Application of OsRH11 protein and coding gene thereof in controlling male reproductive development of rice

Abstract

The invention relates to the technical field of plant biological breeding, in particular to application of OsRH11 protein and a coding gene thereof in controlling male reproductive development of rice. The rice OsRH11 gene is separated and cloned, and it is found that a rice plant with the OsRH11 gene knocked out is pollen-free abortion; the pollen fertility of the complemented plant line is recovered, and the single plant maturing rate in the mature period is close to that of a wild type. Therefore, the invention newly finds a gene, namely the OsRH11 gene, related to the male sterility of the rice. Meanwhile, the reason of rice male sterility caused by gene mutation is discussed, the molecular mechanism of rice male sterility pollen abortion is clarified, the cognition of people on the rice male sterility molecular mechanism is further deepened, and a new viewpoint is provided for the molecular regulation mechanism of rice male reproductive development. The application of the male sterility gene OsRH11 gene in genetic improvement of rice varieties has important practical significance for rice breeding workers.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant biological breeding, and particularly relates to application of OsRH11 protein and a coding gene thereof in control of rice male reproductive development. BACKGROUND

[0002] Rice male sterility is a key aspect of reproductive development and the basis of hybrid rice breeding, which can significantly improve crop yield. There are many factors leading to male sterility, involving microspore mother cell development, meiosis, tapetum development and degradation, synthesis and transport of nutrients in anther wall, pollen wall formation, starch accumulation and anther dehiscence, etc. Among these processes, the research on programmed cell death (PCD) and synthesis and transport of nutrients in anther wall is relatively in-depth. These processes are crucial for the normal formation and maturation of pollen cells in the later stage of anther development, and directly affect the success of rice male reproductive development. Rice male reproductive development is highly complex, and the exploration and molecular mechanism research of core regulatory factors have always been a new hotspot and focus of rice biology research. Further exploration and utilization of rice male sterility genes, analysis of their expression regulation mechanism, and exploration of their breeding application value can not only lay a theoretical foundation for the research on molecular mechanisms of crop male sterility, and improve the understanding of the process of rice reproductive development and its molecular mechanisms, but also provide advantageous utilization resources and approaches for creating new hybrids, directly serving rice breeding improvement and production practice, and having important application foundation and scientific exploration significance.

[0003] RNA helicases are enzymes that use the energy released by hydrolyzing ATP to open the hydrogen bonds of RNA double strands, and are involved in almost all RNA metabolism processes, including precursor mRNA splicing, translation initiation, ribosome formation, RNA degradation, etc. According to the sequence ordering characteristics of the conserved sequences in the helicase and structure, they are divided into five superfamilies (named SF1-SF5), among which SF1 and SF2 are two main superfamilies. Among them, the DEAD / H-box RNA protein belongs to the SF2 family member, and is involved in the whole process of RNA from initial transcription to senescence and death.

[0004] Reports on DEAD / H-box RNA helicases in plants mainly focus on plant responses to abiotic stresses (such as low temperature, heat, salt, and oxidative stress). In these studies, RNA helicases are mostly involved in the splicing of precursor mRNAs. The AtRH7 gene regulates the plant's response to cold stress by participating in the biosynthesis of Arabidopsis rRNA and ribosome assembly. The SHI2 gene is a DEAD-box RNA helicase that responds to both salt and cold stress; mutations in this gene lead to a decrease in the number and intensity of cold stress-responsive genes and result in missplicing of some cold stress genes. The RNA helicase gene UAP56 interacts with the E3 ubiquitin ligase gene COP1, binding to common small RNAs and target gene mRNAs to jointly control the selective splicing of precursor mRNAs, thereby negatively regulating photomorphogenesis in Arabidopsis. In rice, OsRH2 and OsRH34, as homologs of the eukaryotic initiation factor eIF4AIII, regulate the cleavage of OsUDT1 mRNA through synergistic action with the exon junction complex (EJC), thereby affecting plant growth and development. However, to date, no research has been reported on the involvement of RNA helicases in plant male reproductive development. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the OsRH11 protein and its encoding gene in controlling male reproductive development in rice, so as to solve the problems existing in the prior art.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides the application of the OsRH11 protein, the encoding gene of the OsRH11 protein, and biological materials with the encoding gene knocked out in controlling male reproductive development in rice. The amino acid sequence of the OsRH11 protein is shown in SEQ ID NO.10; the nucleotide sequence of the encoding gene is shown in SEQ ID NO.12.

