Enhancing CAR-T cell efficacy by inhibition of NR2f6
By inhibiting NR2F6 activity and inducing a secondary immune response, the tumor microenvironment barrier and antigenic heterogeneity issues in CAR-T cell therapy for solid tumors have been addressed, achieving highly efficient and durable immunotherapy effects while reducing treatment costs and adverse events.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-13
- Publication Date
- 2026-04-07
AI Technical Summary
Current CAR-T cell therapies face challenges in the treatment of solid tumors, such as tumor microenvironment barriers, exhaustion and inactivation, and tumor antigen heterogeneity, leading to poor treatment efficacy and immune-related adverse events, and lacking effective treatment options.
By inhibiting the activity of nuclear receptor subfamily 2F member 6 (NR2F6) and binding to transgenic constructs targeting antigens, nonspecific secondary immune responses are induced, enhancing the cytolytic activity and durable immune memory of immune cells, and reducing exhaustion sensitivity.
It achieves highly efficient killing of solid tumors and a durable immune response, reduces immune-related adverse events, lowers treatment costs and patient burden, and is applicable to existing and emerging CAR-T cell therapies.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of cell therapy agents, and in particular to tools for reducing the depletion of therapeutic immune cells and / or enhancing their cytolytic activity in the treatment of solid tumors.
[0002] This invention relates to modified immune cells for treating solid tumors in subjects, wherein the modified immune cells comprise one or more exogenous nucleic acid molecules encoding a transgenic construct that targets an antigen expressed in cancer cells of the solid tumor, wherein the activity of nuclear receptor subfamily 2F member 6 (NR2F6) is inhibited in the immune cells (compared to control immune cells), and during treatment, the binding of the immune cells to the antigen is associated with the death of the cancer cells expressing the antigen, and a secondary immune response is induced in the subjects against cancer cells of the solid tumor, wherein the secondary immune response is nonspecific to the antigen targeted by the transgenic construct (epitope diffusion).
[0003] In one embodiment, the present invention relates to the medical use of CAR-expressing cytotoxic immune cells in the treatment of solid tumors, wherein NR2F6 activity is inhibited or removed, and wherein the treatment comprises inducing a non-antigen-specific secondary immune response against tumor cancer cells in a subject.
[0004] The present invention also relates to modified immune cells comprising one or more exogenous nucleic acid molecules encoding transgenic constructs that target antigens expressed in cancer cells of solid tumors, wherein, in said cells, NR2F6 activity and Casites B lineage lymphoma proto-oncogene-b (CBLB) activity are inhibited (compared to control immune cells).
[0005] The present invention also relates to pharmaceutical compositions comprising modified immune cells suitable for treating solid tumors, additionally comprising a pharmaceutically acceptable carrier, and in vitro methods for reducing the depletion of the modified immune cells and / or enhancing their cytolytic activity. Background Technology
[0006] Cancer immunotherapy is a promising approach to cancer treatment, heavily reliant on an understanding of the immune system (Guha et al., 2022). Several types of immunotherapy are commonly used in cancer treatment. Immune checkpoint inhibitors (ICIs) are the most common type of cancer immunotherapy, consisting of monoclonal antibodies that target tumor antigens to induce an immune response. Therapeutic cancer vaccines are another type of immunotherapy that generate an endogenous immune response against tumor antigens by presenting their antigens with cell-, peptide-, virus-, or gene-based formulations. By relying solely on the endogenous immune response, this therapy has a shorter list of immune-related adverse events (irAEs) than ICIs. Nevertheless, neither ICIs nor cancer vaccines overcome tumor antigen heterogeneity, which is particularly observed in solid tumors, hindering their therapeutic efficacy in solid tumors (Guha et al., 2022).
[0007] In cancer immunotherapy, chimeric antigen receptor T-cell (CAR-T cell) therapy is an advanced technology that has gained recognition over the past decade (Yan et al., 2023). CAR-T cell therapy holds promise by combining the antigen recognition capabilities of antibodies with those of immune cells (such as CD8+). + By combining the cytotoxic effector function of T cells, the efficacy of cancer therapies can be improved in a more targeted manner.
[0008] However, current CAR-T cell therapies, despite their significant success in patients with blood cancers, have not yet reached their full potential. To date, CAR-T cell therapy is expensive and only applicable to a limited number of cancer types, primarily hematologic malignancies. In 2018, the European Medicines Agency (EMA) approved the first CAR-T cell-based immunotherapies, Kymriah (tisagenlecleocel) and Yescarta (axicabtagene ciloleucel), and the first CAR-T cell product was approved in the United States after 2017. To date, the U.S. Food and Drug Administration (FDA) has approved six different CAR-T cell products targeting two different targets, CD19 and B-cell maturation antigen (BCMA), which are primarily found on cells that cause different types of blood cancers.
[0009] However, to date, these treatments have only been available to patients with relapsed or refractory cancers. Recently, the EMA approved Tecartus (Brexucabtagene autoleucel) for example, to treat mantle cell lymphoma (MCL), so now there are three products available in the European market. These clinically approved CAR-T cell therapies target antigens of B cell lines, such as in leukemia and lymphoma (ECIS – European Cancer Information System; Dine et al., 2017; Zhuang et al., 2012; Marin-Avedo et al., 2018; Fleischer et al., 2019; Holstein et al., 2020 and Depil et al., 2020). However, although up to 50% of patients with this hematologic malignancy respond to CAR-T cell therapy, treatment success is often limited by the fact that some patients only respond briefly and require repeated treatment.
[0010] In summary, CAR-T cells are already translatable in the treatment of hematologic disorders and are considered one of the major breakthroughs in cancer immunotherapy. However, currently approved CAR-T cell therapies are all: 1) targeting cancers in liquid tissues, such as hematologic malignancies, and 2) based on autologous cells (i.e., cells obtained from the patient). Despite active research, breakthroughs in solid tumors are still needed, and despite the urgent need for effective treatment concepts for solid tumors, there are currently no CAR-T cell therapies on the market specifically for solid tumors.
[0011] Recent research on the development of effective CAR-T cell therapies for solid tumors has focused on improving the solid tumor specificity of CARs by identifying neoantigens with higher immunogenicity and lower detumescent toxicity (i.e., tumor neoantigens) (Yan et al., 2023). New targets for lung cancer testing include, for example, mesothelin (MSLN), carcinoembryonic antigen (CEA), receptor tyrosine kinase-like orphan receptor 1 (ROR1), epidermal growth factor receptor variant III (EGFRvIII), B7 homolog 3 protein (B7-H3, also known as CD276), mucin 1 (MUC1), tumor necrosis factor receptor superfamily member 4 (TNFRSF4, also known as CD134 or OXO40), tight junction protein 6 (CLDN6), and carcinoembryonic chondroitin sulfate (ofCS) (Maalej et al., 2023). However, while tumor specificity reduces immune-related adverse events (irAEs), it does not address several challenges that still exist in CAR-T cell therapy for solid tumors (Guha et al., 2022).
[0012] The current limitations of CAR-T cell therapy in solid tumors are multifactorial, including limited colonization and penetration into non-inflammatory tumors, or T-cell terminal dysfunction within the immunosuppressive tumor microenvironment (TIME), and subsequent treatment failure. Another inherent limitation of current CAR-T therapies is the heterogeneous expression of the treatment-targeting surface antigens on malignant cells (i) within solid tumors, and (ii) their presence not entirely confined to tumors but also in other non-cancerous tissues. Therefore, the main reasons for current treatment failures in solid tumors are as follows.
[0013] Solid tumors possess a robust tumor immune microenvironment (TIME) barrier, particularly in the lungs, which physically (e.g., due to the extracellular matrix) and biochemically (e.g., due to the presence of cytokines or due to cell-mediated immunosuppression) hinders the ability of CAR-T cells to penetrate the tumor and results in low persistence due to CAR-T cell depletion and inactivation. This leads to CAR-T cells being unable to effectively kill tumor cells (Mamdani et al., 2022; Hosseinkhani et al., 2020). CAR-T cells have been reported to be almost completely metabolically impaired at solid tumor sites and are typically depleted by solid tumor-mediated immunosuppression, thereby suppressing their cytotoxic function. Furthermore, the immunosuppressive properties of TIME, such as particularly high TGFβ levels, lead to a significant reduction in granzyme secretion, subsequently resulting in a gradual loss of effective antitumor cytotoxicity.
[0014] Furthermore, solid tumors such as lung cancers exhibit high heterogeneity of tumor antigens (primary resistance). Due to this heterogeneity, CAR-T cells targeting one or even two tumor surface antigens often fail to effectively eliminate solid tumors. Non-small cell lung cancer (NSCLC) is one such example of a highly incurable cancer with heterogeneous expression of tumor surface antigens, which has not yet responded to CAR-T therapy (Porter et al., 2015). Additionally, downregulation of CAR-T target antigens can lead to immune evasion of tumor cells from CAR-T cell therapy (acquired resistance) (Mamdani et al., 2022; Zhong et al., 2020; Füchsl et al., 2022). Moreover, it must be noted that tumors often express antigens also present in non-cancerous tissues (e.g., CD19 in acute lymphoblastic leukemia (ALL), making specific targeting of tumor cells difficult and leading to immune-related adverse events (irAEs).
[0015] Multiple approaches to CAR-T cell therapy are under investigation to overcome these obstacles in treating solid tumors, for example, by enhancing the cytotoxic function of T cells (Guha et al., 2022; Majzner et al., 2018). Examples include studies combining CAR-T cells with plug-in technologies, such as secreting cytokines to stimulate anti-cancer effects (e.g., KJ-C2113, a candidate drug from Carsgen Therapeutics in preclinical testing) or modifying immunosuppressive pathways (e.g., PD1 gene editing) (Maalej et al., 2023; Chen et al., 2018).
[0016] Kumar et al. (“The absence of Cblb-b inhibits CD8”) + T cell depletion and promotion of CAR-T cell function (Deletion of Cblb-b inhibits CD8) + The study, "T cell exhaustion and promotes CAR-T cell function," *Journal for Immunotherapy of Cancer*, 2020, analyzed the role of CBLB (CBLB gene) in T cell exhaustion in Castratas B-cell lymphoma. They showed that CBLB deletion inhibited CAR-T cell exhaustion in Rag1 knockout mouse models, which are mouse strains completely lacking an endogenous adaptive immune system. Therefore, due to the lack of endogenous T cell compartments in these Rag1 knockout mice used by Kumar et al., it was impossible to study cross-sensitization to tumor antigens. Thus, by using Rag1 knockout mice, Kumar et al., in their study, provided no evidence that effective secondary and polyclonal immune responses could be induced by CBLB gene-edited CAR-T therapy in antigenically heterogeneous solid tumors.
[0017] Another approach is to inhibit nuclear receptor subfamily 2F member 6 (NR2F6) as an immune checkpoint in T cells or other cells (e.g., umbilical cord blood cells) to enhance the antitumor activity of these cells. For example, such an approach, disclosed in Hermann-Kleiter et al. (2015), showed that NR2F6-modified T cells exhibited a significant tumor rejection advantage in therapeutic adoptive transfer of T cells in vivo in a prior art tumor mouse model (B16). Furthermore, Klepsch et al. (“Nucelar receptor NR2F6 inhibition potentiates responses to PD-L1 / PD-1 cancer immune checkpoint blockade”, Nature Communications, 2018) evaluated the role of NR2F6 as an intracellular immune checkpoint, demonstrating a synergistic effect between NR2F6 and PD-L1 inhibition in antitumor therapy. Klepsch et al. (“Targeting the orphan nuclear receptor NR2F6 in T cells prime tumors for immune checkpoint therapy,” Cell Communication and Signaling, 2020) disclosed that NR2F6 gene elimination in primary mouse T cells enhanced an established PD-L1 and CTLA-4 blockade anticancer therapy. However, these studies did not disclose the modification or effect of NR2F6 on the inhibition of CAR-T cells targeting antigenically heterogeneous solid tumors.
[0018] Regen BioPharma has disclosed that inhibiting NR2F6 in CAR-T cells reduces T-cell exhaustion (Regen Biopharma, “Regen Biopharma Begins Validation of its Proprietary CAR-T Cell Therapy,” 2022; Regen BioPharma, “Regen BioPharma Advances its DuraCar Therapy,” 2022). This demonstrates anti-CD19 CAR-T cells against B-cell-related cancers, such as B-cell lymphoma. Other approaches are disclosed in US 2017 / 0304418 and US 2021 / 0317180. However, none of these publications demonstrate that these approaches overcome the barriers to CAR-T cell therapy for solid tumors. In particular, no evidence of secondary and polyclonal immune responses has been demonstrated in the treatment of antigenically heterogeneous solid tumors.
[0019] Most of these studies are still in early-stage clinical trials, with no curative solutions or clear market leaders. The lack of understanding of the precise tumor rejection mechanisms triggered by CAR-T cells within the patient's endogenous T-cell compartment hinders the development of these therapies. This is evidenced by the fact that no CAR-T approach is effective or shows durable responses to tumors with high antigenic heterogeneity, such as most solid tumors.
[0020] Given the aforementioned drawbacks and the inherent difficulties in developing cell therapies that exhibit high affinity and cytotoxic activity against malignant cells in solid tumors, there is an urgent need in the field for new approaches to improve the activity and ultimate efficacy of cell therapies (e.g., CAR-T cells) to overcome the challenges in treating solid tumors caused by CAR-T cell depletion, metabolic dysfunction and subsequent loss of function, as well as the antigenic heterogeneity of solid tumors. Summary of the Invention
[0021] In view of the prior art, the fundamental technical problem of the present invention is to provide alternative or improved means for enhancing the cytolytic activity of therapeutic immune cells against solid tumors, particularly for alternative or improved means for the cytolytic activity of immune cells against solid tumors having antigen-specific targeting constructs that guide immune cells to specific tumor targets.
[0022] Another object of the present invention is to provide alternative or improved means for reducing the sensitivity of therapeutic immune cells to depletion and inactivation in the solid tumor microenvironment.
[0023] Another object of the present invention is to provide means for improving immunocellular therapies such as CAR-T or TCRT cell therapies for the treatment of solid tumors.
[0024] Another object of the present invention is to provide an immunocellular therapy for treating solid tumors that can be produced in a time- and cost-effective and simple manner.
[0025] Another object of the present invention is to provide an immunocellular therapy for treating solid tumors that has shown low systemic cytotoxicity and low immune-related side effects in subjects.
[0026] Another object of the present invention is to provide an immunocellular therapy for treating solid tumors that produces a durable immune response and does not require repeated administration of the cell therapy to a subject.
[0027] These problems are addressed by the features of the independent claims. Preferred embodiments of the invention are provided in the dependent claims.
[0028] In one aspect, the present invention relates to modified immune cells for treating solid tumors in a subject, wherein,
[0029] - The modified immune cells comprise one or more exogenous nucleic acid molecules that encode transgenic constructs that target antigens expressed in the cancer cells of the solid tumor.
[0030] - In the said immune cells, the activity of nuclear receptor subfamily 2F member 6 (NR2F6) was inhibited (compared to control immune cells), and
[0031] - The binding of the immune cells to the antigen is associated with the death of the cancer cells expressing the antigen and induces a secondary immune response against cancer cells of solid tumors in the subject, wherein the secondary immune response is nonspecific to the antigen targeted by the transgenic construct (epitope diffusion).
[0032] The modified immune cells of this invention exhibit surprising efficacy and specificity in the treatment of solid tumors. Therefore, the inventors have discovered that the high efficiency and specificity of the immune cells of this invention (e.g., NR2F6-modified CAR-T cells) compared to prior art immunocellular therapies primarily involve (1) reduced sensitivity to chronic tumor antigen stimulation and the exhaustion and metabolic inactivation induced by the tumor immune microenvironment (TIME), leading to effective killing of tumor cells expressing antigens targeted by the transgenic construct (e.g., CAR), and (2) the subsequent induction of a secondary, polyclonal, and sustained immune response due to the initial killing of tumor cells expressing the targeted antigen. This induction of a secondary immune response advantageously leads to effective killing and clearance, particularly effective killing and clearance of heterogeneous tumors comprising tumor cells not expressing antigens targeted by the transgenic construct, which are generally insensitive to immunocellular therapy, thereby enabling patients to survive without tumor recurrence.
[0033] Compared to existing therapeutic immune cells, inhibition of NR2F6 maintains the robust tumor-killing activity of the immune cells of the present invention, despite the fact that existing immune cells, such as CAR-T cells, are typically exhausted and inactivated under the harsh tumor microenvironment (TIME) and chronic tumor antigen stimulation of solid tumors. Inhibition of NR2F6 prevents exhaustion-mediated immune cell dysfunction and maintains the long-lasting cytotoxic effector function of the immune cells of the present invention. This allows for effective killing and induction of secondary immune responses. Furthermore, NR2F6 is a highly localized and inducible “exhaustion factor” selectively activated in immune cells within the tumor microenvironment (TIME), thus the cytotoxic activity of the immune cells of the present invention is advantageously limited to the tumor site, thereby reducing the chance of immune-related adverse events (irAEs). The immune cells of the present invention with NR2F6 inhibition activate an immune response against the tumor, allowing for the recognition of excessive tumor antigens for a given solid cancer type. Therefore, autoantigens also expressed in healthy cells do not trigger robust and persistent activation of the patient’s own immune system. Consequently, the secondary immune response is specific to the patient’s solid tumor, advantageously leading to a reduction in immune-related adverse events (irAEs).
[0034] These beneficial effects are also demonstrated in the following embodiments. Figure 8 As shown, inhibition of NR2F6 in CAR-T cells, for example, only in immune-active wild-type recipient mice (but not in Rag1 knockout mouse strains that are completely lacking in the endogenous adaptive immune system) resulted in superior antitumor immunity against the EpCAM antigen-heterogeneous PanC-02 tumor burden. Figure 8 The data presented clearly demonstrate that the tumor growth advantage observed based on epitope diffusion requires an endogenous immune system. Only epitope diffusion elicits a durable secondary immune response from the endogenous adaptive immune system. Furthermore, as... Figure 10 As shown, intact NR2F6-modified CAR-T responders have developed secondary and polyclonal antitumor memories for tumor control that can be transferred to EpCAM-negative WT tumor receptors. These results provide proof of concept for long-term immune memory of the NR2F6-modified CAR-T therapy of the present invention, which induces secondary induced endogenous T cell compartments for host-protective tumor control in EpCAM-negative tumors (in tumor antigen-agnostic effects).
