Method for improving citrus canker resistance by using CsENPP1 gene

By cloning and overexpressing the CsENPP1 gene in citrus and constructing an overexpression vector, the resistance of citrus to citrus canker was improved. This solved the shortcomings of existing chemical and biological control technologies, significantly reduced the area of ​​lesions and the severity of disease, and provided a new molecular breeding method.

CN121801955AActive Publication Date: 2026-04-07GERMPLASM INNOVATION GRAND SCIENCE CENTER OF WESTERN CHINA (CHONGQING) SCIENCE CITY
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-11
Publication Date
2026-04-07

AI Technical Summary

Technical Problem

Existing technologies for the control of citrus canker have several drawbacks: chemical control is environmentally unfriendly and costly, biological control is ineffective, and breeding efficiency is low. There is a lack of effective genetic engineering methods to improve the resistance of citrus to canker.

Method used

By cloning the CsENPP1 gene of citrus and constructing an overexpression vector, the gene was introduced into citrus leaves to achieve overexpression of the CsENPP1 gene, thereby improving the resistance of citrus to bacterial canker.

Benefits of technology

This study significantly reduced the lesion area of ​​citrus canker, alleviated the severity of the disease, and improved the disease resistance of citrus, providing a new molecular breeding approach.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121801955A_ABST
    Figure CN121801955A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular biology, and particularly discloses a method for improving citrus canker resistance by using a CsENPP1 gene, the coding protein of the CsENPP1 gene is citrus nucleotide pyrophosphatase / phosphodiesterase 1, the coding sequence of the CsENPP1 is a nucleotide sequence shown as SEQ ID No.1, and the citrus canker resistance is improved based on overexpression of the CsENPP1 gene in citrus cells. The citrus nucleotide pyrophosphatase / phosphodiesterase 1 coding gene is integrated into citrus through an expression vector, the canker attack degree of the obtained transgenic material can be reduced to 48.9% of that of the existing citrus to the maximum extent, the canker attack degree can be remarkably reduced, the scab area is reduced, and the yield of the citrus is improved. The technology provided by the invention is a bioengineering technology which has potential to improve the citrus canker resistance, and has great value for citrus canker resistance molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a method for improving resistance to citrus canker using the CsENPP1 gene. Background Technology

[0002] Citrus is the largest fruit crop in southern my country and an important economic crop globally. However, citrus canker seriously hinders the healthy development of the citrus industry (Hu Junhua et al., 2015, Journal of Fruit Science). Citrus canker is caused by Xanthomonas aureus, a citrus-pathogenic bacterium (Xanthomonas xanthomonas). Xanthomonas citri subsp . citri , Xcc Citrus canker, caused by bacteria, originated in India and Java (Hu Junhua et al., 2015, Journal of Fruit Science). In my country, major citrus-producing areas such as Fujian, Hunan, and Guangdong are severely affected. The canker pathogen mainly infects citrus leaves, twigs, and fruits, with seedlings and young trees being particularly vulnerable (He Xiuling et al., 2007, Chinese Agricultural Science Bulletin). Diseased trees exhibit leaf drop, twig dieback, weakened tree vigor, and fruit drop, severely impacting citrus yield and quality. Dozens of Rutaceae species are susceptible to citrus canker, the vast majority of which are commercially cultivated varieties. Studies have found that sweet oranges are most susceptible, followed by sour oranges and pomelos (Yuan Chengdong et al., 1997, Plant Quarantine; Li Min et al., 2013, Southern China Fruits).