[0008] Preferably, male sterility in rice is achieved by inhibiting the activity of the OsRH11 protein or the expression level of the encoding gene.

[0009] Preferably, the biomaterial includes a recombinant vector.

[0010] This invention provides the application of OsRH11 protein, the encoding gene of OsRH11 protein, and biological materials with the encoding gene knocked out in the cultivation of male sterile rice lines. The amino acid sequence of the OsRH11 protein is shown in SEQ ID NO.10; the nucleotide sequence of the encoding gene is shown in SEQ ID NO.12.

[0011] Preferably, the rice male-sterile line is obtained by inhibiting the activity of the OsRH11 protein or the expression level of the encoding gene.

[0012] This invention provides a method for creating a male-sterile rice line, the method comprising the step of inhibiting the activity of the OsRH11 protein or the expression level of the encoding gene in the rice to obtain male-sterile rice plants; the amino acid sequence of the OsRH11 protein is shown in SEQ ID NO.10; the nucleotide sequence of the encoding gene is shown in SEQ ID NO.12.

[0013] Preferably, the rice variety includes Zhonghui 8015.

[0014] This invention provides the use of the male-sterile rice lines obtained by the above method in rice seed production.

[0015] More preferably, the application involves using the aforementioned male-sterile rice line as the female parent for hybridization breeding.

[0016] This invention provides a molecular marker primer combination for the OsRH11 male sterile line, the molecular marker primer combination comprising ARMS-SC13-IF (nucleotide sequence as shown in SEQ ID NO.6), ARMS-SC13-IR (nucleotide sequence as shown in SEQ ID NO.7), ARMS-SC13-OF (nucleotide sequence as shown in SEQ ID NO.8), and ARMS-SC13-OR (nucleotide sequence as shown in SEQ ID NO.9).

[0017] This invention provides the application of the above-mentioned molecular marker primer combination in the backcrossing and breeding of male-sterile rice lines.

[0018] The present invention discloses the following technical effects:

[0019] This invention isolated and cloned the rice OsRH11 gene. It was found that rice plants with the OsRH11 gene knocked out exhibited pollen-free male sterility, while the pollen fertility of the reintroduced lines was restored, and the seed setting rate per plant at maturity was close to that of the wild type. Therefore, this invention represents a novel discovery of a gene related to male sterility in rice—the OsRH11 gene. Furthermore, this invention explores the reasons why mutations in this gene lead to male sterility in rice, elucidating the molecular mechanism of pollen abortion in rice male sterility. This will further deepen our understanding of the molecular mechanism of male sterility in rice and provide new insights into the molecular regulatory mechanism of male reproductive development in rice. Applying the OsRH11 gene, a male sterility gene, to the genetic improvement of rice varieties has significant practical implications for rice breeders.

[0020] In addition, the present invention has developed a molecular marker primer combination for the OsRH11 male sterile line. This combination can be used to detect OsRH11 gene mutation sites. Therefore, this molecular marker primer combination can be applied to the backcrossing and conversion of rice male sterile lines and the breeding of rice male sterile lines. Attached Figure Description

[0021] Figure 1 Phenotypic and genetic analyses were performed on wild-type Zhonghui 8015 (WT) and the pollenless male-sterile mutant sc13 (sc13). Among them, a is the plant phenotype of WT and sc13, b is the panicle-filling phenotype of WT and sc13 at maturity, c is the spikelet morphology of WT and sc13, d is the anther phenotype of WT and sc13, e is the pollen I2 / KI black staining morphology of WT, and f is the pollen-free morphology of sc13 anthers after I2 / KI staining.

[0022] Figure 2 Semi-thin sections of anther development in wild-type and rh11 mutants under high-temperature growth conditions in Hangzhou are shown. Among them, a represents the cross-sectional morphology of anthers at stage S8a (wild-type), b represents the cross-sectional morphology of anthers at stage S8b (wild-type), c represents the cross-sectional morphology of anthers at stage S9 (wild-type), d represents the cross-sectional morphology of anthers at stage S10 (wild-type), e represents the cross-sectional morphology of anthers at stage S11 (wild-type), f represents the cross-sectional morphology of anthers at stage S12 (wild-type), g represents the cross-sectional morphology of anthers at stage S8a (rh11 mutant), h represents the cross-sectional morphology of anthers at stage S8b (rh11 mutant), i represents the cross-sectional morphology of anthers at stage S9 (rh11 mutant), j represents the cross-sectional morphology of anthers at stage S10 (rh11 mutant), k represents the cross-sectional morphology of anthers at stage S11 (rh11 mutant), and l represents the cross-sectional morphology of anthers at stage S12 (rh11 mutant). Scale bar: 20 μm.