[0035] No prior art mentions the effective, secondary, and polyclonal immune responses generated by NR2F6 gene-edited CAR-T therapy in patients' own immune systems. However, this tumor epitope spread is a key mechanistic basis for the durable immune memory response promoted by NR2F6-modified CAR-T therapy for antigenically heterogeneous solid tumors. This is the fundamental mechanism of the present invention. Prior art, such as the literature of Klepsch et al. or RegenBio Pharma, provides no evidence that NR2F6 gene-edited CAR-T therapy for antigenically heterogeneous solid tumors induces effective secondary and polyclonal immune responses in endogenous T cell compartments. However, this is a key mechanistic basis for the durable immune memory response promoted by NR2F6-modified CAR-T therapy for antigenically heterogeneous solid tumors.
[0036] Other advantages of this invention include the discovery that the immune cells of this invention can treat highly heterogeneous solid tumors, such as NSCLC. Solid tumors are typically antigenically diverse and cannot be effectively eliminated by existing immunocellular therapies, such as CAR-T cells designed to target one or even two tumor surface antigens. Therefore, one of the most challenging design aspects of solid tumor immunotherapy is providing specific therapies that target tumor cells but overcome antigen loss or heterogeneity within the tumor. The modified immune cells of this invention, utilizing the TIME-inducible NR2F6 immune checkpoint, surprisingly ensure tumor specificity while inducing a secondary immune response therein, making tumor cells that do not express the antigens targeted by the immune cells of this invention more readily recognized by the patient's immune system through cross-sensitization (epitope diffusion). Solid tumor patients typically have low responsiveness to existing CAR-T cell therapies and are highly variable due to inherent and / or acquired tumor resistance to current CAR-T regimens. In contrast, the self-sustaining and expanding systemic secondary tumor immunity triggered by the immune cells of this invention allows most solid tumor patients to receive immunocellular therapy. Therefore, this invention advantageously transforms non-curative immunotherapy (e.g., CAR-T and TCR therapy) for solid tumors into curative therapy by providing a gene-editing plug-in technology that targets the NR2F6 immune checkpoint in immune cells.
[0037] Unlike existing immunocellular therapies, the immune cells of this invention effectively kill cancer cells carrying target antigens within the immune microenvironment (TIME) of solid tumors due to reduced sensitivity to depletion and metabolic inactivation within the TIME. Dying cancer cells expose a large amount of tumor cell antigens for cross-sensitization (epitope diffusion), enabling the body's T cells to recognize a variety of non-self tumor antigens (expressed on the surface and within the patient's tumor cells) and subsequently kill all tumor cells, including those that do not express (or no longer exhibit acquired resistance due to immune evasion) the antigens targeted by the immune cells of this invention. Therefore, the modified immune cells of this invention surprisingly provide a "tumor antigen-agnostic" immunocellular therapy that leads to the depletion of all cancer cells in solid tumors, including those that do not express antigens targeted by transgenic constructs (e.g., CARs). Since this cell therapy of the invention initiates a long-lasting secondary immune response against solid tumors rather than a temporary / occasional immune response, the need for repeated treatments is further reduced, thereby lowering costs and alleviating the burden on patients.
[0038] Furthermore, compared to existing immunocellular therapies, the immune cells of this invention surprisingly do not require leukocyte depletion before administration to the subject, as the endogenous immune system essentially contributes to a secondary, sustained immune response. Therefore, the method of this invention further reduces the suffering and treatment costs for patients due to additional treatment prior to immunocellular therapy.
[0039] This invention can be advantageously applied to any prior art immunocellular therapy, such as CAR-T cell therapy. The inventive concept of NR2F6 inhibition in modified immune cells can be applied, for example, as a plug-in technology to any prior art CAR targeting a given cancer entity. This advantageously enables the personalization of CAR-T cell therapy by complementing current strategies (e.g., targeting tumor neoantigens). For treatment personalization, a patient biopsy can be used to identify neoantigens expressed in the patient's solid tumor. Subsequently, CAR-T cells expressing a selected neoantigen-specific CAR can be generated from autologous T cells in which NR2F6 is inhibited, for example through gene silencing or with an NR2F6 inhibitor, such as a small molecule inhibitor. Therefore, this concept improves the therapeutic efficacy of existing and emerging CAR-T cell therapies in the treatment of solid tumors.
[0040] Furthermore, the concept of this invention is surprisingly applicable to emerging off-the-shelf allogeneic CAR-T cell therapies. T cells used in allogeneic CAR-T cell therapy are collected from healthy donors and can be pre-stably engineered for use in patients. In this document, following a biopsy, an allogeneic CAR expressing a neoantigen optimal for the patient is selected. NR2F6 is inhibited within the cells expressing this CAR, either before administration to the patient or by simultaneous or sequential administration of the cells and an NR2F6 inhibitor to the patient. Therefore, the concept of this invention can be readily and broadly applied to existing and emerging immunocellular therapies, significantly improving the efficiency of such therapies.
[0041] Therefore, the present invention is defined by a combination of features representing a novel approach superior to the prior art. For example, in embodiments, the invention includes (a) administering modified immune cells with inhibited, disrupted, or removed NR2F6 activity, and (b) inducing a secondary non-antigen-specific immune response (epitope diffusion) against cancer cells. Thus, the invention is defined by one or more novel technical or medical effects that are not previously apparent or cannot be derived from prior art disclosures. Importantly, the identification of such novel medical effects, particularly the relationship between (a) modified immune cells with inhibited NR2F6 activity and (b) a secondary non-antigen-specific immune response (epitope diffusion) against cancer cells, also enables its practical implementation in treating additional patients previously considered untreatable and enhancing the efficacy of therapeutic cell products, thereby positively influencing the treatment, dosage, and administration of therapeutic cells. Furthermore, the present invention advantageously transforms non-curative immunotherapies for solid tumors (e.g., CAR-T and TCR therapies) into curative ones by providing a gene-editing plug-in technology targeting the NR2F6 immune checkpoint in immune cells.
[0042] The recognition of this previously unknown and beneficial technical effect—the induction or enhancement of epitope diffusion by employing cytotoxic immune cells in which NR2F6 activity is inhibited—has led to new clinical situations. By recognizing this novel effect, previously untreatable patient populations (e.g., those with solid tumors and / or tumors with different cancer antigenic heterogeneity) can now be effectively treated. Furthermore, due to the anticipated increased efficacy of the methods of the present invention, a reduced number of therapeutic cells is expected to be needed to induce the desired medical effect. Therefore, recognizing a new mechanism of epitope diffusion in the context of, for example, CAR-expressing immune cells, and enhancing this effect using NR2F6 inhibition in said immune cells, represents a novel combination of features sufficient to distinguish the present invention from the prior art. This creates a new clinical situation that has a direct impact on the treatment of new patient populations and / or administration regimens.
[0043] In one implementation, the secondary immune response targets one or more antigens expressed by cancer cells.
[0044] In one implementation, one or more antigens expressed by cancer cells are non-autotumor antigens.
[0045] In one implementation, one or more antigens expressed by cancer cells are expressed intracellularly and / or extracellularly.
[0046] In one embodiment, the secondary immune response is a T-cell-mediated immune response, preferably a polyclonal T-cell-mediated immune response.
[0047] In one embodiment, inhibition of NR2F6 is associated with resistance and / or reduced sensitivity of the cells to the tumor immune microenvironment (TIME) of solid tumors, which inhibits cytolytic activity.
[0048] In one embodiment, immune cells modified with a transgenic antigen-targeting construct (where NR2F6 activity is inhibited) are characterized by an increase in cell lysis activity of 50% or more, preferably 65% or more, more preferably 80% or more. In another embodiment, immune cells modified with a transgenic antigen-targeting construct (where NR2F6 activity is inhibited) are characterized by an increase in cell lysis activity in the tumor microenvironment (TIME) of 50% or more, for example, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, or 300% or more.
[0049] Functional assays for quantitatively or semi-quantitatively determining the increase in cytolytic activity in immune cells in which NR2F6 and optionally CBLB are suppressed are available to those skilled in the art, and some examples are described herein. For example, the in vitro assays described in the examples can be applied to determine an increase in cytolytic activity relative to control immune cells (i.e., immune cells in which NR2F6 and optionally CBLB are not suppressed).
[0050] In one implementation, the inhibition of NR2F6 is associated with the cells’ resistance to exhaustion and / or reduced sensitivity to stimulation by chronic tumor antigens within the tumor immune microenvironment (TIME).
[0051] In one embodiment, immune cells modified with a transgenic antigen-targeting construct (wherein NR2F6 activity is inhibited) are characterized by an increase in metabolic activity of 50% or more, preferably 75% or more, more preferably 100% or more. In another embodiment, immune cells modified with a transgenic antigen-targeting construct (wherein NR2F6 activity is inhibited) are characterized by an increase in metabolic activity of 50% or more, for example, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, or 300% or more, compared to control immune cells without NR2F6 inhibition.
[0052] Functional assays for quantitatively or semi-quantitatively determining the increase in metabolic activity in immune cells where NR2F6 and optionally CBLB are suppressed are available to those skilled in the art, and some examples are described herein. For example, the in vitro assays described in the examples can be applied to determine an increase in metabolic activity relative to control immune cells (i.e., immune cells where NR2F6 and optionally CBLB are not suppressed).
[0053] In one embodiment, the activity of the Casites B lineage lymphoma proto-oncogene-b (CBLB) was further inhibited in the cells (compared to control immune cells).
[0054] Surprisingly, simultaneous inhibition of NR2F6 and CBLB in the immune cells of this invention results in a synergistic effect on the effector activity of said immune cells in the treatment of solid tumors, and further synergistically reduces the sensitivity of said cells to exhaustion and inactivation induced by chronic tumor antigen stimulation and the tumor microenvironment (TIME). Without being bound by theory, this synergistic effect can be attributed to NR2F6 inhibition, leading to metabolic shift of said immune cells in TIME and CBLB, resulting in resistance of said cells to TIME exhaustion, particularly to TGFβ. Given the prior art, those skilled in the art would not have anticipated such a synergistic effect of inhibiting NR2F6 and CBLB.
[0055] In one embodiment, the transgenic construct is transiently expressed in the immune cells.
[0056] The inventors unexpectedly discovered that immune cells of the present invention can be modified to transiently express transgenic constructs (e.g., CAR or TCR) by using mRNA encoding CAR or TCR. Therefore, such transiently transfected cells surprisingly maintain their efficiency and specificity in the treatment of solid tumors when compared to immune cells that permanently express transgenic constructs. This can be attributed to the secondary response induced by the immune cells of the present invention in the patient's immune system, which is persistent and independent of the antigen targeted by the modified immune cells.
[0057] In contrast to permanent expression, the transient expression of the transgenic constructs in the immune cells of the present invention does not require specialized and time-consuming gene-editing techniques. Therefore, the manufacture of transiently modified immune cells does not require trained personnel or specialized GMP facilities, and is much less time-consuming. Consequently, the immune cells according to the present invention can be produced in a more efficient, cost-effective, and faster manner (e.g., reducing vein-to-vein time (the time between T cell collection and CAR-T infusion) from 2 / 3 weeks to 1 day), making cell-based therapies more effective for patients with solid tumors and avoiding the need for bridging therapies to compensate for the waiting time until immune cells are ready for therapy.
[0058] In one implementation, the transgenic construct is a T-cell receptor (TCR).
[0059] In one implementation, the transgenic construct is a chimeric antigen receptor (CAR).
[0060] The specific type or form of the antigen-targeting construct is not intended to be a limiting feature of the invention. The concept of the invention is based on the intrinsic NR2F6 and optional CBLB inhibition of immune cells, which mediates increased cytolytic activity and decreased depletion sensitivity of solid tumors via TIME. Therefore, the enhanced activity of the modified immune cells of the present invention is independent of the antigen-targeting construct, which is only considered a means of bringing modified immune cells closer to tumor cells.
[0061] Tumor-associated antigens targeted by transgenic constructs (e.g., CAR or TCR constructs) can be selected from, but are not limited to: phosphatidylinositol proteoglycan-3 (GPC3), human epidermal growth factor receptor 2 (HER2), tumor-associated ganglioside GD2 (GD2), epidermal growth factor receptor (EGFR), EGFR variant III (EGFR vIII), carcinoembryonic acid chondroitin sulfate (ofCS), EGFR806, carcinoembryonic antigen (CEA), prostate-specific membrane antigen (PSMA), folate receptor α (FRα), epithelial cell adhesion molecule (EPCAM), mucin 1 (MUC1), receptor tyrosine kinase-like orphan receptor 1 (ROR1), MUCI16eto, vascular endothelial growth factor receptor 2 (VEGFR2), neural cell adhesion molecule L1 (CD171), prostate stem cell antigen (PSCA), erythropoietin-induced hepatocellular carcinoma A2 (EphA2), and fibroblasts. Activated protein (FAP), carbonic anhydrase 9 (CAIX), hepatocyte growth factor receptor (c-MET), neural cell adhesion molecule L1 (L1-CAM), mesothelin (MSLN), programmed cell death 1 ligand 1 (PD-L1), Wilms tumor protein (WT1), New York esophageal squamous cell carcinoma-1 (NY-ESO-1), melanoma-associated antigen-encoding gene A1 (MAGE-A1), melanoma-associated antigen-encoding gene A1 (MAGE-A2), melanoma-associated antigen-encoding gene A1 (MAGE-A4), Claudin 18.2, Alpha-fetoprotein (AFP), Nectin 4 / FAP, Lewis Y, MUC16, AXL receptor tyrosine kinase (AXL), CD20, CD80 / 86, delta-like ligand 3 (DLL-3), death receptor 5 (DR5), glycoprotein 100 (gp100), latent membrane protein (LMP-1), cytotoxic lectin-like receptor K1 (NKG2D), guanylate cyclase C (GUCY2C), tumor-associated glycoprotein 72 (TA-72), CD46, anthrax toxin receptor 1 (ANTXR1), mucin 3A (MUC3A), trophoblast cell surface antigen 2 (Trop2), integrin αvβ6 (αvβ6), CD47, chondroitin sulfate proteoglycan 4 (GSPG4), phosphatidylinositol proteoglycan 2 (GP 2) B7 homologue 3 (B7-H3, also known as CD276), prostate-specific antigen (PSA), anti-prostate acid phosphatase (PAP), CD32A, C133 and interleukin-13 receptor α2 (IL13Rα2).
[0062] Detailed overviews of publicly available clinical trials of chimeric antigen receptor T cells (CAR-T) and TCR-transduced T cells (TCR-T) have been published in Mo et al. (Journal of Cancer, 2017; 8(9): 1690-1703), Hartmann et al. (EMBOMolecular Medicine, 2017; 9(9): 1183-1197), Townsend et al. (Journal of Experimental & Clinical Cancer Research, 2018, 37:163), Marofi et al. (Stem Cell Research & Therapy, 2021, 12, 81), Sorkhabi et al. (Frontiers in Immunology, 2023, 14, 1113882), and Drouggkas et al. (Journal of Cancer Research and Clinical Oncology, 2023, 149(6), 2709-2734).
[0063] In implementation, a combination of antigen-targeting constructs targeting two or more of the above-mentioned antigens may also be used, for example, by using one or more targeting constructs to target, for example, mesothelin (MSLN), epidermal growth factor receptor variant III (EGFRvIII), B7 homology 3 protein (B7-H3, also known as CD276), mucin 1 (MUC1) and / or carcinoembryonic chondroitin sulfate (ofCS).
[0064] Not only are tumor type-specific and diverse antigens expressed in one type of cancer, but one antigen can also be expressed in multiple types of cancer. These antigens can also be targeted. For example, NY-ESO-1 is highly expressed in melanoma, multiple myeloma, NSCLC, synovial sarcoma, breast cancer, renal cell carcinoma, hepatocellular carcinoma, esophageal cancer, ovarian cancer, and bladder cancer. Similarly, mesothelin is highly expressed in mesothelioma and breast cancer, cervical cancer, pancreatic cancer, ovarian cancer, lung cancer, and endometrial cancer.
[0065] In other embodiments, the transgenic construct to be used, such as the CAR construct, can be easily replaced, thus allowing for modular compositions of clinically applicable CARs. The antigen specificity of the CAR is variable and does not limit the invention.
[0066] The specific antigens described herein are exemplary and represent preferred, non-limiting embodiments of the invention. The inventive concept of NR2F6 and optional CBLB inhibition can be applied to any given modified immune cells, regardless of the antigen specificity of the immune cells.
[0067] In one embodiment of the cells, the activities of NR2F6 and optionally CBLB are inhibited by at least 50%, preferably at least 60%, more preferably at least 70%, or the activities of NR2F6 and optionally CBLB are removed compared to control immune cells. In one embodiment of the cells, the activities of NR2F6 and optionally CBLB are inhibited by at least 50% (compared to control immune cells), for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100% (compared to control immune cells).
[0068] For example, control immune cells are cells of the same type as those exhibiting the inhibition, although measures to inhibit NR2F6 activity have not yet been taken in the control cells. For instance, in the context of therapeutic CAR-T cells, control cells could be considered as T cells or CAR-T cells in which no measures to inhibit NR2F6 activity have been taken, and cells in which NR2F6 has been inhibited are compared with control cells.
[0069] Functional assays for quantitatively or semi-quantitatively determining the inhibition of NR2F6 and optionally CBLB in immune cells are available to those skilled in the art, and some examples are described herein. For example, the in vitro assays described in the examples can be applied to determine the inhibition of NR2F6 and CBLB.
[0070] In one embodiment, inhibition of NR2F6 activity and optionally CBLB activity is achieved by disrupting the expression and / or sequence of the NR2F6 gene and optionally the CBLB gene prior to administration of the cells to a subject, preferably by CRISPR-Cas, zinc finger nuclease (ZFN), integrase, site-specific recombinase, meganuclease, homing endonuclease or TALEN, more preferably by CRISPR / Cas9.
[0071] In one embodiment, inhibition of NR2F6 activity and optional CBLB activity is achieved by knocking down NR2F6 and optional CBLB, preferably by RNA interference of NR2F6 expression and optional CBLB expression, such as by small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), morpholinos, and / or antisense oligonucleotides (ASO).
[0072] Due to the inherent advantages of RNA interference methods in biological systems, RNA interference methods are preferred for NR2F6 and optionally for CBLB suppression (i.e., "silencing" or "knockdown"). RNAi technology offers a superior safety profile compared to genome manipulation by not interfering with genome structure or integrity.
