and protein within the seeds, increasing both the total seed yield per plant and the thousand-seed weight, ultimately enhancing seed yield.

[0150] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. The application of a maize gene ZmGPT1 in increasing starch content in plant leaves, characterized in that, The starch content of plant leaves can be increased by overexpressing the ZmGPT1 gene in plants; the CDS sequence of the maize gene ZmGPT1 is shown in SEQ ID NO.

1.

2. The application of a maize gene ZmGPT1 in increasing plant seed yield, characterized in that, The application includes increasing plant seed yield by overexpressing the ZmGPT1 gene in plants; the CDS sequence of the maize gene ZmGPT1 is shown in SEQ ID NO.

1.

3. The application of a maize gene ZmGPT1 in promoting plant growth and development, characterized in that, Plant growth and development are promoted by overexpressing the ZmGPT1 gene in plants, and the promotion of plant growth and development includes increasing the biomass of the aboveground and / or underground parts of the plant; the CDS sequence of the maize gene ZmGPT1 is shown in SEQ ID NO.

1.

4. The application according to any one of claims 1 to 3, characterized in that, A method for overexpressing the ZmGPT1 gene in plants includes: constructing an overexpression vector of the CDS sequence of the maize gene ZmGPT1, and then transforming the overexpression vector into plants to overexpress the ZmGPT1 gene.

5. The application according to any one of claims 1 to 3, characterized in that, The method for converting the overexpression vector into plants is Agrobacterium-mediated transformation.

6. The application according to any one of claims 1 to 3, characterized in that, The plant in question is a member of the Brassicaceae family.

7. The application according to claim 6, characterized in that, The plant in question is Arabidopsis thaliana.

Images