[0023] Figure 3 Map-based cloning of the rice male sterility gene OsRH11; (A) shows linkage analysis and preliminary localization of the OsRH11 site, (B) shows Mut Map analysis of the OsRH11 site, (C) shows the position and amino acid changes of the rh11 mutant in the OsRH11 gene, and (D) shows the sequencing peak diagram of the OsRH11 mutant site.

[0024] Figure 4 To verify the function of the OsRH11 gene; (A) is the gene knockout target of the OsRH11 gene and the mutation site of the KO strain, (B) is the microscopic phenotype of the plant, anther and pollen of the OsRH11 gene knockout strain, and (C) is the microscopic phenotype of the plant, anther and pollen of the rh11 functional complement strain.

[0025] Figure 5The purpose of this study is to develop and detect ARMS-specific functional molecular markers for the rh11 mutation site. Among them, (A) is the sequence development of ARMS-specific functional molecular markers for the rh11 mutation site, (B) is the agarose detection of ARMS-specific functional molecular markers for the rh11 mutation site, M is the DNA Marker I band, H is the heterozygous band with three band patterns (364bp, 244bp and 169bp), W is the wild-type homozygous genotype with only two band patterns (364bp and 169bp), and m is the rh11 homozygous genotype, i.e. the mutant, with only two band patterns (364bp and 244bp).

[0026] Figure 6 The structure and function of OsRH11 protein were analyzed. Among them, (A) is the structure and key domains of OsRH11 protein, (B) is the three-dimensional structural model of OsRH11 protein, its OB fold domain and rh11 mutation site, a is the three-dimensional structural model of OsRH11 protein, b is the three-dimensional structural model of the OB fold domain in OsRH11 protein, and c is the three-dimensional structural model of rh11 mutation site.

[0027] Figure 7 Comparison of lipid composition in anthers of wild-type and mutant at different developmental stages; (A) is a volcano map of the yms stage, (B) is a volcano map of the mps stage, (C) is a statistical chart of lipid composition in anthers of the yms stage, and (D) is a statistical chart of lipid composition in anthers of the mps stage.

[0028] Figure 8 Expression analysis of core genes in pollen development regulatory pathways. Detailed Implementation

[0029] The pollenless male-sterile mutant sc13 (field number sc13) was obtained from the mutant library of the EMS-induced mutagenesis of the indica restorer line Zhonghui 8015 by the Super Rice Breeding Research Group of China National Rice Research Institute. The applicant has committed to distributing it to the public for 20 years from the date of application.

[0030] The primers, knockout targets, and ARMS-rh11 molecular marker primers required in this invention are shown in Table 1.

[0031]

[0032] The detection method and result interpretation of the ARMS-rh11 molecular marker at the rh11 mutation site are as follows:

[0033] (1) Detection method

[0034] Reaction system: The PCR system was 14 μL, specifically consisting of 2 μL DNA (50 ng / μL), 1.0 μL each of the four primers (SEQ ID NO.6-9), 5.0 μL of 2×Rapid Taq Master Mix (Nanjing Novizan Biotechnology Co., Ltd.), and 3.0 μL of ddH2O.

[0035] Reaction procedure: pre-denaturation at 95℃ for 3 min; then denaturation at 95℃ for 15 s, annealing at 56℃ for 15 s, extension at 72℃ for 8 s, for 35 cycles; extension at 72℃ for 10 min; cooling at 4℃ for 10 min, and then electrophoresis on 1.5% agarose for 15 min.

[0036] (2) Interpretation of results

[0037] In agarose gel electrophoresis, the two bands at 364bp and 169bp represent the wild-type genotype (CC).

[0038] The two bands at 364bp and 244bp in the agarose gel electrophoresis bands represent the rh11 homozygous mutation site genotype (TT).

[0039] The three bands of 364bp+244bp+169bp in the agarose gel electrophoresis bands represent the rh11 heterozygous mutation site genotype (CT).