[0003] Currently, the control of citrus canker disease typically employs a comprehensive management strategy, primarily using chemical control supplemented by biological control. However, chemical control measures are environmentally unfriendly, easily causing pollution and requiring significant human and material resources. Biological control is less effective and more costly. Therefore, there is an urgent need to cultivate new disease-resistant varieties to reduce losses caused by canker (Zhu Xuemei et al., 2017, Modern Horticulture). The long cycle of hybridization breeding results in low breeding efficiency. With the rise of molecular biology, researchers have begun to study the pathogen itself and the plant's disease resistance response through genetic engineering. Genetic engineering techniques have also been explored in canker resistance research (Duan Minjie et al., 2016, Journal of Southwest Normal University; Jia Ruirui et al., 2017, Chinese Agricultural Science), resulting in some transgenic materials resistant to canker. For example, Chen Shanchun et al. obtained transgenic silkworm antimicrobial peptide D gene lines of Jincheng orange, Xinhui orange, and navel orange that were resistant to citrus canker (Chen Shanchun et al., 1996, Chinese Journal of Agricultural Sciences); exogenous genes NLS, chit42, Xa21, and PthA, after being transferred to Bingtang orange, Ponkan orange, and sweet orange, showed resistance to citrus canker (Mendes). et al. , 2010, Plant Pathology; Yang et al.(Li, 2011, Plant Molecular Biology); CsBZIP40 is an important transcription factor in response to citrus canker infection, and it is speculated that it affects the resistance of citrus varieties through the SA pathway (Li et al. (Li, 2019, PloS one); The CsLOB1 gene, as a target protein of the citrus canker pathogen gene PthA, makes citrus more susceptible to citrus canker (Li et al. (2014, Proceedings of the National Academy of Sciences); CRISPR / Cas9 targeted knockout of the CsLOB1 promoter, a gene susceptible to citrus canker, can produce plants with increased resistance to citrus canker (Peng et al. , 2017, Plant biotechnology journal).

[0004] Nucleotide pyrophosphatases / phosphodiesterases (NPPs) are N-glycosylation enzymes found in monocotyledonous and dicotyledonous plants. They catalyze the hydrolysis of pyrophosphate and phosphodiester bonds in various nucleotides and nucleotide sugars (Rodrı 'guez-Lo'pez et al., 2000, Proceedings of the National Academy of Sciences; Nanjo et al., 2006, The Plant Cell).

[0005] Although the regulation of nucleotide pyrophosphatase / phosphodiesterase 1 has been applied to some aspects of plant disease resistance, there is no relevant research in the field of citrus canker. Therefore, this application is hereby submitted. Summary of the Invention

[0006] This invention provides a method for improving citrus canker resistance by utilizing the CsENPP1 gene. Specifically, a gene encoding citrus nucleotide pyrophosphatase / phosphodiesterase 1 is integrated into citrus through an expression vector, effectively improving the resistance of citrus to canker. This has significant application value for citrus canker resistance breeding.

[0007] The present invention adopts the following technical solution: The purpose of this invention is to provide a method for improving resistance to citrus canker by utilizing the CsENPP1 gene. The protein encoded by the CsENPP1 gene is citrus nucleotide pyrophosphatase / phosphodiesterase 1, and the CsENPP1 coding sequence is the nucleotide sequence shown in SEQ ID No. 1. The method improves resistance to citrus canker by overexpressing the CsENPP1 gene in citrus cells.

[0008] The sequence is: SEQ ID No. 1 (CsENPP1 CDS sequence, ATG to stop codon) As a preferred technical solution, the steps include: (1) Cloning the CsENPP1 coding sequence of citrus; (2) Constructing a CsENPP1 overexpression vector; (3) The CsENPP1 overexpression vector was introduced into citrus leaves and identified to obtain transgenic materials with improved resistance to citrus canker.

[0009] As a preferred technical solution, the cloning method for the citrus CsENPP1 coding sequence in step (1) is as follows: Total RNA was extracted from citrus fruits and reverse transcribed into cDNA. Using cDNA as a template, PCR amplification was performed using primers OE-CsENPP1-F and OE-CsENPP1-R, and the CsENPP1 coding sequence DNA fragment was recovered. The nucleotide sequences of the primers OE-CsENPP1-F and OE-CsENPP1-R are shown in SEQ ID No. 2 and SEQ ID No. 3, respectively.

[0010] The sequence is: SEQ ID No. 2 (CDS pre-cloning primer OE-CsENPP1-F, containing restriction enzyme sites) CATTTCATTTGGAGAGGACAGGGTACCATGGGTTCTGACCATCACG SEQ ID No. 3 (CDS clone primer OE-CsENPP1-R, containing restriction enzyme sites) GTCGTCATCCTTGTAATCGGATCCTTGGGCAGGCAAGAGAATAG As a preferred technical solution, in step (2), the method for constructing the CsENPP1 overexpression vector is as follows: the CsENPP1 coding sequence DNA fragment recovered by KpnⅠ and BamHⅠ enzyme digestion is ligated into the pLGNe vector recovered by KpnⅠ and BamHⅠ enzyme digestion to construct the overexpression vector pLGNe-CsENPP1.