[0073] Those skilled in the art can design effective RNA targeting sequences based on the target sequence and well-known knowledge in the field. Software for such methods is generally available, which can be used to design sequences, for example, as siRNA, shRNA, miRNA, or ASO, to interfere with the expression of NR2F6 and optionally CBLB. For example, the program BLOCK-iT RNAi from ThermoFisher can be used. Alternative software can also be identified and used.
[0074] In one embodiment, inhibition of NR2F6 activity and optional CBLB activity is achieved by treating the cells with an NR2F6 antagonist and an optional CBLB antagonist (e.g., a small molecule inhibitor of NR2F6 and optional CBLB).
[0075] A non-limiting example of a small molecule inhibitor of NR2F6 is TES-4207, developed by TESPharma (Peruggia / Italy). Other non-limiting examples of small molecule inhibitors of NR2F6 are disclosed in WO2019 / 104199, WO2019 / 104201, and US2019 / 0358224. A non-limiting example of a small molecule inhibitor of CBLB is NX-1607, developed by Nurix / USA. Other non-limiting examples of small molecule inhibitors of CBLB are disclosed in WO2020 / 210508, WO2020 / 236654, WO2020 / 264398, WO2019 / 148005, and WO2022 / 272248.
[0076] In one embodiment, inhibition of NR2F6 activity and optional CBLB activity is obtained before administering the cells to the subject and / or by administering the cells and the NR2F6 antagonist and optional CBLB antagonist to the subject simultaneously or sequentially.
[0077] In one embodiment, the cell is a T cell, preferably a CD4+ T cell or a CD8+ T cell. + T cells.
[0078] In one embodiment, the cells are cytotoxic T cells, preferably CD4+ T cells or CD8+ T cells. + T cells.
[0079] In one implementation, the cell is a natural killer (NK) cell.
[0080] In one embodiment, the solid tumor is selected from the group consisting of glioblastoma, lung cancer, breast cancer, kidney cancer, pancreatic cancer, melanoma, colorectal cancer, ovarian cancer, prostate cancer, and colon cancer.
[0081] In one aspect, the present invention relates to modified immune cells comprising one or more exogenous nucleic acid molecules encoding transgenic constructs that target antigens expressed in cancer cells of solid tumors, wherein NR2F6 activity is inhibited in said cells (compared to control immune cells).
[0082] In one aspect, the present invention relates to modified immune cells comprising one or more exogenous nucleic acid molecules encoding transgenic constructs targeting antigens expressed in cancer cells of solid tumors, wherein, in said cells, NR2F6 activity and Casites B lineage lymphoma proto-oncogene-b (CBLB) activity are inhibited (compared to control immune cells).
[0083] In one aspect, the present invention relates to pharmaceutical compositions suitable for treating solid tumors, comprising immune cells modified according to the invention, and additionally comprising a pharmaceutically acceptable carrier.
[0084] In one aspect, the present invention relates to an in vitro method for enhancing the cytolytic activity of modified immune cells, said immune cells comprising one or more exogenous nucleic acid molecules encoding transgenic constructs targeting antigens expressed in cancer cells of solid tumors, said method comprising inhibiting the activity of nuclear receptor subfamily 2F member 6 (NR2F6) and optionally the activity of the Castratas B lineage lymphoma proto-oncogene-b (CBLB) in said immune cells, wherein inhibiting NR2F6 activity and optionally CBLB activity preferably comprises:
[0085] a. Genetic modification of the T cell genome by disrupting the expression and / or sequence of the NR2F6 gene and optionally the CBLB gene, wherein the disruption of the expression and / or sequence of the NR2F6 gene and optionally the CBLB gene is preferably performed via CRISPR-Cas, zinc finger nucleases (ZFNs), integrases, site-specific recombinases, meganucleases, homing endonucleases, or TALENs.
[0086] b. Knock down NR2F6 and optional CBLB, preferably via RNA interference expressing NR2F6 and optional CBLB, such as via small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), molar finol and / or antisense oligonucleotide (ASO), or
[0087] c. Treat the cells with an NR2F6 antagonist and optionally a CBLB antagonist, such as NR2F6 and optionally a small molecule inhibitor of CBLB.
[0088] This invention relates to all suitable methods for transferring genetic information / nucleic acid molecules of transgenic antigen-targeting constructs (e.g., CAR or TCR) and inhibitors of NR2F6 and optional CBLB into cells, and that, when practicing this invention, those skilled in the art can choose suitable methods. For example, a variety of methods for transfecting immune cells are known in the art, including any given virus-based gene transfer method (e.g., methods based on modified retrovirids) and non-viral methods (e.g., lipid nanoparticles and cationic polymers, DNA-based transposons, cDNA vectors containing free genes, and direct transfer of mRNA via electroporation or lipid nanoparticles).
[0089] All features described in this specification may be used to define any other embodiment or aspect of the invention. For example, features describing immune cells may be used to describe immune cells for treating solid tumors, pharmaceutical compositions, or methods for enhancing the cytolytic activity of modified immune cells, and vice versa. Similarly, features describing methods of the invention may be used to describe cells or compositions, and vice versa. Detailed Implementation
[0090] As described in detail herein, the present invention relates to modified immune cells in which NR2F6 and optionally CBLB are inhibited, thereby enhancing cytolytic function and reducing the sensitivity of said cells to depletion and inactivation caused by the microenvironment of solid tumors. The enhanced cytolytic function and the reduction in depletion and inactivation lead to greater efficiency and induction of secondary immune responses, resulting in greater efficiency of said cells against tumors.
[0091] Genetically modified immune cells
[0092] In a specific embodiment, the present invention considers genetically modified immune cells to express antigen-specific targeting constructs that target antigens expressed in cancer cells of solid tumors, wherein NR2F6 is inhibited in said immune cells. These immune cells are intended for use in the treatment of solid tumors, the treatment comprising inducing a secondary immune response (epitope diffusion).
[0093] As used herein, the terms “genetically engineered,” “genetically modified,” or “modified” refer to the addition of extra genetic material in the form of DNA or RNA to the total genetic material of a cell. The terms “genetically modified cell,” “modified cell,” and “redirected cell” are used interchangeably. As used herein, the terms “gene therapy” or “modification” refer to the permanent or temporary introduction of extra genetic material in the form of DNA or RNA into the total genetic material of a cell to restore, correct, or modify gene expression, or to express a transgenic construct, such as a CAR or TCR, targeting an antigen expressed in cancer cells of a solid tumor. The expression of the transgenic construct can be “transient” or “stable.” Transient expression involves the transient expression of a construct by introducing a foreign nucleic acid into the cell without integrating the nucleic acid into the cell’s genome. Stable expression refers to the long-term expression of the construct by introducing a foreign nucleic acid into the cell and integrating it into the cell’s genome.
[0094] "Immune cells" or "immune effector cells" are any cells of the immune system that have one or more effector functions (e.g., cytotoxic cell-killing activity, cytokine secretion, induction of antibody-dependent cytotoxicity (ADCC) and / or complement-dependent cytotoxicity (CDC)). Immune cells, such as the T cells and NK cells of the present invention, can be autologous / autogenetic ("self") or non-self ("non-self", e.g., allogeneic, syngeneic, or allogeneic). As used herein, "self" means a cell from the same subject, representing a preferred embodiment of the invention. As used herein, "allogeneic" means a cell of the same species that is genetically different from the cell being compared. As used herein, "syngeneic" means a cell from a different subject that is genetically identical to the cell being compared. As used herein, "alienate" means a cell from a different species that is genetically different from the cell being compared. In a preferred embodiment, the cells of the present invention are autologous or allogeneic.
[0095] T cells, also known as T lymphocytes, are immune cells belonging to the lymphocyte group. T cells can be thymocytes, immature T lymphocytes, mature T lymphocytes, resting T lymphocytes, cytokine-induced killer cells (CIK cells), activated T lymphocytes, or tumor-infiltrating lymphocytes (TILs). T cells originate from the bone marrow and migrate to the thymus via the bloodstream. In the thymus, they produce T cell receptors (TCRs) and undergo positive and negative selection, during which cells showing high affinity for endogenous proteins are degraded. T cells can be helper T cells (Th; CD4+ T cells, CD4 T cells), such as helper T (Th) cells like TH1, TH2, TH3, TH17, TH9, or TFH cells. T cells can be cytotoxic T cells (CTLs; CD8+ T cells, CD8 T cells) or CD4+CD8+ T cells or any other subset of T cells, such as cytokine-induced killer (CIK) cells, which are typically CD3 and CD56 positive, non-major histocompatibility complex (MHC) restricted, natural killer (NK)-like T lymphocytes. T cells can be naive T cells, effector T cells, memory T cells, effector memory T cells, central memory T cells, or memory stem T cells. T cells can be umbilical cord blood cells. T cells can be peripheral lymphocytes. T cells can be derived from and expanded from peripheral blood mononuclear cells (PBMCs). T cells can be autologous relative to the individual to whom they are administered. T cells can be allogeneic relative to the individual to whom they are administered.
[0096] Cytotoxic T cells (also known as TCs, cytotoxic T lymphocytes, CTLs, killer T cells, cytolytic T cells, T cells, or cytotoxic T cells, used interchangeably herein) are T cells (a type of white blood cell) that have cytolytic activity against, for example, cancer cells. In some embodiments, cytolytic activity may be associated with CD8+ and / or CD4+ T cells. Both T cell subsets can produce and release lysosome contents, i.e., cytolytic enzymes, such as granzymes. The terms “cytolysis” or “cytolytic activity” refer to the ability of immune cells (e.g., T cells) to kill target cells, for example, by releasing lysosome contents, the latter also known as secretory lysosomes. The terms CD8 and CD8+ are also used in this context. + The cells refer to the same type of cell. The terms CD4 and CD4 + The cells all refer to the same type of cell.
[0097] As a central element of the adaptive immune response, T cells are able to eliminate infected and transformed tumor cells. CD8 + T cells can mature into cytotoxic T lymphocytes (CTLs) and are primarily involved in destroying infected or transformed cells by releasing cytolytic granules into the immune synapse. These granules include Ca 2+Perforin and granzyme are released and induce apoptosis in target cells via a cognitotropic secretory pathway. Once a CTL recognizes and binds to its target cell, the secretory lysosome moves and accumulates around the microtubule organization center. Following membrane fusion, perforin and granzyme are released into the immune synapse. Perforin is a pore-forming molecule capable of membrane permeability, which is crucial for enabling granzyme to enter the target cell cytosol. Within the target cell, the programmed cell death pathway is initiated by granzyme.
[0098] Natural killer cells, also known as NK cells or large granular lymphocytes (LGLs), are cytotoxic lymphocytes essential to the innate immune system. They belong to the rapidly expanding known family of innate lymphocytes (ILCs) and comprise 5–20% of all circulating lymphocytes in the human body. NK cells function similarly to cytotoxic T cells in the adaptive immune response in vertebrates. NK cells provide a rapid response to virus-infected cells and other intracellular pathogens approximately 3 days after infection and also respond to tumorigenesis. Normally, immune cells detect the major histocompatibility complex (MHC) present on the surface of infected cells, triggering the release of cytokines that cause the infected cells to die through lysis or apoptosis. However, NK cells are unique because they possess the ability to recognize and kill stressed cells in the absence of antibodies and MHC, allowing for a more rapid immune response. NK cells can be identified by the presence of CD56 and the absence of CD3 (CD56+, CD3-).
[0099] This invention provides a method for modifying immune cells to express transgenic constructs targeting antigens expressed in cancer cells of solid tumors as described herein. In one embodiment, the method includes transfecting or transducing immune cells isolated from an individual such that the immune cells express one or more antigen-specific constructs as described herein (e.g., CAR or TCR). In some embodiments, immune cells are isolated from an individual and genetically modified in vitro without further processing. Such cells can then be directly re-administered to the individual. In a further embodiment, before genetic modification to express the transgenic construct (e.g., CAR or TCR), the immune cells are first activated and stimulated to proliferate in vitro, possibly with an inhibitor of NR2F6 and optionally CBLB (e.g., a small molecule inhibitor, a CRISPR-Cas system, or an RNAi system). In this regard, the immune cells can be cultured before and / or after genetic modification.
[0100] In certain embodiments, the cells are derived from a subject prior to modification of the immune effector cells described herein. In certain embodiments, the modified immune effector cells comprise T cells. T cells can be obtained from a variety of sources, including but not limited to peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In some embodiments, T cells can be generated using any number of techniques known to those skilled in the art, such as sedimentation methods (e.g., FICOLL). TM Separation), based on antibody-conjugated magnetic beads (e.g., MACS). TM Cells obtained from a blood sample collected from a subject are obtained via apheresis. In one embodiment, cells from an individual's circulating blood are obtained via apheresis. Apheresis products typically contain lymphocytes (including T cells), monocytes, granulocytes, B cells, other nucleated leukocytes, erythrocytes, and platelets. In one embodiment, cells collected via apheresis can be washed to remove plasma fractions and placed in a suitable buffer or culture medium for subsequent processing. Cells can be washed with PBS or another suitable solution free of calcium, magnesium, and most (if not all) other divalent cations. Those skilled in the art will understand that the washing step can be performed by methods known to those skilled in the art, such as using a semi-automatic flow-through centrifuge, for example, the Cobe 2991 cell processor, Baxter CytoMate, etc. After washing, cells can be resuspended in various biocompatible buffers or other saline solutions with or without buffers. In some embodiments, unwanted components of the apheresis sample can be removed in the culture medium in which the cells are directly resuspended.
[0101] In some implementations, this is achieved by lysing red blood cells and depleting monocytes (e.g., via PERCOLL). TM Gradient centrifugation was used to isolate T cells from peripheral blood mononuclear cells (PBMCs). Specific T cell subsets can be further isolated using positive or negative selection techniques. One method used in this paper involves cell sorting and / or selection via negative magnetic immunoadhesion or flow cytometry (which uses a mixture of monoclonal antibodies against cell surface markers present on negatively selected cells).
[0102] PBMCs can be directly genetically modified using the methods envisioned herein to express transgenic constructs targeting antigens expressed in tumor cells of solid tumors. In some embodiments, T lymphocytes are further isolated after PBMC isolation, and in some embodiments, both cytotoxic T lymphocytes and helper T lymphocytes can be sorted into naive T cell subsets, memory T cell subsets, and effector T cell subsets before or after gene modification and / or amplification. CD8 + Cells can be obtained using standard methods. In some implementations, they are obtained by identifying cells with these types of CD8. + Each relevant cell surface antigen in the cell will cause CD8 to... + The cells were further sorted into initial cells, central memory cells, and effector cells.
[0103] In some embodiments, the immune cells of the present invention, such as the T cells described herein, can be obtained from induced pluripotent stem cells (iPSCs) using methods known to those skilled in the art.
[0104] Acceptable methods for producing modified cells (e.g., modified cells expressing a CAR) rely on the genetic modification and expansion of mature circulating T cells. Such methods utilize autologous T cells and reduce the risk of graft-versus-host disease (GvHD) from allogeneic T cells through endogenous TCR expression and rejection by MHC incompatibility. Alternatively, direct in vitro differentiation of engineered T cells with pluripotent stem cells (such as induced pluripotent stem cells) provides a virtually unlimited source of cells that can be genetically modified to express the CAR of the present invention. In some embodiments, a so-called master iPSC cell line can be maintained, representing a renewable energy source for the continuous and repetitive production of homogeneous cell products. In some embodiments, it is anticipated that the master iPSC cell line be transformed with nucleic acids encoding the CAR before expansion and differentiation into the desired immune cells (preferably T cells or NK cells). T lymphocytes can be generated, for example, from iPSCs, such that the iPSCs can be modified with transgenic constructs encoding nucleic acids and subsequently expanded and differentiated into T cells for administration to patients. iPSCs can also be differentiated into appropriate immune cells, such as T cells, prior to transformation with a transgenic construct encoding nucleic acid and amplification before administration. All possible combinations of iPSC amplification, genetic modification, and expansion are considered in this invention to provide a suitable number of cells for administration.
[0105] Immune effector cells, such as T cells, NK cells, or CIK cells, can be genetically modified after isolation using known methods, or immune effector cells can be activated and expanded in vitro (or differentiated in the case of progenitor cells) before genetic modification.
[0106] T cells can be genetically modified after isolation using known methods, or T cells can be activated and expanded in vitro (or differentiated in the case of progenitor cells) prior to genetic modification. In a specific embodiment, T cells are genetically modified with transgenic constructs contemplated herein (e.g., transduced with a viral vector containing nucleic acid encoding a CAR), and then activated and expanded in vitro. In various embodiments, T cells can be activated and expanded before or after the gene-modified expression of the transgenic construct, using methods described below, such as U.S. Patents 6,352,694, 6,534,055, 6,905,680, 6,692,964, 5,858,358, 6,887,466, 6,905,681, 7,144,575, 7,067,318, 7,172,869, 7,232,566, 7,175,843, 5,883,223, 6,905,874, 6,797,514, 6,867,041, and U.S. Patent Application Publication No. 2006 / 0121005. In another implementation, a mixture of, for example, one, two, three, four, five or more different expression vectors can be used to genetically modify a population of T-cell donors, wherein each vector encodes a different antigen-targeting construct.
[0107] In one embodiment, the present invention provides a method for storing genetically modified immune cells exhibiting NR2F6 and optional CBLB suppression, comprising cryopreserving the immune cells such that the cells remain viable upon thawing. A subset of immune effector cells can be cryopreserved using methods known in the art to provide a permanent source of such cells for future treatment of patients with a treatable condition. When needed, the cryopreserved cells can be thawed, grown, and expanded to obtain more of these cells.
[0108] NR2F6 and its role in cell exhaustion
[0109] Nuclear receptor subfamily 2F member 6 (also known as NR2F6, Ear2, or V-erbA-associated protein 2) is an intracellularly expressed nuclear receptor that has been characterized as an intracellular immune checkpoint in immune cells such as effector T cells, potentially controlling tumor development and growth. Mechanistically, NR2F6 acts as a negatively regulated signaling intermediate “downstream” of antigen receptors, determining the threshold for TCR / CD28 activation-induced effector function by acting as a transcriptional repressor to antagonize the DNA accessibility of activation-induced NFAT / AP-1 transcription factors at cytokine loci.
[0110] Casitas B-cell lymphoma proto-oncogene-b (CBLB) is a ubiquitin ligase and an intracellular checkpoint that negatively regulates T cell activation. CBLB expression in T cells leads to ligand-induced downregulation of T cell receptors, controlling the degree of T cell activation during antigen presentation.