[0040] The OsRH11 protein sequence of wild-type Zhonghui 8015 is shown in SEQ ID NO.10, specifically as follows:

[0041]

[0042] The OsRH11 protein sequence in the rh11 mutant is shown in SEQ ID NO.11, specifically:

[0043]

[0044] The CDS sequence of the OsRH11 gene in wild-type Zhonghui 8015 is shown in SEQ ID NO.12, specifically as follows:

[0045]

[0046] The CDS sequence of the OsRH11 gene in the rh11 mutant is shown in SEQ ID NO.13, specifically as follows:

[0047]

[0048] The genomic DNA sequence of the OsRH11 gene in wild-type Zhonghui 8015 is shown in SEQ ID NO.14, specifically as follows:

[0049]

[0050] The genomic DNA sequence of the OsRH11 gene in mutant rh11 is shown in SEQ ID NO.15, specifically as follows:

[0051]

[0052] The OsRH11 gene complementation fragment is shown in SEQ ID NO.16, specifically:

[0053] CATATCATGTAAATTTG TATAAATTGGTACAAATAATTATGTGTATAATATAGGCAGCTGATCCATTACCACTAATAATTATCTGATGCCAAC AGCCCCCATTTGTGTTCTGAATATTGTAGCACTATTTGGTAAAGTACTAAAATATCATTTAGAATATTTTAGGGAA TTTAGTAATAAATGGCATTTTCTTTGTAAGATGGCCGTCTTAATCTAACACAACATTATATTGTTCCTAGAAATTG ATCTATGCAAGGCATGGAAAATGTGCTTTATCTAGTTTTATCTATAAACAATAATAGACTCCCAGAGAAAGTCTGC CGGGAATTATGTTCCAAGACATGCCTCTTTCCATTTGTTGCTCTATAGACGTAAGCATTACTATATTTTAGTGTGA GGCCATGAAGGTCATCTTGATTTTTTTCTTTTGTTTTGTTCATAATTATTGTTTGTAGTTTATTCAATGTTCTATT AATTCTAGTATATGCAATTTAGTCCCCTAATTTGAAGTATAAAATTCTATAGCAGACTTTTCAATGTTACATGCTG ACCGTTTCTTAACTTCATGGAATCAATCCAGCATATGCAGCATATGTTATCTTTAATTTAGTCTCCTTGTGAAGCT TGAAACTTCTTGAGCAGATTCCTTAGTGTTTTATACAACAGTTGTTGCTTAACTTAACTATATGCAATATGCTATC TTGTAAGTTGTAATGCGTCGAGAATGTCATGTATTTCCAAGACACCTGTTTGGAGCATTGTCACACTAAGCAAATG GATAAAATTTGAAGCTCTAAAAAATTGTGAAGCATCTCAGTAGGTTGAAGAATTGAATGATCTTGTATGGATCATA ATACTCATGTAGGATATTGATAGGAGTATGTGCTAGCTGCAAGTTTTTTCTTTTTGCCAGTTATGCTGATTTTGTC GAAATGCGGATTGGTGGCTCATGTGGACGTCCACTCATGAATTTTTATGTAAGCTATACATATTTTTCCCGAAACG AAAGGATTTGGGCGGTACATTTCTCAGTTCACTGCAGCTAATCTGATTTGGATAGTGCTGTTGAAGTTCTCTGTTG GGACTACCTATACATTTGTCGATGTTTTTTC The uppercase part represents the promoter region of the vector, the lowercase part represents the OsRH11 gene region (including exons and introns), and the uppercase part with an underline represents the downstream termination region.

[0054] Example 1: Phenotypic and Genetic Analysis of sc13

[0055] Methods for constructing BC1F1 and BC1F2 populations: Using sc13 as the female parent and wild-type Zhonghui 8015 as the male parent, backcrossing for one generation to obtain the hybrid BC1F1, and then self-crossing for one generation to obtain the BC1F2 population.

[0056] Methods for constructing F1 and F2 populations: Using sc13 as the female parent and the widely compatible japonica rice parent 02428 as the male parent, the hybrid F1 population was obtained. Then, the F1 population was self-crossed to obtain the F2 population.

[0057] In Fuyang District, Hangzhou City, summer-sown (late May) wild-type (WT, Zhonghui 8015, ZH8015), sc13, BC1F1, BC1F2, F1, and F2 populations, sc13, under high-temperature conditions (booting in late July to mid-August, heading and flowering around August 20th), exhibited pale creamy-yellow anthers, no pollen, and completely sterile spikelets. Figure 1 ).