[0011] As a preferred technical solution, in step (3), the method of transforming citrus with the CsENPP1 overexpression vector is as follows: the overexpression vector pLGNe-CsENPP1 is transformed into Agrobacterium tumefaciens by electroporation, and then the Agrobacterium tumefaciens liquid carrying the overexpression vector is injected into citrus leaves.

[0012] As a preferred technical solution, PCR primers are used to identify whether the CsENPP1 gene has been successfully introduced into citrus leaves, and qRT-PCR primers are used to identify whether the CsENPP1 gene is overexpressed in citrus leaves.

[0013] As a preferred technical solution, when using qRT-PCR primers to identify whether the CsENPP1 gene is overexpressed in citrus leaves, the qRT-PCR primers used are RT-CsENPP1-F and RT-CsENPP1-R, and the nucleotide sequences of primers RT-CsENPP1-F and RT-CsENPP1-R are shown in SEQ ID No. 4 and SEQ ID No. 5, respectively.

[0014] The sequence is: SEQ ID No. 4 (RT-CsENPP1-F primers for RT-PCR identification of transgenic material, designed in CDS) TTCTGCTCGTCACCTGCAAT SEQ ID No. 5 (RT-CsENPP1-R primers for RT-PCR identification of transgenic material, designed in CDS) TTCTTGACAGGACCGTGAGC As a preferred technical solution, after obtaining the transgenic material in step (3), the transgenic material is evaluated for resistance, and it is determined that CsENPP1 overexpression improves the resistance to citrus canker.

[0015] Compared with the prior art, the present invention has the following advantages and beneficial effects: This invention provides a method for improving citrus canker resistance based on CsENPP1 overexpression. The method involves cloning the CsENPP1 coding sequence of citrus, constructing an overexpression vector, and then transforming citrus leaves. The resulting transgenic material shows a reduction in canker incidence to up to 48.9% of existing citrus varieties, significantly alleviating the severity of canker and reducing lesion area. This invention represents a promising bioengineering technique for improving citrus canker resistance and has significant value for molecular breeding of citrus with canker resistance. Attached Figure Description

[0016] To more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly described below. It should be understood that the following drawings only show some embodiments of the present invention and should not be considered as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort. In the drawings: Figure 1The bioinformatics characteristics of the CsENPP1 gene of this invention are as follows: A is the chromosomal location of the citrus CsENPP1 gene, where bp represents a base; B is the gene structure of the citrus CsENPP1 gene, where E1 represents an exon; C is the conserved domain of the citrus CsENPP1 gene, where aa represents an amino acid.

[0017] Figure 2 The image shows the PCR amplification electrophoresis diagram of the CsENPP1 gene clone of this invention: CDS represents the CsENPP1 coding sequence; M represents the DNA molecular weight standard, the same below.

[0018] Figure 3 The following is a structural diagram of the CsENPP1 plant overexpression vector of this invention: GUS represents the β-glucosidase gene; GUS:NPTⅡ represents the fusion of the GUS gene and the NPTⅡ gene to form a bifunctional marker element (NPTⅡ: neomycin phosphotransferase II gene); CaMV 35S represents the plant constitutive promoter derived from cauliflower mosaic virus; NOS represents the crown gall synthase gene terminator.

[0019] Figure 4 The graph shows the expression level of CsENPP1 in the transgenic material of this invention: * indicates a significant difference compared with the control. P <0.05); ** indicates a highly significant difference compared to the control group. P <0.01), *** indicates an extremely significant difference compared to the control group ( P <0.001), the same applies below.

[0020] Figure 5 This image shows the symptoms of the transgenic material leaves of this invention 10 days after inoculation with ulcer pathogens.

[0021] Figure 6 This is a statistical chart showing the area of ​​lesions on the leaves of the transgenic material of this invention 10 days after inoculation with ulcer pathogen.

[0022] Figure 7 This is a statistical chart of the disease index of the leaves of the transgenic material of this invention 10 days after inoculation with ulcer pathogen. Detailed Implementation

[0023] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the embodiments and accompanying drawings. The illustrative embodiments and descriptions of this invention are only used to explain this invention and are not intended to limit this invention.