[0111] The tumor immune microenvironment (TIME) is the environment within a tumor, encompassing tumor cells, surrounding blood vessels, immune cells, fibroblasts, signaling molecules, and the tumor extracellular matrix (ECM). Tumors can influence the microenvironment by releasing extracellular signals, promoting tumor angiogenesis, and inducing peripheral immune tolerance, while immune cells within the microenvironment can influence the growth and evolution of cancer cells. Immune cells infiltrate the tumor microenvironment, interact with each other and with tumor cells, and then exhibit an immunosuppressive phenotype, which is the cause of immune escape by tumor cells and subsequent tumor progression. These immunosuppressive cells include MDSCs, M2-macrophages, Tregs, N2-TANs, mast cells, Bregs, and dendritic cells. They secrete cytokines such as IL-2, IL-10, and TGF-β, growth factors such as VEGF, checkpoint ligands such as PD-L1, or express checkpoints such as PD-1 on the cell surface, and TIM-3 on Tregs, which negatively regulate anti-tumor immune responses, remodel the extracellular matrix, and promote angiogenesis. Therefore, these immunosuppressive cells and their interactions create the immunosuppressive microenvironment (TIME) and promote the proliferation, escape, and migration of tumor cells. Furthermore, chronic stimulation (also known as continuous stimulation) of effector immune cells (such as CD8+ T cells) by tumor antigens present within the TIME leads to the depletion of these cells. TIME-depleted immune cells are characterized by increased expression of multiple co-inhibitory receptors (such as NR2F6), loss of effector function, poor proliferation and self-renewal capacity, and dysregulation of metabolic activity. In embodiments of the modified immune cells of the present invention, NR2F6 and optionally CBLB are inhibited, exhibiting resistance to and / or reduced sensitivity to TIME depletion and / or inhibition. Therefore, these cells do not, or do not completely, lose their effector functions against solid tumors, such as their cytolytic activity.
[0112] The term "secondary immune response" refers to an immune response induced by immune cell death (ICD), such as the killing of tumor cells by the immune cells of this invention. During cancer cell death via ICD, the release of DAMP ("damage-associated molecular pattern," a molecular structure that appears during cell damage), chemokines, and cytokines is induced, which is associated with the processing, presentation, and release of intracellular and extracellular tumor antigens from the killed cancer cells, attracting antigen-presenting cells, such as dendritic cells (DCs). After phagocytosis by DCs (called effector cells), they migrate to lymph nodes, where they present processed tumor antigens to NK cells and T lymphocytes. Lymphocytes are prepared and activated during cross-presentation, in conjunction with the action of co-stimulatory factors. The now activated and tumor antigen-specific T cells then proliferate and migrate to the tumor, where they recognize tumor cells via antigenic epitopes and induce their killing. Thus, tumor-specific effector CD8... + T cells are recruited into the tumor microenvironment to maintain T cell-mediated polyclonal immune responses (epitope diffusion) against a variety of cancer antigens.
[0113] As used herein, the term "epitope diffusion" has its common meaning in the art. For example, epitope diffusion is the development of an immune response following the release of an endogenous epitope containing an autoantigen during an immune response. For example, epitope diffusion is based on the release of non-autotumor antigens during immunogenic cell death (ICD) of tumor cells, induced by an initial effective antitumor immune response, triggering a secondary immune response (i.e., a secondary immune response to a tumor epitope). In other words, the term epitope diffusion refers to the expansion and diversification of tumor epitope specificity following an initial concentrated epitope-specific immune response (i.e., here, therapeutic adoptive transfer using, for example, tumor antigen-specific CARs or TCR-encoded T cells as described in this invention, to kill tumor cells with tumor antigen-specific immune cells).
[0114] For example, following the primary antigen-specific immune response (triggered by adoptive transfer of tumor antigen-specific CAR or TCR-encoded T cells), a secondary immune response, preferably based on epitope diffusion, involves the extension of the immune response to other antigens released by the primary immune response. These other antigens are unique to tumor cells and are not expressed, or are expressed at least poorly or negligibly, on normal cells. Such tumor antigens presented to the endogenous immune system include neotumor antigens and tumor-associated antigens produced and / or upregulated by tumor cells due to various tumor-specific alterations.
[0115] For example, following a primary tumor antigen-specific immune response (e.g., CAR-T by promoting ICDs in tumor cells), other tumor antigens (now advantageously expressed on the surface or intracellularly in tumor cells) are exposed to the endogenous immune system, preferably involving epitope diffusion to promote endogenous T cell activation. This polyclonal immune response involves extending the immune response to non-autologous tumor epitopes in a secondary memory immune response against multiple tumor antigens that is unknown to the inventors. Essentially, to the best of the inventors' knowledge within the scope of this invention, this is the first time that an adoptive immunotherapy, such as CAR-T (designed to target only a small number and strictly defined tumor surface antigens), has been able to overcome the limitations of prior heterogeneity of tumor antigens, thereby promoting rejection of CAR-targeted antigen-negative tumors, which are common in antigenically heterogeneous solid tumors, such as NSCLC.
[0116] The principle of this ICD-induced secondary immune response is disclosed, for example, in WO 2014 / 011993. Methods for determining the ICD-induced secondary immune response, such as the modified immune cells of this invention, can be derived from that document and are further disclosed in the following figures and examples (see...). Figures 7-12 These examples clearly demonstrate in mouse models that, in immune-active mouse models alone, inhibition of NR2F6 in the immune cells of the present invention leads to the induction of a secondary immune response against solid tumors (see [link to relevant documentation]). Figure 8 ).
[0117] Antigen targeting constructs:
[0118] As used herein, the terms “antigen-targeting construct,” “targeting construct,” or “transgenic construct targeting an antigen” refer to a transgenic molecule (encoded by a foreign nucleic acid molecule) that can guide immune cells (e.g., T cells) to a specific antigen or group of antigens (e.g., an antigen expressed in cancer cells of a solid tumor).
[0119] Therefore, antigen-targeting constructs are preferably chimeric antigen receptors (CARs) or T-cell receptors (TCRs). Engineered immune cells have become a new stage in precision cancer therapy. Through the forced expression of these antigen-targeting molecules on preferred autologous or donor immune cells, they lead to the specific recognition of tumor antigens and enhance therapeutic specificity and efficacy.
[0120] Chimeric antigen receptors:
[0121] According to the present invention, a chimeric antigen receptor polypeptide (CAR) comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the extracellular antigen-binding domain contains an antibody or antibody fragment that binds to a target antigen. CARs are generally described as comprising an extracellular domain (antigen-binding domain) derived from an antibody and an intracellular domain comprising a signal transduction module derived from a T-cell signaling protein.
[0122] In a preferred embodiment, the extracellular domain preferably comprises variable regions derived from the heavy and light chains of immunoglobulins, configured as single-chain variable fragments (scFvs). The scFvs are preferably linked to a hinge region that provides flexibility and transduces signals to the intracellular signal transduction domain by anchoring the transmembrane portion. The transmembrane domain is preferably derived from CD8α or CD28. In first-generation CARs, the signal transduction domain consists of the CD3ζ chain of the TCR complex. The term "generation" refers to the structure of the intracellular signal transduction domain. Second-generation CARs are equipped with a single co-stimulatory domain derived from CD28 or 4-1BB. Third-generation CARs have included two co-stimulatory domains, such as CD28, 4-1BB, ICOS or OX40, and CD3ζ. The present invention preferably relates to second- or third-generation CARs.
[0123] In various embodiments, genetically engineered receptors are provided that redirect the cytotoxicity of immune effector cells to cancer cells of solid tumors. These genetically engineered receptors are referred to herein as chimeric antigen receptors (CARs). A CAR is a molecule that combines antibody-based specificity to a desired antigen with an intracellular domain that activates a T-cell receptor to produce a chimeric protein that exhibits antigen-specific cellular immune activity. As used herein, the term "chimera" describes a composition consisting of different proteins or portions of DNA from different sources.
[0124] The CARs described herein comprise an extracellular domain (also known as a binding domain or antigen-binding domain) that binds to the target antigen, a transmembrane domain, and an intracellular domain or intracellular signaling domain. The binding of the antigen-binding domain of the CAR to the surface of the target cell leads to CAR aggregation and delivery of activating stimuli to the CAR-containing cell. A key characteristic of CARs is their ability to redirect immune effector cells specifically, thereby triggering proliferation, cytokine production, phagocytosis, or the production of molecules capable of cell-mediated target antigen expression and cell death in a manner independent of the major histocompatibility complex (MHC), utilizing the cell-specific targeting capabilities of monoclonal antibodies, soluble ligands, or cell-specific co-receptors.
[0125] In various embodiments, the CAR includes an extracellular binding domain comprising a humanized antigen-specific binding domain; a transmembrane domain; and one or more intracellular signaling domains. In a particular embodiment, the CAR includes: an extracellular binding domain comprising its antigen-binding fragment; one or more spacer domains; a transmembrane domain; and one or more intracellular signaling domains.
[0126] The terms "extracellular antigen-binding domain" and "extracellular binding domain" are used interchangeably and provide the CAR with the ability to specifically bind to the target antigen. The binding domain can be derived from natural, synthetic, semi-synthetic, or recombinant sources. The scFv domain is preferred.
[0127] "Specific binding" should be understood by those skilled in the art, who will clearly understand the various experimental procedures that can be used to test binding and binding specificity. Methods for determining the equilibrium association constant or equilibrium dissociation constant are known in the art. In many protein-protein interactions, some cross-reactions or background binding may be unavoidable; this does not reduce the "specificity" of the binding between the CAR and the epitope. "Specific binding" describes the binding of an antibody or its antigen-binding fragment (or a CAR containing it) to the target antigen with a greater binding affinity than background binding. The term "targeting" also applies when considering the term "specificity" to understand the interaction between the antibody and the epitope.
[0128] "Antigen (Ag)" refers to a compound, composition, or substance that can stimulate antibody production or a T-cell response in an animal. In a particular embodiment, the target antigen is an epitope of the desired polypeptide. "Epitope" refers to an antigenic region to which a binder binds. Epitopes can be formed from consecutive amino acids or from non-adjacent amino acids arranged side-by-side through the tertiary folding of a protein.
[0129] Tumor-associated antigens targeted by transgenic constructs (such as CAR or TCR constructs) include, but are not limited to, GPC3, HER2, GD2, EGFR variant III (EGFR vIII), EGFR, EGFR806, CEA, PSMA, FRα, EPCAM, MUC1, ROR1, MUCI16eto, VEGFR2, CD171, PSCA, EphA2, FAP, CAIX, c-MET, L1-CAM, mesothelin, PD-L1, WT1, NY-ESO-1, MAGE-A1 / 3 / 4, Claudin 18.2, VEGFR2, AFP, Nectin4 / FAP, Lewis... Y, Phosphatidylinositol proteoglycan-3, MUC16, AFP, AXL, CD20, CD80 / 86, DLL-3, DR5, EpHA2, FR-α, gp100, LMP-1, NKG2D, GUCY2C, TA-72, CD46, ANTXR1, MUC3A, Trop2, αvβ6, CD47, GSPG4, Phosphatidylinositol proteoglycan 2, B7-H3, PSA, PAP, Mage-A1, CD32A, ROR, C133, OXO40, CLDN6, and IL13Rα2.
[0130] The term "non-autoantigen" or "non-autotumor antigen" refers to an antigen expressed by tumor cells (intracellular or extracellular) that is absent or present only in negligible amounts in non-cancer cells. Examples of "non-autotumor antigens" (also known as neoantigens) include, but are not limited to: mesothelin (MSLN), carcinoembryonic antigen (CEA), receptor tyrosine kinase-like orphan receptor 1 (ROR1), epidermal growth factor receptor variant III (EGFRvIII), B7 homology 3 protein (B7-H3, also known as CD276), mucin 1 (MUC1), tumor necrosis factor receptor superfamily member 4 (TNFRSF4, also known as CD134 or OXO40), Claudin 6 (CLDN6), and carcinoembryonic chondroitin sulfate (ofCS).
[0131] A "single-chain Fv" or "scFv" antibody fragment contains the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain and are in either orientation (e.g., VL-VH or VH-VL). Typically, the scFv polypeptide also contains a polypeptide linker between the VH and VL domains, which enables the scFv to form the structure required for antigen binding. In a preferred embodiment, the CAR considered herein contains an antigen-specific binding domain, which is an scFv and can be murine, human, or humanized scFv. The single-chain antibody can be cloned from the V region gene of a hybridoma targeting the desired target. The scFv can also be obtained from a phage display library, thereby bypassing conventional hybridoma techniques. In a particular embodiment, the antigen-specific binding domain is a humanized scFv that binds a human target antigen polypeptide.
[0132] Antibodies and antibody fragments:
[0133] Typically, a CAR contains an extracellular antigen-binding domain that includes an antibody or antibody fragment that binds to a target polypeptide. Therefore, the antibodies or antibody fragments of the present invention include, but are not limited to: polyclonal antibodies, monoclonal antibodies, bispecific antibodies, human antibodies, humanized antibodies or chimeric antibodies, single-chain fragments (scFv), single variable fragments (ssFv), single-domain antibodies (e.g., VHH fragments from nanobodies), Fab fragments, F(ab')2 fragments, fragments generated from Fab expression libraries, anti-idiotypic antibodies and epitope-binding fragments, or any combination thereof, provided that they retain similar binding properties to the CARs described herein, preferably containing the corresponding CDR or VH and VL regions as described herein. Microantibodies and multivalent antibodies, such as bivalent, trivalent, tetravalent, and peptide antibodies, can also be used in the methods of the present invention. The immunoglobulin molecules of the present invention can be any class (i.e., IgG, IgE, IgM, IgD, and IgA) or subclass of immunoglobulin molecules. Therefore, as used herein, the term antibody also includes antibodies and antibody fragments contained in the CAR of the present invention, which are generated by modifying a complete antibody or synthesized de novo using a recombinant DNA method.
[0134] As used herein, "antibody" generally refers to a protein composed of one or more polypeptides encoded essentially by immunoglobulin genes or segments of immunoglobulin genes. The term "antibody" can also be understood as referring to "antibody fragment." Recognized immunoglobulin genes include κ, λ, α, γ, δ, ε, and μ constant region genes, as well as numerous immunoglobulin variable region genes. Light chains are classified as κ or λ. Heavy chains are classified as γ, μ, α, δ, or ε, which in turn define the immunoglobulin classes IgG, IgM, IgA, IgD, and IgE, respectively. The basic immunoglobulin (antibody) structural unit is known to consist of a tetramer or dimer. Each tetramer consists of two pairs of identical polypeptide chains, each pair having a "light" chain (L) (approximately 25 kDa) and a "heavy" (H) chain (approximately 50–70 kDa). The N-terminus of each chain defines a variable region of approximately 100 to 110 or more amino acids, primarily responsible for antigen recognition. The terms "variable light chain" and "variable heavy chain" refer to these variable regions of the light and heavy chains, respectively. Optionally, the antibody or the immune portion of an antibody may be chemically coupled to or expressed as a fusion protein with other proteins.
[0135] The CAR of this invention is designed to bind to protein targets in mammals (particularly humans). The use of protein names may correspond to the protein forms in mice or humans.
[0136] The affinity of the binding domain peptide and the CAR protein according to this disclosure can be readily determined using conventional techniques, such as by competitive ELISA (enzyme-linked immunosorbent assay), or by binding association, or by displacement assay using labeled ligands, or by surface plasmon resonance devices such as Biacore.
[0137] Humanized antibodies comprising one or more CDRs of the antibodies of the present invention, or derived from one or more CDRs of said antibodies, can be prepared using any method known in the art. For example, humanized monoclonal antibodies can be obtained using four conventional steps. These steps are: (1) determining the nucleotide and predicted amino acid sequences of the variable domains of the light and heavy chains of the starting antibody, (2) designing the humanized antibody, i.e., deciding which antibody framework region to use in the humanization process, (3) the actual humanization method / technique, and (4) transfection and expression of the humanized antibody. See, for example, U.S. Patent Nos. 4,816,567, 5,807,715, 5,866,692, 6,331,415, 5,530,101, 5,693,761, 5,693,762, 5,585,089, 6,180,370, 5,225,539, and 6,548,640.
[0138] The term humanized antibody refers to at least a portion of the framework region of an immunoglobulin, and optionally a portion of the CDR region or other binding regions, derived from or modified to a human immunoglobulin sequence. Humanized, chimeric, or partially humanized forms of mouse monoclonal antibodies can be prepared, for example, by recombinant DNA technology, from mouse and / or human genomic DNA sequences encoding the H and L chains, or from cDNA clones encoding the H and L chains. Humanized mouse antibodies can be generated by linking the CDR region of a non-human antibody to a human constant region using recombinant DNA technology (Queen et al., 1989; WO 90 / 07861). Alternatively, the monoclonal antibody used in the methods of this invention can be a human monoclonal antibody. For example, human antibodies can be obtained using phage display methods (WO 91 / 17271; WO 92 / 01047).
[0139] As used herein, humanized antibodies also refer to non-human (e.g., mouse, camel, alpaca, shark) antibodies that are specifically chimeric immunoglobulins, immunoglobulin chains or fragments thereof (e.g., Fv, Fab, Fab', F(ab')2 or other antigen-binding sequences of antibodies) containing minimal sequences derived from non-human immunoglobulins.
[0140] As used herein, a human or humanized antibody or antibody fragment refers to an antibody having an amino acid sequence corresponding to the amino acid sequence of an antibody produced by a human, and / or an antibody prepared using any technique known in the art or disclosed herein for the preparation of human antibodies. Human antibodies or fragments thereof can be screened by competitive binding assays or otherwise to have the same epitope specificity as a particular mouse antibody. The humanized antibodies of the present invention surprisingly possess largely similar useful functional properties to mouse antibodies. Human polyclonal antibodies can also be provided in the form of human serum immunized with an immunogenic reagent. Optionally, such polyclonal antibodies can be concentrated by affinity purification using amyloid fibrillary and / or non-fibrillary polypeptides or fragments thereof as affinity reagents. Monoclonal antibodies can be obtained from serum according to the techniques described in WO 99 / 60846.
[0141] Variable regions and CDRs
[0142] The variable region of an antibody refers to the variable region of the antibody light chain, either alone or in combination, or the variable region of the antibody heavy chain. The variable regions of both the heavy and light chains are each composed of four frame regions (FRs) connected by three complementarity-determining regions (CDRs) (also known as hypervariable regions). The CDRs in each chain are held closely together by the FRs and, together with CDRs from the other chain, contribute to the formation of the antibody's antigen-binding site.