[0058] The phenotypes of individual plants in the BC1F1, BC1F2, F1, and F2 populations, including spikelet set rate and pollen fertility, were then statistically analyzed, and the results are shown in Table 2. The results showed that individual plants in BC1F1 and F1 exhibited the same phenotype as the wild type, with normal spikelet set rate and fertile pollen. However, in the F2 and BC1F2 segregating populations, the phenotypes of the wild-type and pollenless rice male-sterile mutant sc13 both conformed to a segregation ratio of 3:1. Therefore, the male-sterile trait of sc13 is controlled by a pair of recessive nuclear genes.

[0059] Table 2. Statistical results of spikelet seed setting rate, pollen fertility, and other phenotypic characteristics of individual plants in different populations.

[0060]

[0061] Example 2: Map-based cloning of the target gene

[0062] The F2 population constructed from sc13 × broadly compatible parent 02428 in Example 1 was used as the localization population. Using universal SSR markers (SSR markers are publicly available at https: / / archive.gramene.org / markers / ), the target gene was initially located at the end of the long arm of chromosome 7. Further utilizing the differences in indica-japonica genome sequences, InDel markers were densely developed within the RM6403 and RM248 intervals. Through 327 recessive individuals in the F2 population, the localization interval was shortened to between markers BM13 and BM7, a physical distance of approximately 450 kb. Figure 3 (A) Meanwhile, 35 recessive single plants were selected from the BC1F2 population obtained in Example 1 to construct a mutant pool. Using MutMap sequencing technology, three SNP-index=1 sites were identified within the localization interval. After excluding intergenic regions and nonsense mutations, a C→T single base substitution was found in exon 2 of one of the DEAD / H-Box RNA helicase genes (RNA helicase DEAH11 type). Figure 3 (BD in the text). Full-length gDNA and cDNA sequencing of this gene in both wild-type and mutant strains revealed that the mutation resulted in only one amino acid substitution (Thr→Ile) in the encoded protein. Subsequently, 100 individual plants were randomly selected from the BC1F2 population for phenotypic and genotypic identification. When the site was congruent to the wild-type (ZH8015) (CC) or heterozygous (CT), the plant had normal seed setting rate; however, when the site was congruent to the mutant (TT), the plant exhibited spikelet abortion. Therefore, the amino acid substitution caused by this mutation may be the reason for pollenlessness and spikelet abortion in sc13. The target gene was tentatively named OsRH11, and the corresponding sc13 mutant was also named the rh11 mutant (i.e., BC1F2 population plants with genotype TT were designated as the rh11 mutant). The nucleotide sequence of the wild-type OsRH11 gene is shown in SEQ ID NO.12, the amino acid sequence of the OsRH11 protein it encodes is shown in SEQ ID NO.10, and the genomic sequence of the OsRH11 gene is shown in SEQ ID NO.14; the nucleotide sequence of the rh11 mutant OsRH11 gene is shown in SEQ ID NO.13, the OsRH11 protein sequence is shown in SEQ ID NO.11, and the genomic sequence of the OsRH11 gene is shown in SEQ ID NO.14.

[0063] Example 3: Observation of semi-thin sections of anther development in mutants under high-temperature growth conditions.

[0064] To clarify the aberration details in the anther development process of the rh11 mutant in Example 2, this example describes planting wild-type (WT, Zhonghui 8015, ZH8015) and rh11 mutants in Hangzhou at the normal season temperature (both during spikelet differentiation and flowering stages are above 30℃). The anther development process of both wild-type and rh11 mutants was then semi-thinly sectioned and observed in detail. The results are as follows: Figure 2 As shown. There were no significant differences in anther morphology between the two before stage 9 (S8a, S8b, and S9), and both could produce and release microspore cells (…). Figure 2 (a, b, c, g, h, and i). However, in wild-type S10-11, the wild-type microspore cells, after vacuoleization and mitosis, gradually form irregular crescent shapes, and the cytoplasm of the tapetal cells condenses and degrades into bands, resulting in significantly lighter staining compared to S9. Figure 2 (d and e in the text); but at this time, in the lumen of the rh11 mutant, although the microspore cells have a certain degree of vacuoleization, they are obviously more disordered and irregular, and the tapetum is still obviously present ( Figure 2 In the S11 stage (j and k), many pollen cells begin to degrade, becoming irregular in shape, with most degenerating into thin threads, while the tapetum remains thick. However, in the anther chambers of the rh11 mutant, the vacuolation of microspore cells in S10 becomes significantly normal (j and k). Figure 2 In the S11 stage, most microspore cells can form crescent-shaped pollen cells, and the tapetum becomes significantly lighter in color. Figure 2 (k in the text). By the S12 stage, the wild-type anthers contain mature pollen grains, and the anther sac wall consists only of the outer wall structure. Wrinkling and dehiscence occur between adjacent pollen sacs, preparing for the release of mature pollen grains and fertilization. Figure 2 (f in the text); while the rh11-HT mutant has no visible pollen grains in the anther, the exine is clearly visible and not dehiscent, the inner cavity contains only some turbid material of degenerated cells, and the tapetal cells are fused with the degraded pollen cells (f in the text). Figure 2 The l in the figure indicates that the rh11 mutant experienced delays in tapetal degradation and pollen sac wall differentiation under high summer temperatures, resulting in the inability of the anthers to dehisce, ultimately leading to pollen cell degradation, absence of mature pollen, and complete sterility of the spikelets.