[0024] In the following description, numerous specific details are set forth in order to provide a thorough understanding of the invention. However, it will be apparent to those skilled in the art that these specific details are not necessary to practice the invention. In other embodiments, well-known structures, materials, or methods have not been specifically described in order to avoid obscuring the invention.

[0025] Throughout this specification, references to "an embodiment," "an example," or "an example" mean that a particular feature, structure, or characteristic described in connection with that embodiment or example is included in at least one embodiment of the invention. Therefore, the phrases "an embodiment," "an example," "an example," or "an example" appearing in various places throughout the specification do not necessarily refer to the same embodiment or example. Furthermore, specific features, structures, or characteristics can be combined in one or more embodiments or examples in any suitable combination and / or sub-combination. Moreover, those skilled in the art will understand that the illustrations provided herein are for illustrative purposes and are not necessarily drawn to scale. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0026] Example 1: Bioinformatics analysis of the citrus CsENPP1 gene The citrus CsENPP1 gene is located on chromosome 3 of citrus, between 37018577 bp and 37020546 bp, containing two introns and one exon, encoding 451 amino acids. The nucleotide sequence of the CsENPP1 gene is shown in SEQ ID NO: 1. Figure 1 As shown in the image.

[0027] SEQ ID No. 1 (CsENPP1 CDS sequence, ATG to stop codon) Example 2: Cloning of the CsENPP1 coding sequence of citrus 1. RNA extraction and cDNA synthesis Total RNA was extracted from citrus (Late Orange) leaves using a plant total RNA extraction kit (Adley, CAT: RN09). RNA quality was verified by agarose gel electrophoresis, and its concentration was determined using a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A).

[0028] 2. PCR amplification of the CsENPP1 coding sequence The DNA fragment encoding the CsENPP1 sequence was amplified from citrus cDNA using primers OE-CsENPP1-F (SEQ ID No. 2), OE-CsENPP1-R (SEQ ID No. 3), and the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q). The fragment length was 1353 bp. Figure 2 The amplified DNA fragment was sequenced and identified as the coding sequence of the citrus CsENPP1 gene (SEQ ID No. 1). Under UV light, an agarose gel block containing the target fragment was cut off with a clean blade, and the DNA fragment was recovered using a kit (BioFlux, CAT: BSC02M1).

[0029] PCR amplification program: 98℃, 5 min; 98℃, 30 s, 56℃, 30 s, 72℃, 1.5 min, 35 cycles; extension at 72℃ for 10 min.

[0030] SEQ ID No. 2 (CDS pre-cloning primer OE-CsENPP1-F, containing restriction enzyme sites) CATTTCATTTGGAGAGGACAGGGTACCATGGGTTCTGACCATCACG SEQ ID No. 3 (CDS clone primer OE-CsENPP1-R, containing restriction enzyme sites) GTCGTCATCCTTGTAATCGGATCCTTGGGCAGGCAAGAGAATAG Example 3: Construction of CsENPP1 overexpression vector and transformation of Agrobacterium tumefaciens 1. Construction of overexpression vectors The CsENPP1 coding sequence DNA fragment and the overexpression vector pLGNe were digested with restriction endonucleases BamHI and KpnI (ThermoFisher), then recovered by gel extraction and ligated overnight at 16°C using the T4 DNA Ligase kit (Promega, CAT: M1801). The ligation product was transformed into E. coli DH5α, and plasmids from positive clones were extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the CsENPP1 overexpression vector pLGNe-CsENPP1. The structure of the overexpression vector is shown in the figure. Figure 3 As shown in the image.

[0031] 2. Transformation of Agrobacterium tumefaciens with overexpression vector The constructed overexpression vector was introduced into Agrobacterium tumefaciens competent cells EHA105 (purchased from Weidi Biotechnology) using electroporation.