[0143] Many techniques are available for determining CDRs, such as those based on cross-species sequence variability (i.e., Kabat et al., Immunology-Related Protein Sequences, (5th ed., 1991, National Institutes of Health, Bethesda Md.)); and those based on antigen-antibody complex crystallographic studies (Al-Lazikani et al., (1997) J. Molec. Biol. 273:927-948). Alternative methods include the IMGT International Immunogenetic Information System (Marie-Paule Lefranc). The Kabat definition, based on sequence variability, is the most commonly used method. The Chothia definition is based on the location of structural loop regions, while the AbM definition is a compromise between the two used by Oxford Molecular's AbM antibody modeling software (see www.bioinf.org.uk: Dr. Andrew C. Martin's team). As used herein, a CDR can refer to a CDR defined by one or more methods or a combination of these methods.
[0144] Additional components of CARs
[0145] In some embodiments, the CAR may include linker residues between various domains, adding appropriate spacers and conformations for the molecule. For example, the linker may include an amino acid sequence connecting the VH and VL domains and provide a spacer region function compatible with the interaction of the two sub-binding domains, such that the resulting peptide maintains specific binding affinity to the same target molecule with antibodies containing the same light and heavy chain variable regions. The CARs considered herein may contain one, two, three, four, or five or more linkers. In certain embodiments, the linker length is about 1 to about 25 amino acids, about 5 to about 20 amino acids, or about 10 to about 20 amino acids, or any intermediate length of amino acids.
[0146] Illustrative examples of linkers include glycine polymers; glycine-serine polymers; glycine-alanine polymers; alanine-serine polymers; and other flexible linkers known in the art, such as the Whitlow linker. Glycine and glycine-serine polymers are relatively unstructured and can therefore serve as neutral linkers between the domains of fusion proteins such as the CAR described herein.
[0147] In certain embodiments, the CAR binding domain is followed by one or more "spacer regions" or "spacer peptides," which refer to regions that remove the antigen-binding domain from the effector cell surface to achieve proper cell / cell contact, antigen binding, and activation. In some embodiments, the spacer region domain is part of an immunoglobulin, including but not limited to one or more heavy chain constant regions, such as CH2 and CH3. The spacer region may include the amino acid sequence of a naturally occurring immunoglobulin hinge region or a modified immunoglobulin hinge region. In one embodiment, the spacer region domain comprises the CH2 and CH3 domains of IgG1 or IgG4. In one embodiment, the Fc binding domain of this spacer / hinge region is mutated to prevent the CAR from binding to Fc receptors expressed on macrophages and other innate immune cells.
[0148] In some embodiments, the CAR may be followed by one or more "hinge domains" that position the antigen-binding domain away from the effector cell surface to achieve proper cell / cell contact, antigen binding, and activation. The CAR may include one or more hinge domains between the binding domain and the transmembrane domain (TM). The hinge domain may be derived from natural, synthetic, semi-synthetic, or recombinant sources. The hinge domain may include the amino acid sequence of a naturally occurring immunoglobulin hinge region or a modified immunoglobulin hinge region. Exemplary hinge domains used in the CAR described herein include hinge regions derived from the extracellular regions of type 1 membrane proteins (e.g., CD8α, CD4, CD28, PD1, CD152, and CD7), which may be wild-type hinge regions from these molecules or may be modified. In another embodiment, the hinge domain includes a PD1, CD152, or CD8α hinge region.
[0149] The "transmembrane domain" is the portion of the CAR that fuses the extracellular binding portion and the intracellular signal transduction domain, anchoring the CAR to the plasma membrane of immune effector cells. The TM domain can be derived from natural, synthetic, semi-synthetic, or recombinant sources. The TM domain can be derived from the α, β, or ζ chain of the T cell receptor, CD3ε, CD3ζ, CD4, CD5, CD8α, CD9, CD16, CD22, CD27, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD152, CD154, and PD1. In one embodiment, the CAR considered herein includes a TM domain derived from CD8α or CD28.
[0150] In certain embodiments, the CARs considered herein include intracellular signaling domains. An “intracellular signaling domain” refers to a portion of the CAR involved in transducing information about the effective binding of a human target peptide into the interior of immune effector cells to trigger effector cell functions (e.g., activation, cytokine production, proliferation, and cytotoxic activity, including the release of cytotoxic factors to CAR-bound target cells, or other cellular responses triggered by the binding of antigens to extracellular CAR domains). The term “effective function” refers to a specific function of an immune effector cell. The effector function of a T cell may, for example, be cytolytic activity or activity that aids in or includes the secretion of cytokines. Therefore, the term “intracellular signaling domain” refers to a protein portion that transduces effector function signals and directs the cell to perform a specific function. The CARs considered herein include one or more co-stimulatory signaling domains to enhance the therapeutic efficacy, expansion, and / or memory formation of T cells expressing the CAR receptor. As used herein, the term “co-stimulatory signaling domain” refers to the intracellular signaling domain of a co-stimulatory molecule. Co-stimulatory molecules are cell surface molecules other than antigen receptors or Fc receptors that provide a second signal required for the effective activation and functioning of T lymphocytes when they bind to antigens.
[0151] In one embodiment, the CAR includes an intracellular domain comprising a co-stimulatory domain and a signal transduction (activation) domain. Thus, the CAR construct may include an intracellular signal transduction domain (CD3ζ) of the native T cell receptor complex and one or more co-stimulatory domains that provide a second signal to stimulate full T cell activation. The co-stimulatory domain is thought to increase CAR-T cell cytokine production and promote T cell replication and T cell persistence. The co-stimulatory domain has also been shown to potentially prevent CAR-T cell exhaustion, increase T cell antitumor activity, and enhance CAR-T cell survival in patients. As a non-limiting example, in preclinical studies, CAR constructs with a 4-1BB co-stimulatory domain have been associated with progressive, sustained expansion and effector function, increased persistence, and enrichment of central memory cells (TCMs) in T cell subset compositions. 4-1BB is a member of the tumor necrosis factor (TNF) superfamily and is an in vivo inducible glycoprotein receptor, primarily on antigen-activated CD4 and CD8. + Expressed on T cells. As a non-restrictive example, CD28 is a member of the immunoglobulin (Ig) superfamily. It is expressed on resting and activated CD4+ cells. + and CD8 + Constitutively expressed on T cells, it plays a key role in T cell activation by stimulating the PI3K-AKT signaling pathway. In one embodiment, the intracellular domain includes a 4-1BB and CD28 co-stimulatory domain. Other co-stimulatory domains include ICOS and OX40, which can be combined with the CD3ζ signaling (activation) domain.
[0152] T receptors:
[0153] T cell receptors, or TCRs, are molecules typically found on the surface of T cells or T lymphocytes that recognize peptide fragments of antigens that bind to the major histocompatibility complex (MHC) molecule. The TCR consists of two distinct protein chains. In humans, in 95% of T cells, the TCR is composed of an α chain and a β chain (encoded by TRA and TRB, respectively), while in 5% of T cells, it is composed of a γ chain and a δ chain (encoded by TRG and TRD, respectively). Each chain consists of two extracellular domains: a variable (V) region and a constant (C) region, with two immunoglobulin superfamily (IgSF) domains forming an antiparallel β-sheet. The constant region is located close to the cell membrane, followed by a transmembrane region and a short cytoplasmic tail, while the variable region binds to the peptide / MHC complex.
[0154] The variable domains of the TCR α and β chains each have three hypervariable regions, or complementarity-determining regions (CDRs). The β chain (HV4), which does not normally contact the antigen, has additional highly variable regions and is therefore not considered CDRs.
[0155] The residues in these variable domains are located in two regions of the TCR: at the interface between the α and β chains, and in the β-chain framework region, which is thought to be close to the CD3 signaling complex. CDR3 is the major CDR responsible for recognizing processed antigens, although CDR1 of the α chain also shows interaction with the N-terminal portion of the antigenic peptide, while CDR1 of the β chain interacts with the C-terminal portion of the peptide.
[0156] Recombinant TCRs have previously been transfected into therapeutic T cells intended for the treatment of proliferative diseases. For example, TCR-T cells are engineered by transducing preferred autologous α-β or γ-δ cells using retroviral or lentiviral vectors that encode a TCR (typically an α-chain non-covalently bound to the β-chain) that recognizes a target peptide and the CD3z gene. When engineered T cells recognize a peptide that binds to the major histocompatibility complex (MHC) on the surface of antigen-presenting or tumor cells, they are activated and begin to proliferate. The first TCR-T cell therapy used in a clinical trial for metastatic melanoma involved a TCR that recognizes an HLA-A2-restricted peptide derived from melanocyte differentiation antigen (a melanoma antigen recognized by T cell 1 (MART-1)).
[0157] Polypeptides
[0158] Unless otherwise stated, “peptide,” “polypeptide,” “polypeptide fragment,” and “protein” are used interchangeably and, by their conventional meaning, refer to an amino acid sequence. Polypeptides are not limited to a specific length; for example, they may comprise a full-length protein sequence or a fragment of a full-length protein, and may include post-translational modifications of the polypeptide, such as glycosylation, acetylation, phosphorylation, etc., as well as other modifications known in the art, both naturally occurring and non-natural.
[0159] In various embodiments, the CAR peptides considered herein contain a signal (or leader) sequence at the N-terminus of the protein, which co-translates or post-translations the protein transfer. The peptides can be prepared using any of a variety of well-known recombinant and / or synthetic techniques. The peptides considered herein specifically encompass the CARs of this disclosure, or sequences having one or more amino acid deletions, additions, and / or substitutions as disclosed herein.
[0160] As used herein, "isolated peptide" or "isolated polypeptide" refers to peptide or polypeptide molecules that have been isolated and / or purified in vitro from the cellular environment and associated with other components of the cell, i.e., they do not significantly associate with substances in vivo. Similarly, "isolated cell" refers to a cell that has been obtained from an in vivo tissue or organ and is substantially free of extracellular matrix.
[0161] Nucleic acids
[0162] As used herein, the terms "polynucleotide" or "nucleic acid molecule" refer to, but are not limited to, nucleic acids such as ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or any analogues or structural modifications thereof, including but not limited to DNA, messenger RNA (mRNA), RNA, genomic RNA (gRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), microRNA (miRNA), small interfering RNA (siRNA), single-guide RNA (sgRNA), short hairpin RNA (shRNA), piwi-interacting RNA (piRNA), small nuclear RNA (snRNA), positive-strand RNA (RNA(+)), negative-strand RNA (RNA(-)), genomic DNA (gDNA), complementary DNA (cDNA), antisense oligonucleotides (ASO), recombinant polynucleotides, branched polynucleotides, plasmids, nucleic acid probes, and primers. Polynucleotides include single-stranded and double-stranded polynucleotides. Preferably, the polynucleotides of the present invention comprise polynucleotides or variants having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any reference sequence described herein, typically wherein the variants maintain at least one biological activity of the reference sequence. In various illustrative embodiments, the present invention is partly contemplated as comprising polynucleotides containing expression vectors, viral vectors, and transfer plasmids, as well as compositions and cells containing them.
[0163] Polynucleotides can be prepared, manipulated, and / or expressed using any of a variety of well-known and available techniques in the art. To express the desired polypeptide, the nucleotide sequence encoding the polypeptide can be inserted into a suitable vector. Examples of vectors are plasmids, autonomously replicating sequences, and transposable elements. Other exemplary vectors include, but are not limited to, plasmids, phage particles, granules, artificial chromosomes (such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC)), bacteriophages (such as λ phage or Ml 3 phage), and animal viruses. Examples of animal virus classes that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and multivoid papillomaviruses (e.g., SV40). Examples of expression vectors are the pClneo vector (Promega) for expression in mammalian cells; and pLenti4 / V5-DEST™, pLenti6 / V5-DEST™, and pLenti6.2 / V5-GW / lacZ (Invitrogen) for lentivirus-mediated gene transfer and expression in mammalian cells. In certain embodiments, the coding sequences of the chimeric proteins disclosed herein can be ligated into such expression vectors for expression of the chimeric proteins in mammalian cells. The “control elements” or “regulatory sequences” present in the expression vector are those untranslated regions of the vector: origin of replication, selection cassette, promoter, enhancer, translation initiation signal (ShineDalgarno sequence or Kozak sequence) intron, polyadenylated sequences, and 5' and 3' untranslated regions, which interact with host cell proteins for transcription and translation. The strength and specificity of such elements can vary. Depending on the vector system and host used, any number of suitable transcription and translation elements can be used, including ubiquitous promoters and inducible promoters.
[0164] "Exogenous nucleic acid," "exogenous genetic element," or "transgenic" nucleic acid or construct refers to any nucleic acid introduced into a cell that is not part of the cell's "original" or "natural" genome or nucleic acid pool, which is "naturally" found in unmodified T cells. Exogenous nucleic acids may or may not be integrated into the genetic material of the target T cell, or may involve stably transduced nucleic acids. Delivery of exogenous nucleic acids can lead to genetic modification of the initial cell through permanent integration of the exogenous nucleic acid molecule into the initial cell. However, delivery of exogenous nucleic acids can also be transient, meaning that the genetic material used to deliver one or more TFs disappears from the cell after a period of time. The delivery of nucleic acid molecules and potential genetic modifications in biological cells (i.e., T cells) can be performed and determined by technicians using common techniques. For example, sequencing the genome of a cell or a portion thereof can be used to detect gene modification sequencing, thereby identifying the presence of exogenous nucleic acids. Alternatively, other molecular biotechnologies, such as polymerase chain reaction (PCR), can be applied to identify / amplify exogenous genetic material. Exogenous nucleic acids can be detected by vector sequences or portions of vector sequences, such as those retained at gene modification sites. Vector sequences (e.g., vector sequences flanking therapeutic transgenes) can be removed from the genome or are not retained after modification, such as by CRISPR technology. The addition of transgenes can still be detected by sequencing work by sequencing at “non-natural” locations in the genome containing foreign sequences.
[0165] Embodiments of the present invention relate to genetically modified immune cells comprising one or more exogenous nucleic acid molecules encoding a transgenic antigen-targeting construct. In embodiments of the invention, the exogenous nucleic acid represents a nucleic acid sequence not naturally found in immune cells, based, for example, a comparison with an unmodified human genome sequence. In embodiments of the invention, the transgenic antigen-targeting construct is a nucleic acid sequence encoding an antigen-targeting construct whose encoding sequence is not naturally present in immune cells, based, for example, a comparison with an unmodified human genome sequence. In some embodiments, the sequence is located at a “non-natural location” in the genome. In some embodiments, the targeting construct comprises or is composed of a non-naturally present sequence, i.e., a synthetic sequence designed and generated using recombinant or other molecular biology techniques. According to the invention, NR2F6 and optionally CBLB activity are inhibited (compared to control immune cells).
[0166] Inhibition of NR2F6 and CBLB
[0167] According to the present invention, NR2F6 and optional CBLB can be suppressed by gene silencing or gene editing, for example by disrupting the expression and / or sequence of the NR2F6 and optional CBLB genes.
[0168] Gene editing, also known as gene modification, is a form of genetic engineering in which DNA is inserted, deleted, or replaced in the genome of a living organism using manipulated nucleases, or "molecular scissors." These nucleases create site-specific double-strand breaks (DSBs) at the desired sites in the genome. The induced double-strand breaks are repaired by non-homologous end-joint compounds (HEJs) or homologous recombination (HRs), resulting in targeted mutations ("edits"). Examples of manipulable nucleases that can be used for gene editing include meganucleases, integrases, site-specific recombinases, homing endonucleases, zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALENs), giant TALENs, and the CRISPR-Cas system.
[0169] Methods for introducing exogenous molecules (e.g., nucleic acid sequences) into cells are well-known and include lipid-mediated transfer (i.e., liposomes, including neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment, biopolymer nanoparticles, calcium phosphate coprecipitation, DEAE-glucan-mediated transfer, and viral vector-mediated transfer. The terms "gene transfer," "nucleic acid transfer," "gene sequence transfer," and "transgenic transfer" are used interchangeably. In embodiments, nucleic acid constructs are preferably transferred into cells via non-viral vectors and methods such as electroporation.
[0170] In some embodiments, inhibiting NR2F6 and optionally CBLB involves genetically modifying the immune cell genome by disrupting the expression and / or sequence of the NR2F6 and optionally CBLB genes via CRISPR-Cas. In other embodiments of the invention, CRISPR-mediated nucleic acid insertion may be employed, which encodes a transgenic antigen-targeting construct, such as a CAR or TCR.
[0171] CRISPR stands for Clustered Regularly Interspaced Short Palindromic Repeats, a type of DNA sequence found in bacteria. These sequences contain DNA fragments from viruses that have attacked the bacteria. Bacteria use these fragments to detect and destroy DNA from further attacks by similar viruses. These sequences play a crucial role in bacterial defense systems and form the basis of technologies known as CRISPR / Cas, which effectively and specifically alter genes within an organism.
[0172] The sequence of the CRISPR locus is transcribed and processed into CRISPR RNA (crRNA). The crRNA, together with the trans-activating crRNA (tracrRNA), forms a complex with the CRISPR-associated (Cas) protein. The specificity of the Cas nuclease for DNA cleavage is determined by the Watson-Crick base pairing between nucleic acids (Wiedenheft, B et al. (2012). Nature 482:331–338; Horvath, P et al. (2010). Science 327: 167–170; Fineran, PC et al. (2012). Virology 434: 202–209).
[0173] It was shown that the three components required for the type II CRISPR nuclease system are Cas9 protein, mature crRNA, and tracrRNA. This can be reduced to two components by fusing crRNA and tracrRNA into a single guide RNA (sgRNA). Furthermore, the Cas9 / sgRNA complex can be retargeted to a new site by altering the sequence of a short portion of the gRNA (Garneau, JE et al. (2010). Nature 468: 67–71; Deltcheva, E et al. (2011). Nature 471: 602–607; Jinek, M et al. (2012) Science 337: 816–821).
[0174] CRISPR-Cas systems are RNA-guided adaptive immune systems in bacteria and archaea that provide sequence-specific resistance to viruses or other invading genetic material. Based on the structure of the effector modules responsible for target recognition and cleavage of invading nucleic acids, this immune-like response has been classified into two classes (Makarova KS et al., Nat Rev Microbiol. 2015Nov; 13(11):722-36). Class I contains multi-subunit Cas protein effectors, while Class II consists of a single large effector protein. Both classes utilize CRISPR RNA (crRNA) to guide Cas nuclease components to their target sites, where they cleave invading nucleic acids. Due to their simplicity, Class II CRISPR-Cas systems are the most studied and widely used in genome editing. The most widely used CRISPR-Cas system is CRISPR-Cas9. Studies have shown that CRISPR / Cas9 systems can be engineered for efficient gene modification in mammalian cells.