[0065] Example 4 Functional verification of the OsRH11 gene

[0066] To further confirm whether the OsRH11 gene is the target gene causing male sterility in rh11 mutants, this embodiment constructed a CRISPR / Cas9 knockout vector and a pCAMBIA1300-OsRH11 complementary vector, and identified the genotype and phenotype of the transformed positive plants.

[0067] The method for constructing CRISPR / Cas9 knockout vectors is as follows: Based on the knockout target, design the CRISPR-P website (…). http: / / crispr.hzau.edu.cn / CRISPR2 / news.php Target primers were designed (knockout targets and target primers are shown in SEQ ID NO. 3-5 in Table 1), and inserted into the Aar I site of the vector pcas9-sgRNA-AarI (this vector is disclosed in the literature "Targeted mutagenesis in rice using CRISPR-Cas system" (Jin Miao 1, Dongshu Guo, JinzheZhang, Qingpei Huang, Genji Qin, Xin Zhang, Jianmin Wan, Hongya Gu, Li-JiaQu. Targeted mutagenesis in rice using CRISPR-Cas system. Cell Res., 2013, 23(10): 1233-1236)). The constructed vector was recombinantly transformed into Agrobacterium EHA105 strain, and finally genetically transformed into wild-type Zhonghui 8015 plants using Agrobacterium-mediated transformation.

[0068] The pCAMBIA1300-OsRH11 complementary vector: The full-length OsRH11 genome sequence (SEQ ID NO.16) was amplified using specific primers (SEQ ID NO.1-2 in Table 1), including the promoter sequence 2280 bp upstream of the start codon, the coding region sequence 6359 bp, and the termination sequence 1113 bp. This sequence was then cloned into the HindIII site of the complementary vector pCAMBIA1300, and finally the RH11-COM complementary vector was constructed.

[0069] Obtaining positive plants: The constructed vector was sent to Wuhan Boyuan Biotechnology Co., Ltd. for subsequent plant genetic transformation to obtain the OsRH11 knockout line (rh11-ko mutant). This mutant produced a 6-bp deletion at the target site, resulting in a change in the encoded amino acid. Although the transformation did not terminate prematurely, the OsRH11 protein exhibited defective function, such as... Figure 4 (as shown in (A)).

[0070] In this example, wild-type (ZH8015, WT), rh11 mutant, rh11-ko mutant, and rh11-com complementary lines (plants obtained by introducing the RH11-COM complementary vector) were sown under the same sowing environment as in Example 1. The phenotypes of the wild-type (ZH8015, WT), rh11 mutant, rh11-ko mutant, and rh11-com complementary lines were then investigated, and the results are as follows:Figure 4 As shown in (B) and (C). The results showed that the anthers of the rh11-ko mutant and the rh11 mutant exhibited pollen-free sterility after I2-KI staining at the heading stage, and the spikelets were completely sterile at maturity. However, the pollen fertility of the rh11-com complementary line was restored, and the seed setting rate per plant at maturity was close to that of the wild type. These results demonstrate that the OsRH11 gene is a novel rice male sterility gene controlling the rh11 mutant phenotype in this embodiment.