[0032] The specific method is as follows: Thaw 50 μL of frozen Agrobacterium tumefaciens competent cells (EHA105) on ice; add 2 μL of the plasmid overexpression vector to the Agrobacterium tumefaciens competent cells, mix by pipetting, and place on ice for 5 min; transfer the mixture to the bottom of a pre-dried electroporation cuvette, place the cuvette into the slot and adjust to the correct position, adjust the electroporation device to the "Agr" setting, press the electroporation button, and check the electroporation data to ensure successful electroporation; add 1 mL of LB liquid medium to the electroporation cuvette, mix by pipetting, transfer to a sterile centrifuge tube, and incubate at 260 r / min, 28℃, and shake for 60 min; centrifuge the bacterial culture at 10000 r / min for 1 min, discard the supernatant, resuspend the bacterial cells in 100 μL of LB liquid medium, spread the resuspended cells, and incubate in the dark at 28℃ for 2 days; after the plaques have grown, use primer OE-CsENPP1-F (SEQ ID No.). 2) PCR verification of single colonies using OE-CsENPP1-R (SEQ ID No. 3).

[0033] PCR reaction conditions: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 10 min.

[0034] Example 4: CsENPP1 overexpression 1. Agrobacterium infection Add 500 μL of Agrobacterium tumefaciens bacterial culture containing the pLGNe-CsENPP1 plasmid to 50 mL of liquid LB medium (containing kanamycin), and incubate at 28℃ and 200 r / min until OD. 600 = 0.5; Activate ulcer bacteria solution to OD 600= 0.5, mixed with Agrobacterium tumefaciens bacterial suspension in equal proportion, centrifuged to obtain bacterial cells, and diluted with sterile water to OD. 600 = 0.5, late-blooming orange leaves were inoculated by needle pricking and placed in an incubator at 28℃.

[0035] 2. qRT-PCR analysis of overexpression materials Total RNA was extracted from the transgenic material (Adelaide, CAT No: RN09), and cDNA was synthesized using the PrimeScript RT Master Mix reverse transcription kit (TaKaRa, CAT: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsENPP1-F (SEQ ID No. 4) and RT-CsENPP1-R (SEQ ID No. 5). A 2... -△△Ct The relative expression level of the CsENPP1 gene in transgenic materials was calculated as follows: The water-treated sample was defined as the reference factor, with a CsENPP1 expression level of 1. The fold increase in gene expression relative to the reference factor in the transgenic material was then calculated as 2. -△△Ct The relative expression level was calculated. Results showed that the CsENPP1 gene was highly expressed in transgenic materials compared to wild-type plants (up to more than 7 times that of the control). See the results below. Figure 4 As shown in the image.

[0036] qRT-PCR reaction conditions: 95℃ for 3 min, 94℃ for 10 s; 56℃ for 10 s, 72℃ for 10 s, 40 cycles; 72℃ for 10 min.

[0037] SEQ ID No. 4 (RT-CsENPP1-F primers for RT-PCR identification of transgenic material, designed in CDS) TTCTGCTCGTCACCTGCAAT SEQ ID No. 5 (RT-CsENPP1-R primers for RT-PCR identification of transgenic material, designed in CDS) TTCTTGACAGGACCGTGAGC Example 5: Evaluation of Ulcer Resistance in CsENPP1 Overexpression Materials On day 10 after inoculation with a mixture of *Agrobacterium tumefaciens* and *Actinomyces ulcerans* using pLGNe-CsENPP1, ulcer symptoms were observed and photographed. The lesion area was statistically analyzed using ImageJ V1.47. The disease was classified into grades 0-7 based on lesion area, with the letter R representing lesion area, grade 0 (R ≤ 0.25 mm). 2 Level 1 (0.25 mm) 2 <R≤0.5 mm 2Level 2 (0.5 mm) 2 <R≤0.75 mm 2 Level 3 (0.75 mm) 2 <R≤1 mm 2 Level 4 (1.0 mm) 2 <R≤1.25 mm 2 Level 5 (1.25 mm) 2 <R≤1.5 mm 2 Level 6 (1.5 mm) 2 <R≤ 1.75 mm 2 Level 7 (R > 1.75 mm) 2 The disease index is calculated according to the formula: DI = 100 × Σ [number of lesions at each level × corresponding level value] / (total number of lesions × maximum level).

[0038] The results showed that 10 days after inoculation with the bacterial canker pathogen, both the overexpressing plants and the WT plants grafted at the same time exhibited varying degrees of disease in the inoculated plants, with some differences in lesion area. Figure 5 Statistical analysis revealed that the lesion area of ​​the transgenic material was significantly smaller than that of the wild-type control, decreasing to 39.7% of the control's area. Figure 6 The disease index of the transgenic material was significantly lower than that of the wild-type control, decreasing to 48.9% of the control. Figure 7 Therefore, CsENPP1 overexpression can significantly reduce the lesion area of ​​citrus bacterial canker and alleviate the severity of citrus canker.