[0175] In some embodiments of the present invention, RNA-guided DNA endonucleases are used. In the context of the present invention, the term "RNA-guided DNA endonuclease" refers to a DNA endonuclease that interacts with at least one RNA molecule. DNA endonucleases are enzymes that cleave phosphodiester bonds within a DNA polynucleotide chain. In the case of RNA-guided DNA endonucleases, the interacting RNA molecule can guide the RNA-guided DNA endonuclease to the site or location in the DNA where the endonuclease functions. Specifically, the term RNA-guided DNA endonuclease refers to naturally occurring or genetically modified Cas nuclease components or CRISPR-Cas systems, including but not limited to multi-subunit Cas protein effectors of class 1 CRISPR-Cas systems and single large effector Cas proteins of class 2 systems.
[0176] For example, Barrangou R et al. (Nat Biotechnol. 2016 Sep 8;34(9):933-941), Maeder ML et al. (Mol Ther. 2016 Mar;24(3):430-46), and Cebrian-Serrano A et al. (Mamm Genome.2017; 28(7): 247–261) have described in detail the technical applications of CRISPR / Cas systems and suitable RNA-guided endonucleases known to those skilled in the art. This invention is not limited to the use of specific RNA-guided endonucleases, and therefore includes the use of any RNA-guided endonuclease as defined herein that is suitable for the methods described herein.
[0177] According to the present invention, any RNA-guided DNA endonuclease known in the art can be used. RNA-guided DNA endonucleases include, but are not limited to: Cas proteins of Class 1 CRISPR-Cas systems, such as Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Csx11, Csx10, and Csf1; Cas proteins of Class 2 CRISPR-Cas systems, such as Cas9, Csn2, Cas4, Cpf1, C2c1, C2c3, and C2c2; corresponding orthologous enzymes / CRISPR effectors from various bacterial and archaea species; and engineered CRISPR effectors having, for example, novel PAM specificity, increased fidelity (e.g., SpCas9-HF1 / eSpCas9), or altered function (e.g., nickase). The RNA-guided DNA endonucleases particularly preferred in this invention are Streptococcus pyogenes Cas9 (SpCas9), Staphylococcus aureus Cas9, Streptococcus thermophilus Cas9, Neisseria meningitidis Cas9 (NmCas9), Francisella novicida Cas9 (FnCas9), Campylobacter jejuni Cas9 (CjCas9), Cas12a (Cpf1), and Cas13a (C2C2) (Makarova KS et al. (November 2015) Nature Reviews Microbiology. 13 (11): 722–36).
[0178] The definitions and explanations provided herein focus primarily on the SpCas9 Crispr / Cas system. However, those skilled in the art know how to use alternative Crispr / Cas systems, as well as the tools and methods that provide or allow access to detailed information about such alternative systems.
[0179] According to the method of the present invention, the RNA-guided DNA endonuclease can be introduced as a protein; however, alternatively, the RNA-guided DNA endonuclease can also be introduced in the form of a nucleic acid molecule encoding said protein. It should be understood that the nucleic acid molecule encodes the RNA-guided DNA endonuclease in an expressible form, such that expression in the cell produces a functional RNA-guided DNA endonuclease protein, such as the Cas9 protein. Means and methods for ensuring the expression of functional peptides are well known in the art. For example, the coding sequence of the endonuclease can be contained in a vector, such as a plasmid, granule, virus, bacteriophage, or other vectors conventionally used for, for example, genetic engineering.
[0180] Furthermore, the method of the present invention includes introducing at least one guide RNA into the cell. In the context of the present invention, "guide RNA" refers to an RNA molecule that interacts with an RNA-guided DNA endonuclease, resulting in the recognition of a target sequence to be cleaved by the RNA-guided DNA endonuclease. According to the present invention, the term "guide RNA" therefore includes, but is not limited to, target sequence-specific CRISPR RNA (crRNA), trans-activating crRNA (tracrRNA), and chimeric single guide RNA (sgRNA).
[0181] According to the present invention, NR2F6 and optional CBLB can be suppressed by knocking down NR2F6 expression and optional CBLB expression, for example by RNA interference (RNAi).
[0182] RNAi is a post-transcriptional gene silencing mechanism triggered by double-stranded RNA (dsRNA) to induce sequence-specific translational repression or mRNA degradation. Historically, RNAi has been referred to as co-repression, post-transcriptional gene silencing (PTGS), and gene quelling.
[0183] In the cell nucleus, microRNA (miRNA) genes are transcribed into 500-3000 nucleotide pri-miRNAs by RNA polymerase II. These pri-miRNAs are capped and polyadenylated. Furthermore, pri-miRNAs contain one or more stem-loop sequences and are cleaved by the Drosha-DGCR8 complex into 60-100 nucleotide double-stranded pre-miRNA hairpin structures. RanGTPase and Exportin-5 mediate the export of pre-miRNAs from the nucleus to the cytoplasm. Here, they are further processed by the RNase III enzyme known as Dicer into imperfect double-stranded structures of 22 nucleotides. One strand resembles a mature miRNA that binds to the Argonaut (Ago) protein and is incorporated into the RNA-induced silencing complex (RISC). As a result of RISC binding, mRNA degradation or protein translation inhibition is induced. The fate of the target mRNA molecule depends on the degree of complementarity between the target mRNA molecule and the miRNA, but is also influenced by the incorporated Ago protein. Although binding to Ago 2 leads to direct cleavage of the target mRNA, other Ago proteins have a negative impact on mRNA stability or impair translation.
[0184] For engineered knockdown of specific targets, various dsRNA molecules that enter the RNAi pathway at different points can be used. Transfection with small interfering RNA (siRNA) molecules that enter the cytosol of the RNAi pathway only results in transient protein knockdown. For long-term regulation of gene expression, it is necessary to deliver dsRNA molecules via integrated gene transfer vectors. Therefore, short hairpin RNA (shRNA) or miRNA molecules can be used.
[0185] Both enter the RNAi pathway in the cell nucleus and are then processed into siRNA-like molecules. shRNAs mimic the stem-loop structure of pre-miRNAs. Their expression is driven by a potent RNA polymerase III promoter that leads to high levels of expression and stable gene knockdown.
[0186] Those skilled in the art can design suitable small interfering RNA (siRNA), short hairpin RNA (shRNA), or miRNA molecules. For example, examples of siRNA molecules for NR2F6 inhibitors are disclosed in WO2010 / 004051 A1.
[0187] Another possibility is to use artificial miRNAs to mediate stable knockdown in primary T cells. These artificial miRNAs are similar to pri-miRNAs, thus representing a further step in mimicking the biology of natural miRNAs. This has several advantages for potential clinical applications. Most importantly, using endogenous miRNA processing mechanisms does not trigger cellular self-defense mechanisms, such as interferon induction.
[0188] Furthermore, artificial miRNAs are transcribed by RNA polymerase II promoters, much like most natural miRNAs. These promoters mediate regulatory and tissue-specific expression and further enable the simultaneous expression of selective or therapeutic transgenes. Additionally, multiple miRNAs from a single expression cassette can be combined to target regions in the same or different mRNAs, thereby achieving a synergistic effect in target downregulation. Such target downregulation is referred to herein as, for example, knockdown, silencing, or RNA interference.
[0189] Additionally, morpholinos can be used to knock down NR2F6 and optionally CBLB expression. Morpholinos, also known as "morpholino oligomers" or "phosphoryldiamid morpholino oligomers (PMOs)," are oligomers comprising DNA bases linked to a methylene morpholino ring backbone and connected by phosphoryldiamid groups. Morpholinos block the access of other molecules to small (approximately 25 bases) specific sequences on the base-pairing surface of ribonucleic acid (RNA) (e.g., mRNA or pre-mRNA), thereby blocking their sequence-dependent processes, such as translation or splicing of RNA molecules. Morpholinos do not trigger the degradation of said RNA molecules. Those skilled in the art can design and synthesize morpholinos for knocking down NR2F6 and optionally CBLB expression.
[0190] Additional antisense oligonucleotides (ASOs) can be used to knock down NR2F6 and optionally CBLB expression. Antisense oligonucleotides are short, synthetic, single-stranded oligodeoxynucleotides that can alter RNA and reduce, restore, or modify protein expression through several different mechanisms. These mechanisms include regulating pre-mRNA by redirecting polyadenylation, altering splicing or cleaving nucleotide bonds, and regulating mRNA by inhibiting translation or cleavage. Those skilled in the art can design and synthesize ASOs for knocking down NR2F6 and optionally CBLB expression.
[0191] According to the present invention, NR2F6 and optionally CBLB can be inhibited by treating the immune cells of the present invention with an NR2F6 antagonist and optionally a CBLB antagonist. The antagonists for NR2F6 and CBLB are preferably small molecule inhibitors. Examples of such small molecule inhibitors are TES-4207 (an NR2F6 inhibitor) and NX-1607 (a CBLB inhibitor). Other examples of such inhibitors are disclosed in WO2019 / 104199, WO2019 / 104201, US2019 / 0358224, WO2020 / 210508, WO2020 / 236654, WO2020 / 264398, WO2019 / 148005, and WO2022 / 272248.
[0192] Compositions and formulations
[0193] The compositions considered herein may comprise one or more polypeptides, polynucleotides, carriers containing them, genetically modified immune cells, etc., as considered herein. Compositions include, but are not limited to, pharmaceutical compositions. A “pharmaceutical composition” means a composition formulated in a pharmaceutically acceptable or physiologically acceptable solution for administration alone or in combination with one or more other therapeutic modalities to cells or animals. It should also be understood that, if desired, the compositions of the present invention may also be administered in combination with other pharmaceutical agents, such as cytokines, growth factors, hormones, small molecules, chemotherapeutic agents, prodrugs, drugs, antibodies, or other various pharmaceutically active agents. There are practically no limitations on other components that may also be included in the composition, provided that the additional agents do not adversely affect the composition’s ability to deliver the intended therapeutic effect.
[0194] "Pharmaceutical composition" means a composition formulated into a pharmaceutically acceptable or physiologically acceptable solution for administration alone or in combination with one or more other therapeutic modalities to cells or animals. It should also be understood that, if desired, the compositions of the present invention can also be administered in combination with other pharmaceutical agents, such as cytokines, growth factors, hormones, small molecules, chemotherapeutic agents, prodrugs, drugs, antibodies, or other various pharmaceutically active agents. There are practically no limitations on other components that may be included in the composition, provided that the addition of pharmaceutical agents does not adversely affect the composition's ability to deliver the intended therapeutic effect.
[0195] The term “pharmaceutically acceptable” in this document refers to those compounds, materials, compositions, and / or dosage forms that are suitable for use in human and animal tissue contact without excessive toxicity, irritation, allergic reactions, or other problems or complications, to the extent that reasonable medical judgment allows, and which are commensurate with a reasonable benefit / risk ratio.
[0196] As used herein, “pharmaceuticalally acceptable carriers, diluents, or excipients” include, but are not limited to, any adjuvants, carriers, excipients, glidants, sweeteners, diluents, preservatives, dyes / colorants, flavor enhancers, surfactants, wetting agents, dispersants, suspending agents, stabilizers, isotonic agents, solvents, surfactants, or emulsifiers that have been approved by the United States Food and Drug Administration (FDA) for acceptable use in humans or livestock. Exemplary pharmaceutically acceptable carriers include, but are not limited to: pyrogen-free water; isotonic saline; Ringer's solution; phosphate buffer solution; and any other compatible substances used in pharmaceutical formulations.
[0197] In certain embodiments, the compositions of the present invention comprise the amount of immune cells considered herein. As used herein, the term “amount” refers to the “effective amount” or “response amount” of genetically modified therapeutic cells, such as T cells, to achieve a beneficial or desired preventive or therapeutic outcome, including clinical outcomes.
[0198] "Prophylactic effective dose" refers to the amount of gene-modified therapeutic cells effective enough to achieve the desired preventative outcome. Typically, but not always, the prophylactic effective dose is less than the therapeutic effective dose because the prophylactic dose is administered to the subject before or in the early stages of the disease. The term "prophylaxis" does not necessarily refer to complete suppression or prevention of a specific medical condition. Prophylaxis also refers to reducing the risk of developing a medical condition or worsening its symptoms.
[0199] The "therapeutic effective amount" of genetically modified therapeutic cells can vary depending on factors such as an individual's disease state, age, sex, and weight, as well as the ability of stem cells and progenitor cells to elicit the desired response in an individual. Therapeutic effective amount is also the amount in which the beneficial therapeutic effect outweighs any toxic or harmful effects of the virus or transduced therapeutic cells. The term "therapeutic effective amount" includes the amount that effectively "treats" a subject (e.g., a patient). When indicating a therapeutic amount, the precise amount of the composition of the invention to be administered can be determined by a physician taking into account the patient's (subject's) age, weight, tumor size, degree of infection or metastasis, and individual differences in the condition.
[0200] Generally speaking, it can be said that a pharmaceutical composition containing the immune cells described herein can be used in 10 2 Up to 10 10 Administered at a dose of cells / kg body weight, preferably 10. 5 Up to 10 7 Cells / kg body weight, including all integer values within these ranges. The number of cells will depend on the intended end use of the composition, as well as the type of cells included. For the uses described herein, cells are typically in volumes of 1 liter or less, but can be 500 ml or less, or even 250 ml or 100 ml or less. Therefore, the desired cell density is typically greater than 10. 6 cells / ml, usually greater than 10 7 cells / ml, typically 10 8 Cells / ml or higher. Clinically relevant cell counts can be administered in multiple infusions, accumulating to 10 or more. 5 10 6 10 7 10 8 10 9 10 10 10 11 Or 10 12Cells. In some aspects of the invention, particularly when all infused cells are redirected to a specific target antigen, a smaller number of cells can be administered. The cell composition can be administered multiple times at doses within these ranges. The cells for the treated patient can be allogeneic, syngeneic, xenogeneic, or autologous.
[0201] Generally, compositions comprising activated and expanded cells as described herein can be used to treat and prevent diseases in immunocompromised individuals. In particular, compositions comprising the modified immune cells considered herein are used to treat solid tumors. The modified immune cells of the present invention can be administered alone or as pharmaceutical compositions in combination with carriers, diluents, excipients, and / or other components (such as IL-2 or other cytokines or cell populations). In certain embodiments, the pharmaceutical compositions considered herein comprise a quantity of genetically modified immune cells, and one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. In certain embodiments, the pharmaceutical compositions considered herein comprise a quantity of genetically modified immune cells in combination with an NR2F6 inhibitor and optionally a CBLB inhibitor.
[0202] The pharmaceutical compositions of the present invention comprising immune cells may include buffers such as neutral buffered saline solutions, phosphate buffered saline solutions, etc.; carbohydrates such as glucose, mannose, sucrose, or dextran, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. The compositions of the present invention are preferably formulated for parenteral administration, such as intravascular (intravenous or intraarterial), intraperitoneal, or intramuscular administration.
[0203] Liquid pharmaceutical compositions, whether solutions, suspensions, or other similar dosage forms, may include one or more of the following: a sterile diluent, such as water for injection, physiological saline solution, preferably physiological saline, Ringer's solution, or isotonic sodium chloride; a fixing oil, such as synthetic monoglycerides or diglycerides, polyethylene glycol, glycerol, propylene glycol, or other solvents that can be used as a solvent or suspension medium; an antibacterial agent, such as benzyl alcohol or methylparaben; an antioxidant, such as ascorbic acid or sodium bisulfite; a chelating agent, such as ethylenediaminetetraacetic acid; a buffer, such as acetate, citrate, or phosphate; and a reagent for adjusting osmotic pressure, such as sodium chloride or glucose. Parenteral preparations may be packaged in ampoules, disposable syringes, multi-dose vials, or bags made of glass or plastic. Injectable pharmaceutical compositions are preferably sterile.
[0204] In specific embodiments, the compositions contemplated herein comprise an effective amount of immune cells, alone or in combination with one or more therapeutic agents. Therefore, the immune cell compositions can be administered alone or in combination with other known cancer treatments, such as radiotherapy, chemotherapy, transplantation, immunotherapy, hormone therapy, photodynamic therapy, etc. The compositions can also be administered in combination with antibiotics. Such therapeutic agents are acceptable in the art as standard treatment for specific disease states (e.g., specific cancers) as described herein. Exemplary therapeutic agents contemplated include cytokines, growth factors, steroids, NSAIDs, DMARDs, anti-inflammatory substances, chemotherapy agents, radiotherapy agents, therapeutic antibodies, or other active and adjuvant agents.
[0205] Immune cell products can be cryopreserved in liquid nitrogen gas phase in dimethyl sulfoxide (DMSO) / human serum albumin (10% / 90% vol / vol) until pre-treatment for administration to the patient. This storage does not impair the viability and functionality of the T cell products.
[0206] Methods of treatment
[0207] The genetically modified cells considered in this article provide an improved approach to adoptive immunotherapy for the treatment of solid tumors.
[0208] In the context of this invention, the term solid tumor refers to, but is not limited to, glioblastoma, lung cancer, breast cancer, kidney cancer, pancreatic cancer, skin cancer such as melanoma, intestinal cancer, ovarian cancer, prostate cancer, colon cancer, and sarcoma.
[0209] Sarcomas defined in the context of this invention include, but are not limited to, chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, abenezerian sarcoma, and liposarcoma. Sarcoma, liposarcoma, alveolar soft tissue sarcoma, ameloblastic sarcoma, botryoid sarcoma, chloroma sarcoma, choriocarcinoma, embryonal sarcoma, nephroblastoma sarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fascial sarcoma, fibroblastic sarcoma, giant cell sarcoma, granulocytic sarcoma, Hodgkin's sarcoma, idiopathic multiple pigmented hemorrhagic sarcoma, B-cell immunoblastic sarcoma, lymphoma, T-cell immunoblastic sarcoma, Jensen's sarcoma, Kaposi's sarcoma, Kupffer cell sarcoma, angiosarcoma, leukemic sarcoma, malignant mesenchymal sarcoma, extraperiosteal sarcoma, reticulum cell sarcoma, Rous sarcoma, serous cystic sarcoma, synovial sarcoma, and capillary dilatational sarcoma.
[0210] The melanomas according to the present invention include, but are not limited to, for example, acral lentigines melanoma, amelanoma, benign juvenile melanoma, Cloudman's melanoma, S91 melanoma, Harding-Passey melanoma, juvenile melanoma, malignant lentigines melanoma, malignant melanoma, nodular melanoma, subungual melanoma, and superficial spreading melanoma.