[0071] Example 5: Development and Validation of ARMS-rh11-Specific Functional Molecular Markers

[0072] To facilitate the detection of specific genotypes of the rh11 mutant, an ARMS-rh11 molecular marker was designed for this mutation site in this embodiment. The primers for the ARMS-rh11 molecular marker are shown in SEQ ID NO. 6-9 in Table 1. The genotype of the BC1F2 population constructed in Example 1 was detected using the ARMS-rh11 molecular marker detection method for the rh11 mutation site. The structure is shown in the figure. Figure 5 As shown in the figure. The results showed that the two bands at 364bp+169bp in the agarose gel electrophoresis pattern represented the wild-type genotype (CC), the two bands at 364bp+244bp represented the rh11 homozygous mutant genotype (TT), and the three bands at 364bp+244bp+169bp represented the rh11 heterozygous mutant genotype (CT). These results also validated the applicability of the marker; this specific functional marker and primer pair can be used for backcrossing and breeding applications at this locus.

[0073] Example 6: Protein structure and function of OsRH11

[0074] This embodiment uses multiple databases such as SMART, UniProt, and InterPro to predict the domains and functions of the OsRH11 protein, and uses AlphaFold to construct a three-dimensional structural model of the OsRH11 protein online. Figure 6(B) a). The N-terminus of the OsRH11 protein contains multiple RNA helicase (DEAD / H-Box RNA Helicase) structural components, including Helicase ATP-binding, Helicase C-terminal, Helicase associated domain (HA2), and Oligonucleotide / oligosaccharide-binding (OB)-fold. The C-terminus contains multiple E3 ubiquitin ligase components, including Ring fingers (RING), zinc finger (ZnF_C2H2), and In Between Ring fingers (IBR). Figure 6 (A in the original text). This suggests that the OsRH11 protein may possess both RNA unwinding and ubiquitination modification functions.

[0075] In the rh11 mutant, the amino acid substitution of the OsRH11 protein occurs in the OB-fold domain of the RNA helicase. In yeast, this domain is considered the entrance and active site of the putative nucleic acid lumen in the RNA helicase assembly, synergistically regulating the affinity and binding ability of the RNA helicase to RNA with the HA2 domain. Mutations in this domain lead to a decrease in the affinity between the RNA helicase and RNA. In the analysis of the OB-fold domain, this embodiment found multiple hydrogen bonds between the mutated threonine residue at position 891 (Thr) and the adjacent valine residue at position 875 (Val). The substitution of Thr→Ile in the mutant may cause a change in the OB-fold conformation, which could potentially lead to changes in the activity of the OsRH11 protein itself or a decrease in its binding ability to RNA. Figure 6 (b and c in (B)).

[0076] Example 7: OsRH11 mutation leads to abnormal lipid metabolism in anthers.

[0077] In this embodiment, wild-type (ZH8015, WT) and rh11 mutant were sown under the same sowing environment as in Example 1. Fresh anther tissues of wild-type (ZH8015, WT) and rh11 mutant were simultaneously harvested at two stages: the microspore cell stage (yms) and the mature pollen stage (mps). The content of 620 lipid molecules in the anther tissues was determined using liquid chromatography-mass spectrometry (LC-MS / MS). The results are as follows: Figure 7 As shown. During the YMS period, a total of 46 differentially expressed lipid metabolites were identified. Compared to the wild type, the levels of 36 lipid metabolites were significantly downregulated, and the levels of 10 lipid molecules were significantly upregulated. Figure 7(A) According to the lipid classification system, these lipid molecules are divided into 2 types of sterol lipids (ST), 1 type of sphingolipid (SP), 5 types of glycerophospholipids (GP), 18 types of glycerides (GL), 1 type of fatty acid (FA), and 2 other types (Others). Figure 7 (C in the text). During the mps period, this embodiment found a large number of differentially expressed lipid metabolites (335 types) in the anthers of wild-type and mutant plants, of which 251 lipid molecules were significantly upregulated and 84 lipid molecules were significantly downregulated. Figure 7 (B) Among them, differentially differentiated lipid molecules are mainly divided into 7 types of sphingolipids (SP), 20 types of glycerophospholipids (GP), 51 types of glycerides (GL), 3 types of fatty acids (FA), and 5 other types (Others). Figure 7 (D in the middle).

[0078] During pollen development, lipid molecules play a crucial role in the cytoskeleton and provide essential nutrients for organ morphogenesis, participating in important processes such as tapetum development and pollen exine formation. Among these, the synthesis of lipid precursors such as cytopollins, cuticles, and waxes is critical for pollen wall formation, and lipid metabolism disorders in anthers severely affect male fertility. In the rh11 mutant, the mature anther phenotype is pollen degradation and abortion, with the anther wall failing to dehisce (…). Figure 4 (B in the middle).