[0039] In summary, this invention integrates a citrus nucleotide pyrophosphatase / phosphodiesterase 1 encoding gene into citrus through an expression vector. Overexpression of the CsENPP1 gene can reduce the lesion area and severity of citrus canker. The CsENPP1 gene provided in this invention can be overexpressed using various techniques for molecular breeding against citrus canker. It can also be used synergistically with other resistance or susceptibility genes in molecular breeding for citrus canker resistance, demonstrating significant application value in citrus canker resistance breeding.

[0040] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for improving citrus canker resistance using the CsENPP1 gene, characterized in that, The CsENPP1 gene encodes a citrus nucleotide pyrophosphatase / phosphodiesterase 1, and the CsENPP1 coding sequence is the nucleotide sequence shown in SEQ ID No.

1. Overexpression of the CsENPP1 gene in citrus cells is used to improve resistance to citrus canker.

2. The method for improving citrus canker resistance using the CsENPP1 gene according to claim 1, characterized in that, Includes the following steps: (1) Cloning the CsENPP1 coding sequence of citrus; (2) Constructing a CsENPP1 overexpression vector; (3) The CsENPP1 overexpression vector was introduced into citrus leaves and identified to obtain transgenic materials with improved resistance to citrus canker.

3. The method for improving citrus canker resistance using the CsENPP1 gene according to claim 2, characterized in that, In step (1), the cloning method for the citrus CsENPP1 coding sequence is as follows: Total RNA was extracted from citrus fruits and reverse transcribed into cDNA. Using cDNA as a template, PCR amplification was performed using primers OE-CsENPP1-F and OE-CsENPP1-R, and the CsENPP1 coding sequence DNA fragment was recovered. The nucleotide sequences of the primers OE-CsENPP1-F and OE-CsENPP1-R are shown in SEQ ID No. 2 and SEQ ID No. 3, respectively.

4. The method for improving citrus canker resistance using the CsENPP1 gene according to claim 2, characterized in that, In step (2), the CsENPP1 overexpression vector is constructed as follows: the CsENPP1 coding sequence DNA fragment recovered by KpnⅠ and BamHⅠ enzyme digestion is ligated into the pLGNe vector recovered by KpnⅠ and BamHⅠ enzyme digestion to construct the overexpression vector pLGNe-CsENPP1.

5. A method for improving citrus canker resistance using the CsENPP1 gene according to claim 2, characterized in that, In step (3), the method for transforming citrus with the CsENPP1 overexpression vector is as follows: the overexpression vector pLGNe-CsENPP1 is transformed into Agrobacterium tumefaciens by electroporation, and then the Agrobacterium tumefaciens bacterial solution carrying the overexpression vector is injected into citrus leaves.

6. A method for improving citrus canker resistance using the CsENPP1 gene according to claim 5, characterized in that, PCR primers were used to identify whether the CsENPP1 gene was successfully introduced into citrus leaves, and qRT-PCR primers were used to identify whether the CsENPP1 gene was overexpressed in citrus leaves.

7. A method for improving citrus canker resistance using the CsENPP1 gene according to claim 6, characterized in that, When using qRT-PCR primers to identify whether the CsENPP1 gene is overexpressed in citrus leaves, the qRT-PCR primers used are RT-CsENPP1-F and RT-CsENPP1-R. The nucleotide sequences of primers RT-CsENPP1-F and RT-CsENPP1-R are shown in SEQ ID No. 4 and SEQ ID No. 5, respectively.

8. A method for improving citrus canker resistance using the CsENPP1 gene according to claim 2, characterized in that, After obtaining the transgenic material in step (3), the transgenic material was evaluated for resistance, and it was determined that CsENPP1 overexpression improved the resistance to citrus canker.

Citation Information

Patent Citations

  • Anti-xanthomonas disease related protein as well as coding gene and application thereof

    CN115975981A

  • Application and method of CsDOF5.8 gene in improving citrus canker resistance

    CN118599867A

  • Method for improving citrus canker resistance through CsERF39 gene and application of CsERF39 gene

    CN118834902A

  • Citrus trees with resistance to citrus canker

    US20140137292A1