[0211] In the context of this invention, the term solid tumor also refers to, but is not limited to: acinar carcinoma, acinous carcinoma, adenocystic carcinoma, adenoid cystic carcinoma, adenocarcinoma, adrenocortical carcinoma, alveolar carcinoma, alveolar cell carcinoma, basal cell carcinoma, basal cell carcinoma basocellulare, basal-like carcinoma, basal squamous cell carcinoma, bronchioloalveolar carcinoma, bronchiolar carcinoma, bronchial carcinoma, brain cancer, cholangiocarcinoma, choriocarcinoma, glial carcinoma, comedo carcinoma, uterine endometrial cancer, cribriform carcinoma, armored carcinoma, skin cancer, columnar carcinoma, columnar cell carcinoma, ductal carcinoma, dural carcinoma, embryonal carcinoma, brain-like carcinoma, epidermoid carcinoma, adenoid epithelial carcinoma, exophytic carcinoma, ulcerative carcinoma, fibrous carcinoma, gelatiniform carcinoma, gelatinous carcinoma, giant cell carcinoma, and giant cell carcinoma. gigantocellulare), adenocarcinoma, granulocytic carcinoma, pilostromal carcinoma, hemangioma, hepatocellular carcinoma, Hurthle cell carcinoma, clear carcinoma, adrenoid carcinoma, embryonal carcinoma, carcinoma in situ, intraepithelial carcinoma, intraepithelial carcinoma, Krompecher's carcinoma, Kulchitzky cell carcinoma, large cell carcinoma, lenticular carcinoma, lenticular carcinoma, lipoma-like carcinoma, lymphoepithelial carcinoma, medullary carcinoma, melanoma, molluscum carcinoma, mucinous carcinoma, mucinous carcinoma muciparum, mucinous cell carcinoma, mucinous epidermoid carcinoma, mucinous carcinoma mucosum, mucous carcinoma Carcinoma, myxomatoid carcinoma, nasopharyngeal carcinoma, oat cell carcinoma, osteocyte carcinoma, osteoid carcinoma, papillary carcinoma, periportal carcinoma, carcinoma in situ, acanthosis nigra, cerebral carcinoma, renal cell carcinoma, reserve cell carcinoma, sarcomatoid carcinoma, Schneiderian carcinoma, sclerosing carcinoma, scrotal carcinoma, signet ring cell carcinoma, simple carcinoma, small cell carcinoma, potato carcinoma, spherical cell carcinoma, spindle cell carcinoma, cavernous carcinoma, squamous carcinoma, squamous cell carcinoma, tangle carcinoma, telangiectatic carcinoma, transitional cell carcinoma, tuberosum nodular carcinoma, tuberous carcinoma, verrucous carcinoma, and villous carcinoma.
[0212] As used herein, the terms “individual,” “subject,” and “patient” are generally used interchangeably and refer to any animal exhibiting symptoms of a solid tumor that can be treated with cell-based therapeutic agents and methods disclosed elsewhere herein. Suitable subjects include laboratory animals (e.g., mice, rats, rabbits, or guinea pigs), farm animals, and domesticated animals or pets (e.g., cats or dogs). Non-human primates are included, with human patients being preferred. Typical subjects include human patients with solid tumors, those diagnosed with solid tumors, or those at risk of developing solid tumors.
[0213] As used herein, “treatment” or “treating” includes any beneficial or desired effect on the symptoms or pathology of a disease or pathological condition, and may even include a minimal reduction in one or more measurable markers of the disease or condition being treated. Treatment may optionally reduce or improve the symptoms of a disease or condition, or delay the progression of a disease or condition. “Treatment” does not necessarily mean the complete eradication or cure of a disease or condition or its associated symptoms.
[0214] As used herein, “prevention” and similar terms, such as “prevented,” “being prevented,” or “preventative,” refer to methods used to prevent, suppress, or reduce the likelihood of the occurrence or recurrence of a disease or condition. It also refers to delaying the onset or recurrence of a disease or condition, or delaying the appearance or recurrence of its symptoms. As used herein, “prevention” and similar terms also include reducing the intensity, effect, symptoms, and / or burden of a disease or condition before its onset or recurrence. Attached Figure Description
[0215] The invention is further described with reference to the following accompanying drawings. These are not intended to limit the scope of the invention, but rather to illustrate preferred embodiments of various aspects of the invention for better illustration.
[0216] BRIEF DESCRIPTION OF THE DRAWINGS
[0217] Figure 1 NR2F6, inherent to T cells, directly antagonizes metabolic adaptations both in vivo and in vitro. A schematic overview of NR2F6 as an inducible exhaustion factor in tumor immune responses.
[0218] Figure 2 NR2F6 acts as an inducible and highly restricted "immune checkpoint" within the solid tumor immune microenvironment (TIME). This allows the NR2F6-modified CAR-T cells of this invention to trigger a predominantly "compartmentalized immunogenic cell death therapeutic outcome" and subsequently cross-sensitize endogenous polyclonal T cells with tumor antigens only at sites immediately adjacent to the solid tumor. As a direct result, this reduces the systemic toxicity / irAE of the NR2F6-modified CAR-T therapy regimen of this invention.
[0219] Figure 3 The loss of NR2F6 leads to metabolic shift and increases the metabolic adaptability of CAR-T cells during chronic stimulation.
[0220] Figure 4 NR2F6 depletion enhances the cytotoxic effects of CAR-T cells in vitro.
[0221] Figure 5 NR2F6 is upregulated during chronic stimulation, and NR2F6 depletion enhances the cytotoxic effector function of CAR-T cells and promotes ICD of tumor cells in in vitro co-culture.
[0222] Figure 6 NR2F6 knockout of CD8 + Even under repeated stimulation that leads to exhaustion, T cells retain both (A) the active T cell phenotype and (B) the intact killing mechanism, both genetically characterized.
[0223] Figure 7 Acute depletion of NR2F6 in CAR-T cells improved antitumor activity and significantly prolonged the survival of immune-active mice. Acute gene editing of NR2F6 in CAR-T cells (compared to existing CAR-T cells) maintained effector function against antigenically heterogeneous PanC-02 tumor burden, thereby allowing for durable tumor growth inhibition in healthy immune-active mice. Notably, no significant irAEs were observed in the NR2F6-modified CAR-T treatment group.
[0224] Figure 8 The efficacy of NR2F6-modified CAR-T therapy requires a profound secondary adaptive immune response. It is only effective in immune-active wild-type mice (see above). Figure 7 A- Figure 7 C), but not in Rag1- / - mice (which completely lack an endogenous adaptive immune system), inhibition of NR2F6 in CAR-T cells leads to superior antitumor immunity against the EpCAM antigen-heterogeneous PanC-02 tumor burden. This means that the growth benefits of NR2F6-modified CAR-T tumors (epitope spread, leading to a secondary immune response from the endogenous adaptive immune system, which is only present in immune-active wild-type mice) are subject to strict requirements on the endogenous immune system.
[0225] Figure 9 Despite providing robust and long-term benefits to tumor growth (see above) Figure 7 A- Figure 7C) CAR-T GFP+ cells are rejected by the host immune system of the immune-active receptor within the first week after infusion. This can be explained by ICD-mediated epitope diffusion that occurs during this first week, which is selectively promoted by NR2F6-modified CAR-T therapy but not by conventional WT CAR-T therapy, or at least to a much lesser extent. This finding validates the time-boxed strategy, which uses the NR2F6-modified CAR-T cells of this invention as a transient trigger for a secondary immune response in the endogenous T cell compartment to promote a durable host protective anti-tumor immune response as an innovative strategy.
[0226] Figure 10 Due to epitope diffusion, fully NR2F6-modified CAR-T responders rejected PanC02 antigen-negative tumors upon rechallenge at 5 and 10 months. Remission-free surviving mice (similar to EpCAM-positive tumors) showed effective EpCAM-negative tumor detection and clearance upon rechallenge, validating transient CAR-T therapy-induced immunogenic tumor cell death (ICD) (see above). Figure 9 This demonstrates the transient nature of NR2F6-modified CAR-T therapy, which has triggered a secondary immune response through effective tumor antigen cross-sensitization (epitope diffusion). Furthermore, intact NR2F6-modified CAR-T responders exhibit anti-tumor memory that can transfer to the WT receptor carrying EpCAM-negative tumors: a POC (tumor antigen-agnostic effect) of immune memory for host-protective tumor control in EpCAM-negative tumors.
[0227] Figure 11 NR2F6-modified CAR-T therapy in tumor-bearing mice exhibited enhanced anti-tumor activity of the endogenous immune system. The immunogenic cell death phenomenon mediated by NR2F6-modified CAR-T cells of this invention activates innate immune cells in the solid tumor microenvironment, serving as a key and necessary prerequisite for triggering robust cross-sensitization of multiple tumor antigens. The concept of tumor antigen cross-sensitization demonstrates that NR2F6-modified (but not WT) CAR-T therapy can effectively "preheat" discarded "cold" time as a prerequisite for tumor antigen cross-sensitization. NR2F6 crispr- / - Mice treated with .sg03 (but not the control WT) CAR-T showed enhanced anti-tumor activity and effectively sensitized endogenous T cell compartments against multiple PanCO2 tumor antigens within 3 weeks of NR2F6-modified CAR-T therapy in vivo.
[0228] Figure 12For example, as measured by scRNAseq of CD45+ immune cells, NR2F6-modified CAR-T-treated complete responders exhibited excellent immune responses to EpCAM-negative tumors.
[0229] Figure 13 NR2F6 during chronic stimulation crispr- / - TCF-1 DNA binding is persistent in CAR-T cells. Human NR2F6 directly blocks human TCF-1 DNA binding and transactivation. TCF-1 is a CD8+ receptor agonist. + A key regulator of established clonal memory differentiation and exhaustion resistance in T cells. This biochemical mechanism can provide a mechanistic explanation for the observed metabolic changes and subsequent exhaustion resistance in NR2F6- / -CAR-T cells.
[0230] Figure 14 When stimulated by antigen receptors, primary T cells edited with the human NR2F6 gene exhibited a significantly enhanced effector response, which could be further enhanced by combined inhibition with CBLB. In primary human T cells, the combined inhibition of NR2F6 and CBLB synergistically promoted antigen receptor signaling in the primary human T cells, thereby validating the concept of the combined CAR-T therapy of this invention.
[0231] Figure 15 This diagram illustrates the immunogenic cell death phenomenon mediated by NR2F6-modified CAR-T cells of the present invention, which activates innate immune cells in the immune microenvironment of solid tumors, triggering robust cross-sensitization of the intrinsic immune system through epitope diffusion. Subsequently, this promotes secondary and polyclonal T-cell-based rejection of CAR-targeted antigen-negative tumors (typically found in antigenically heterogeneous solid tumors).
[0232] DETAILED DESCRIPTION
[0233] Figure 1 T cell-inherent NR2F6 directly antagonizes metabolic adaptation in vivo and in vitro. A schematic overview of NR2F6 as an inducible exhaustion factor in the immune response to solid tumors. When NR2F6 is associated with low CD8... + Compared to other cells, NR2F6 has higher CD8 content. + T cells are more easily depleted, thus representing CD8 +The terminal state of T cell exhaustion. This confirms the central role of NR2F6 in terminal T cell exhaustion, and NR2F6-modified CAR-T cells provide a strategy for increasing responses to CAR-T immunotherapy. Nutritional deficiencies in TIME antagonize the metabolic fitness of TILs and, together with persistent tumor antigen exposure, lead to a dysfunctional T cell differentiation state known as “exhaustion.” NR2F6 deficiency leads to a metabolic shift and enhances the metabolic fitness of CAR-T cells during chronic stimulation. Unbound by theory, we conclude that the highly upregulated NR2F6 signaling axis in solid tumor sites is a major driver of T cell metabolic dysfunction in cancer tissue.
[0234] Figure 2 NR2F6 acts as an inducible and highly restricted "immune checkpoint" in the solid tumor immune microenvironment (TIME). A) Large-scale NR2F6 gene induction in T cells at solid tumor sites: Inflammatory signals localized to the mouse TIME lead to >500% upregulation of NR2F6 in tumor-infiltrating lymphocytes (TILs). Therefore, NR2F6 is highly localized to solid tumor sites, primarily impairing TIL effector activity without affecting peripheral T cells. This allows the NR2F6-modified CAR-T cells of this invention to trigger a major "immune checkpoint". Compartmentalized immunogenic cell death therapeutic outcomes Immediately adjacent to the tumor site only "and subsequently Systemically This allows for the cross-sensitization of endogenous polyclonal T cells with tumor antigens. As a direct result, this reduces the effectiveness of the NR2F6-modified CAR-T therapy regimen of this invention. Figure 3 Toxicity / irAE. B) Selective upregulation (>300%) of NR2F6 in primary T cells during repeated antigen stimulation (WT depletion) in vitro, but not observed in single antigen-stimulated cells (WT not depleted). C) Mechanistically, activation of concomitant RAR and / or RXR, as instances of inflammatory signals within TIME, further promotes NR2F6 expression in repeatedly antigen-stimulated T cells, resulting in an additional >300% upregulation of NR2F6.
[0235] Figure 4NR2F6 deficiency leads to a metabolic shift and increases the metabolic fitness of CAR-T cells during prolonged stimulation. AC) NR2F6-edited T cells exhibit superior stress test profiles, indicating that NR2F6-modified T cells exhibit higher oxidative phosphorylation (OXPHOS) activity in both exhausted and unexhausted states. D) Similarly, data from this invention demonstrate the benefit of extracellular acidification rate (EACR) in NR2F6- / -CD8+ T cells. In summary, the inherent NR2F6 in T cells directly antagonizes metabolic fitness. BD) The following metabolic rates were analyzed by hippocampal mitochondrial stress assays: on day 4 of prolonged stimulation, under resting and challenge conditions, the oxygen consumption rate (OCR, see B, C) and extracellular acidification rate (ECAR, see D) of control or NR2F6-deficient CAR-T cells. Data are presented in duplicate from two independent experiments, n=6 donors. FCCP = carbonyl cyanide p-trifluoromethoxyphenylhydrazone, AA+Rot = antimycin A+rotenone; two-way ANOVA [B+D], two-tailed unpaired Student's t-test [C]. E) PCA blot from extensive RNA sequencing data on day 4 (d4) of long-term stimulation. F) Gene Ontology (GO) project of normalized RNA sequencing data showing the effect of NR2F6 compared to wild-type control CAR-T cells. - / - Pathways significantly enriched in CAR-T cells. G) GSEA of NR2F6-deficient CAR-T cells compared to control cells after 4 days of continuous killing, collected using marker genes. Normalized enrichment scores (NES) and p-values are shown. Positive NES indicates gene set enrichment in NR2F6-deficient cells. Data are presented as mean ± SEM. p<0.05, p<0.01, p<0.001.
[0236] Figure 5 NR2F6 depletion promotes effector function and delays depletion formation during prolonged stimulation. (A) NR2F6 knockout in CAR-T cells maintained cytotoxic effector function during continuous killing of PanC02 tumor cells in vitro. Effector properties of T cells were significantly enhanced by NR2F6 gene editing at different effector-to-target (E:T) ratios shown: (B) NR2F6 gene editing restored at least 80% of the cytotoxic effector function of CAR-T cells compared to unedited CAR-T cells. (Measurements were performed during continuous killing cycles, as shown). (C) CAR structure, scFv = single-stranded variable region segment, h = hinge region, TM = transmembrane region; (D) In wild-type and NR2F6 - / -E) CAR transduction efficiency was comparable in CAR-T cells. F) IFNγ production was achieved after 24 hours of co-culturing with tumor cells 5 days after T cell activation. Control and NR2F6-deficient EpCAM-28ζ CAR-T cells were stimulated with PanC02-EpCAM at a 5:1 ratio. Data are the mean ± SEM of n=5 replicates from two independent experiments. Two-tailed unpaired Student's t-test was used. G) Cytotoxicity of control and NR2F6-deficient EpCAM-28ζ CAR-T cells against GFP+ PanC02-EpCAM cells was assessed in cytokine-free medium after continuous stimulation every 48 hours for 5 days following T cell activation at a 5:1 T cell to tumor cell ratio. Data are the mean ± SEM of n=9 replicates from four independent experiments using a two-factor Anova assay. H) Using Bioplex, release of IFNγ (left) and granzyme B (right) in the supernatant after each consecutive restimulation cycle (every 48 h) with GFP+PanC02-EpCAM tumor cells, starting 5 days after T cell activation. Data are from two independent experiments, using mean ± SD from multiple unpaired Student's t-tests from n=6 replicates. I) Flow cytometry analysis of Tcm-like CD62L+CD44+ CAR-T cells on day 4 of continuous killing; n=6 from two independent experiments; unpaired Student's test. J) In wild-type and NR2F6 - / - Representative images (left) and proportions (right) of progenitor (Tim3-Ly108+) and terminal (Tim3+Ly108-) exhausted T cells during continuous killing assays of CAR-T cells (d4 = round 2 and d8 = round 4 after continuous killing). Data are mean ± SEM from n = 6 donors. Mann-Whitney test. Tpex, progenitor-exhausted T cells; Ttex, terminally exhausted T cells; Tex, transiently exhausted T cells. K) Flow cytometry analysis (left) and geometric mean fluorescence intensity (gMFI) (right) of TCF7 in control and NR2F6-deficient CAR-T cells 9 days after T cell activation and 4 days after the start of continuous killing. L) PCA blot of RNA sequencing data obtained on day 8 of continuous killing / day 13 after T cell activation. M) Gene Ontology (GO) project of normalized RNA sequencing data showing that NR2F6 - / - CAR-T cells showed significant enrichment of certain pathways on day 8 after the start of continuous killing and day 13 after T cell activation. Data are presented as mean ± SEM. p<0.05, p<0.01, p<0.001.
[0237] Figure 6 NR2F6 mRNA is upregulated during in vitro CAR-T cell production and chronic stimulation. A) In vitro CD8 + A) NR2F6 expression was induced during CAR-T cell production (n=6). B) However, CAR-T cell expansion during production on day 5 post-T cell isolation was comparable between the two genotypes. C) NR2F6 expression was induced with PanC02-EpCAM tumor cells after long-term antigen-specific stimulation (n=3; day 0 of long-term stimulation (d0) = day 5 of CAR production (d5)). D) No phenotypic changes in expansion between wild-type and NR2F6-deficient CAR-T cells were observed during chronic stimulation. E) Quantitative Gasdermin E (GSDME) cleavage was collected 4 days after long-term stimulation and restimulated for 6 hours with PanC02-EpCAM tumor cells during co-culture of tumor cells and NR2F6-deficient or wild-type CAR-T cells (biological replication, n=6, two independent experiments). p < 0.05 p < 0.01, p < 0.001. As a significant result, NR2F6-deficient CAR-T cells induced pyroptosis in co-cultured tumor cells; pyroptosis represents the major form of ICD. Mechanistically, as demonstrated by tumor-inherent GSDME cleavage, increased production of GRZB and IFNγ led to the qualitative shift from apoptosis to pyroptosis. These data represent functional validation of the NR2F6 pathway in inducing immunogenic cell death (ICD) in tumor cells via NR2F6-modified CAR-T cells.