[0079] Example 8: OsRH11 regulates the expression of genes related to microspore development and pollen wall formation.

[0080] The development of rice anthers involves several crucial processes, including pollen mother cell primordia differentiation and formation, meiosis, microspore formation and development, tapetum formation and timely degradation, pollen exine formation, pollen germination, and anther dehiscence. Abnormalities in any of these developmental processes can ultimately lead to pollen abortion. In this study, gene expression analysis of the corresponding regulatory pathways revealed that transcription factors PTC1, BM1, and EAT1, located downstream in the transcriptional cascade regulatory network, were significantly downregulated in the rh11 mutant at the yms stage. Furthermore, in the rh11 mutant, the expression levels of almost all reported genes involved in anther wall lipid synthesis and transport, microspore development, and pollen exine formation (such as CYP703A3, CYP704B2, PKS1, and PKS2) were significantly lower than in the wild type. Figure 8 Therefore, this embodiment suggests that OsRH11 may directly act on these downstream genes, participate in the transcription process of these target genes, and thus regulate the process of rice anther development and pollen formation by controlling their expression.

[0081] In summary, this invention reveals that the mechanism by which the RNA helicase OsRH11 regulates thermosensitive male sterility in rice may involve amino acid substitutions in the OB-fold domain of the OsRH11 protein, disrupting its protein conformation, reducing its catalytic activity, and decreasing the affinity of the OsRH11 protein for RNA. In rh11 mutants, the processing and quality control of target gene pre-mRNA or miRNA by the OsRH11 protein are impaired, leading to abnormal mRNA transcription and a reduction in translated protein. The OsRH11 mutation primarily affects anther wall development and dehiscence, pollen wall formation, and microspore development during anther development. This invention initially combined transcriptomic and lipid metabolomic results, finding that OsRH11 is highly involved in the synthesis and metabolic pathways of sporophytin, cutin, and wax during anther development. The content of long-chain fatty acids such as C16:0 and C18:X differed significantly between wild-type and mutants. At the same time, the expression of core genes in the metabolic pathway, such as CYP703A3, CYP704B2, PKS1, PKS2, and TKPR1, was significantly inhibited. These changes ultimately led to anther aberration and pollen abortion in mutants.

[0082] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of the OsRH11 protein, the gene encoding the OsRH11 protein, and biological materials with the gene knocked out in controlling male reproductive development in rice, characterized in that... The amino acid sequence of the OsRH11 protein is shown in SEQ ID NO.10; the nucleotide sequence of the encoding gene is shown in SEQ ID NO.

12.

2. The application according to claim 1, characterized in that, Rice male sterility is induced by inhibiting the activity of the OsRH11 protein or the expression level of the encoding gene.

3. The application according to claim 1, characterized in that, The biomaterials include recombinant vectors.

4. The application of the OsRH11 protein, the gene encoding the OsRH11 protein, and biological materials with the gene knocked out in the cultivation of male-sterile rice lines, characterized in that... The amino acid sequence of the OsRH11 protein is shown in SEQ ID NO.10; the nucleotide sequence of the encoding gene is shown in SEQ ID NO.

12.

5. The application according to claim 4, characterized in that, The rice male-sterile line was obtained by inhibiting the activity of the OsRH11 protein or the expression level of the encoding gene.

6. A method for creating male-sterile rice lines, characterized in that, The method includes the step of inhibiting the activity of the OsRH11 protein or the expression level of the encoding gene in the rice to obtain male-sterile rice plants; the amino acid sequence of the OsRH11 protein is shown in SEQ ID NO.10; the nucleotide sequence of the encoding gene is shown in SEQ ID NO.

12.

7. The method according to claim 6, characterized in that, The rice variety mentioned includes Zhonghui 8015.

8. Use of the male-sterile rice line obtained by the method of claim 6 or 7 in rice seed production.

9. A molecular marker primer combination for the OsRH11 male-sterile line, characterized in that, The molecular marker primer combination includes ARMS-SC13-IF with nucleotide sequences as shown in SEQ ID NO.6, ARMS-SC13-IR with nucleotide sequences as shown in SEQ ID NO.7, ARMS-SC13-OF with nucleotide sequences as shown in SEQ ID NO.8, and ARMS-SC13-OR with nucleotide sequences as shown in SEQ ID NO.

9.

10. The application of the molecular marker primer combination according to claim 9 in the backcrossing and breeding of male-sterile rice lines.

Images