[0238] Figure 7 NR2F6 knockout of CD8 + T cells retain the following two genetic characteristics: (A) an activated T cell phenotype and (B) an intact killing mechanism, despite exhaustive repetitive stimulation. (A) RNA sequencing analysis revealed NR2F6- / - and wild-type CD8. + Significant differences exist among T cells, and a bias toward less exhausted and more cytotoxic phenotypes. (B) Upregulated granzyme genes GzmA, GzmC, and GzmD are described, all of which have been shown to play key roles in the cytotoxic killing of tumor cells.
[0239] Figure 8Acute depletion of NR2F6 in CAR-T cells improved antitumor activity and significantly prolonged survival in immunocompetent mice. Acute gene editing of NR2F6 in CAR-T cells maintained effector function, thereby allowing for durable tumor growth inhibition of heterogeneous PanC-02 tumor burden (EpCAM+ / EpCAM- ratio of approximately 75:25), thus allowing for durable tumor growth inhibition in fully immunocompetent mice in vivo. Furthermore, no significant irAEs were observed in the NR2F6-modified CAR-T treatment group. (A) Analysis of tumor clearance and survival. Tumor regions of wild-type mice were subcutaneously injected with PanC02-EpCAM cells and treated with CRISPR / Cas9-modified CAR-T cells (NTC vs NR2F6) 2 days later. crispr.sg04 ), and CD8 receiving non-CAR polyclonal gene modification + T cells were compared with the untreated group. Tumor area was measured by calipers. Two-way ANOVA and Dunnett's multiple comparison test, and log-rank test were performed. n=10 mice were pooled from two independent experiments. Data are presented as mean ± SEM. p<0.05, p<0.01, p<0.001. Remission was achieved in a preclinical in vivo mouse model of solid tumors: NR2F6 CRISPR / Cas9 gene-edited anti-EpCAM CAR-T cell therapy suppressed tumor growth by at least 80% (compared to unedited CAR-T cells in the prior art) and resulted in overall survival in at least 50% of test mice. (B) Tumor growth curves of individual mice within the treatment group. Notably, no significant irAE was observed after treatment with NR2F6 gene-edited anti-EpCAM CAR-T cells. (C) Using independent NR2F6-targeting sgRNA with non-sequence overlap, with NTC or NR2F6 crispr- / -Overall survival analysis of mice carrying PanC02-EpCAM tumors treated with CAR-T cells; n=5, from one independent experiment; D) Frequency of CAR-T cells in the peripheral blood of CAR-T-treated tumor-bearing mice on days 6 and 13 after ACT; n=3, from one independent experiment; multiple unpaired Student's t-test. Notably, despite providing robust and long-term tumor growth benefits, CAR-T cells were completely rejected by the host immune system with immune-active receptors. E) Determination of NR2F6-targeting sgRNA editing efficiency by degradation-tracking insertion / deletion mutation (TIDE) analysis; n=3, from 3 independent experiments. F) Killing assays were performed using PanC02 EpCAM-positive and negative tumor cells, respectively, as specific controls for studying the EpCAM CAR-T system.
[0240] Figure 9 The efficacy of NR2F6-modified CAR-T therapy requires a complete secondary adaptive immune response. Compared to the treatment-free group receiving PBS, subcutaneous injection of 5 × 10⁶ CAR-T cells significantly improved efficacy. 5 PanC02-EpCAM cells were used in conjunction with genetically modified CAR-T cells (NTC vsNR2F6). crispr- / -sg04 or NR2F6 crispr- / -sg03 Rag1 after 2 days of treatment - / - Analysis of tumor clearance (A) and survival (B) in mice. Tumor volume was measured using calipers. Two-way ANOVA and Dunnett's multiple comparison test (A) and Log-Rank test (B) were used. n=6 mice, representing two independent experiments. NR2F6 depletion in CAR-T cells resulted in superior anti-tumor immunity against PanC-02 tumor burden only in immunocompetent wild-type mice (but not in Rag1- / - mice completely lacking an endogenous adaptive immune system), implying that the growth benefit of NR2F6-modified CAR-T tumors is subject to a strict requirement of the endogenous adaptive immune system (i.e., ICD-mediated epitope diffusion leading to a secondary immune response from the endogenous adaptive immune system present only in immunocompetent wild-type mice).
[0241] Figure 6 CAR-T GFP+ is rejected by the host immune system, which has an immune-active receptor, within the first week after infusion. Despite providing robust and long-term benefits to tumor growth (see [link to relevant documentation]). Figure 10A) However, CAR-T GFP+ is rejected by the host immune system of the immune-active receptor within the first week after infusion. This can be explained by ICD-mediated epitope diffusion, which is selectively promoted by NR2F6-modified CAR-T therapy but not promoted or at least to a much lesser extent by conventional WT CAR-T therapy. This finding validates the time-boxed transient strategy of using NR2F6-modified CAR-T cells of the present invention as a trigger for a secondary immune response and improves the polyclonal nature of the endogenous T cell compartment. This potentially key mechanism allows for durable immunotherapy outcomes, leading to a protective host anti-tumor immune response as an innovative strategy.
[0242] Relief At re-challenge after 5 and 10 months, fully NR2F6-modified CAR-T responders rejected PanC02 antigen-negative tumors due to epitope diffusion. A) Experimental setup and timeline. B and C) Analysis of tumor clearance. At re-challenge in EpCAM-positive and EpCAM-negative PanC02 tumor burden, no Figure 7 NR2F6-modified CAR-T cells treated in complete responders (see above) Figure 7 A and Figure 8 B) demonstrated similarly effective tumor clearance, validating that immunogenic tumor cell death was induced by time-boxed transient CAR-T therapy (see [link]). Figure 7 This has triggered secondary and polyclonal immune responses through effective tumor antigen cross-sensitization (epitope diffusion). Furthermore, intact NR2F6-modified CAR-T responders exhibited anti-tumor memory that could transfer to EpCAM-negative tumor-bearing WT receptors: a proof-of-concept (POC) for durable immune memory in host-protective tumor control of EpCAM-negative tumors (epitope diffusion as a tumor antigen-agnostic therapeutic outcome). Initial induction from PanC02-EpCAM+ tumor cells (see above) Figure 7 A and Figure 11 B) Tumor growth (B) and survival (C) of complete responders (CR) treated with NTC and NR2F6 modified CAR-T cells, after 150 days of re-challenge with PanC02-EpCAM-positive (left) and PanC02-EpCAM-negative (right) tumor cells (first re-challenge). Initially age-matched C57BL6 mice were used as controls (naïve wild-type). D and E) When all NR2F6 crispr- / -Mice treated with CAR-T cells who survived the first re-challenge were re-challenged 150 days later (300 days after initial tumor induction) with 1 PanC02-EpCAM-tumor cells. Initially age-matched C57BL6 mice were used as controls (as PanC02 tumor antigen-initial wild-type controls). Mice carrying initial PanC02-EpCAM... negative Tumor growth (D) and survival (E) in wild-type mice receiving intravenous spleen cells from NR2F6-modified CAR-T-treated complete responders (CR) euthanized on day 305 or from control mice initially treated with PanC. F) IFNγ release after 24 hours of co-culturing spleen cells with tumor cells. Initial and second-re-challenged CR endogenous T cells were stimulated with PanC02-EpCAM+ tumor cells at a 5:1 ratio. Data are from n=4, mean ± SEM. p<0.05, p<0.01, p < 0.001. Therefore, a noteworthy finding is that fully NR2F6-modified CAR-T responders have developed secondary and polyclonal antitumor memories for tumor control that can be transferred to EpCAM-negative WT tumor receptors. These results provide a proof-of-concept for long-term immune memory in the secondary-induced endogenous T-cell compartment of the NR2F6-modified CAR-T therapy of this invention for host-protective tumor control in EpCAM-negative tumors (in tumor antigen-agnostic effects).
[0243] Figure 12 NR2F6-modified CAR-T cells in tumor-bearing mice exhibited enhanced antitumor activity of the endogenous immune system. The immunogenic cell death phenomenon mediated by NR2F6-modified CAR-T cells of this invention activates innate immune cells, serving as a key and necessary prerequisite for triggering robust cross-sensitization to multiple tumor antigens. Proof-of-concept for tumor antigen cross-sensitization: NR2F6-modified (but not WT) CAR-T therapy can effectively preheat inactive "cold" TIME, serving as a prerequisite for tumor antigen cross-sensitization. NR2F6 can enhance antitumor activity. crispr- / - (But not the control WT) CAR-T treated mice effectively sensitized endogenous T cell compartments against multiple PanCO2 tumor antigens within 3 weeks of NR2F6-modified CAR-T therapy in vivo. A) Experimental setup and timeline. Ly5.1 mice were used as recipients to track Ly5.2 CAR-T cells from Cas9 transgenic mice. B) Day 8 post-tumor inoculation, from NTC - and NR2F6 crispr- / -.sg03UMAP and FLOWsome analyses were performed on the spleens of wild-type tumor-bearing mice treated with CAR-T cells. The expression of 16 markers was analyzed using full-spectrum flow cytometry (Cytek Aurora). NTC - and NR2F6 crispr- / - The groups were cascaded to produce seven distinct populations (C), which were then classified by marker intensity (D). For those from NTC... - and NR2F6 crispr- / - Genotype-specific UMAP was performed on the spleens of CAR-T-treated wild-type tumor-bearing mice. E) Data were pooled from three spleens. F) CD11c+CD8 multicolor flow cytometry data. + Manual gating of XCR1+cDC1. G) Granulase B ELISPOT. Wild-type mice carrying PanCO2-EpCAM+ tumors (n=5) without CAR-T cells (using PBS) or with CD8 + CAR-T cells (NTC) - and NR2F6 crispr- / - Processing. Data is presented as mean ± SEM. p<0.05, p<0.01, p<0.001.
[0244] Figure 13 NR2F6-modified CAR-T therapy resulted in complete responders exhibiting superior immune responses to EpCAM-negative tumors identified by scRNA sequencing. A) CD45 from tumor-bearing NR2F6-modified CAR-T therapy complete responders (CR) (second rechallenge) and naïve mice. + TIL was used for scRNA-seq and scTCR-seq. Cell annotation and cluster formation, showing initial (vs.) CR. B) Stacked plot showing the proportion of each cell cluster. Asterisks indicate significant differences between groups. C) Dot plot showing comparison of CR with initial proliferation and depletion of CD8. + Differential expression of characteristic genes of T cells. D) ORA project, showing intratumoral proliferation of CD8. + CD8 depletion + Enrichment pathways in macrophages and cDC1 cells. E) TCR scRNA sequencing; comparison of Gini index and Shannon entropy of TCR clonality in naïve and CR tumor-bearing mice. n=4. p < 0.05 p < 0.01, p < 0.001.
[0245] Figure 14NR2F6 directly blocks DNA binding and the transactivation of TCF-1. During prolonged stimulation, NR2F6... crispr- / - CAR-T cells exhibit sustained TCF1 DNA binding. TCF-1 is a precursor to CD8+. + A key regulator of clonal memory and exhaustion resistance in T cells. This biochemical mechanism can at least partially explain the mechanistic changes observed in metabolic alterations, and subsequently, the exhaustion resistance of NR2F6- / - CAR-T cells. (A)NTC - and NR2F6 crispr- / -小鼠 CAR-T cells were maintained in culture with IL-7 and IL-15, or co-cultured in vitro with PanCO2-E pCAM for 4 days (long-term stimulation). Nuclear extracts were isolated, and TCF1 was subjected to electromigration assay (EMSA). Stimulated NR2F6 cells showed significantly higher activity compared to controls. crispr- / - DNA binding in CAR-T cells was significantly enhanced. Equal loading of nuclear cell extracts was controlled by Western blotting (WB) of HDAC. A representative experiment from the three assays is shown. B) EMSA quantification of TCF1 DNA binding in PanC-co-cultured CAR-T cells. C and D) Consistently, promoter reporter gene assays were performed using the human leukemia cell line Jurkat (expressing human NR2F6 or human TCF1 WT or mutant protein ectopically) to confirm functional crosstalk between human NR2F6 and human TCF1 at transcriptional levels. This is shown by EMSA (C) and transcriptional activity (D) readings. In summary, this NR2F6:TCF1 crosstalk appears to be centrally involved in regulating CD8. + T cell metabolic fitness and exhaustion recovery. Mechanistically, NR2F6 acts as a cofactor and / or regulator of TCF1, and specifically participates in regulating TCF1 DNA binding during prolonged antigen stimulation.
[0246] Figure 15When stimulated by antigen receptors, primary T cells edited with the human NR2F6 gene showed a significantly enhanced effector response, which could be further enhanced by combined inhibition with CBLB. The combined NR2F6 and CBLB inhibition in primary human T cells synergistically promoted antigen receptor signaling in primary human T cells, thereby validating the concept of the combined CAR-T therapy of this invention. (A) Experimental setup: NR2F6 was knocked out by lentiviral integration of Cas9, sgRNA, and puromycin resistance genes in human leukemia Jurkat cells. (B) Confirmation of NR2F6 knockout by Western blotting (n=5 replicates, from 4 generations of cells). (C) Experimental setup: NR2F6 was knocked out in primary human T cells by lentiviral knockout. (D) Expression of CD69, IL-2, IFNγ, and GrzB was analyzed by flow cytometry after 4 h of restimulation with 0.3125 μg / mL anti-CD3 and 1 μg / mL anti-CD28 antibodies in the presence of a Golgi stop / plug. n=5 donors. Data are presented as mean ± SEM with individual data points. p < 0.05; p < 0.01; p < 0.001; p < 0.0001; ns = not significant; paired t-test (two-tailed).
[0247] Figure 2 This diagram illustrates the immunogenic cell death (ICD) effect mediated by NR2F6-modified CAR-T cells of the present invention. The NR2F6-modified CAR-T cells of the present invention activate innate immune cells in the immune microenvironment of solid tumors, triggering robust cross-sensitization of endogenous T cell compartments, tumor epitope diffusion, followed by immune cell infiltration and rejection of CAR-targeted antigen-negative tumors, which are typically found in antigenically heterogeneous solid tumors. Therefore, the ICD mediated by NR2F6-modified CAR-T cells of the present invention enhances cross-sensitization of multiple tumor antigens (advantageously, tumor antigens expressed on the surface or intracellularly in tumor cells), which significantly broadens the TCR pool (polyclonal nature) of anti-tumor T cells in the endogenous immune system, thereby coordinating a secondary and more robust systemic immune response. This demonstrates the ability of the NR2F6-modified CAR-T cells of the present invention to induce tumor antigen-specific polyclonal immune memory responses, thereby providing durable immunotherapeutic results capable of effectively eliminating heterogeneous solid tumor cells.
[0248] Example
[0249] The invention is demonstrated through the embodiments disclosed herein. The provided embodiments represent specific implementations and are not intended to limit the scope of the invention. These embodiments should be considered as providing non-limiting illustrations and technical support for carrying out the invention.
[0250] method
[0251] animal
[0252] Female C57BL / 6, B6(C)-Gt(ROSA)26Sorem1.1(CAG-cas9) , -EGFP)Rsky / J, Ly5.1 and NR2F6 - / - Mice are housed in cages of up to 5 or 10 mice under specific pathogen-free (SPF) conditions and are housed in-house at the Innsbruck animal facility. Animals are frequently controlled by facility staff and inventors. All animal experiments are conducted in accordance with European guidelines and approved by the Austrian Federal Ministry of Education, Science and Research (2023-0.203.973).
[0253] cell lines
[0254] The PanC02-EpCAM cell line, derived from mouse pancreatic ductal adenocarcinoma, was a gift from Sebastian Kobold of LMU (Munich). PanC02-EpCAM-negative cells were enriched using flow sort. PanC02-EpCAM cells expressing the fluorescent protein GFP were generated via retroviral transduction using the pMP71-GFP (Sebastian Kobold) construct. GFP+ PanC cells were enriched using flow sort. Mouse tumor cell lines were maintained in DMEM + 10% fetal bovine serum (FCS) + 2 mM L-glutamine (L-Glut) + 100 U / mL PenStrep, further designated as DMEM+++. PlatinumE (PlatE) cells, obtained from Cell Biolabs, were cultured in DMEM++ (further designated PlatE medium) supplemented with 1 μg / mL puromycin (Merck) and 10 μg / mL blastomycin (Sigma) to ensure transgene expression. All cell lines are typically cultured in T175 tissue culture flasks (Sarstedt), passaged every 2 days, and regularly checked for mycoplasma infection.
[0255] Cell line passage and harvesting
[0256] Passaging of adherent cell lines is as follows: Wash the cell culture vessel (usually a T175cm tissue culture flask) once with 6 mL of warm 1x phosphate-buffered saline (PBS), then digest with 3 mL of TrypLE Express (Thermofisher) at 37°C for a few minutes until the cells begin to float. Stop the reaction by adding twice the volume of cell culture medium. Transfer the cell suspension to Falcon tubes and centrifuge at 1250 rpm for 5 minutes at room temperature (RT). Then, for assays, in vivo experiments, or resuspend in 1 mL of cell culture medium and separate accordingly: tumor cells are typically 1:10, and PlatE is 1:5, depending on the application.
[0257] Primary mouse CD8 + T cell isolation
[0258] Using CD8a + T-cell isolation kit (Miltenyi) isolates CD8 cells from primary mice using negative selection. + T cells. In short, mice were euthanized and the spleen and lymph nodes were removed. After pressing the organ through a sieve to obtain a single-cell suspension, the cells were resuspended in 3 mL of Erylysis buffer / spleen and incubated at room temperature for 5 min. The reaction was stopped by adding twice the volume of buffer C (PBS supplemented with 0.5% bovine serum albumin [BSA] and 2 mM EDTA). Splenic cells were counted according to the manufacturer's instructions and incubated with antibodies and magnetic beads. CD8+ cells were then added to an LS column (Miltenyi) placed on a strong magnet. + T cells were separated from the remaining cells. The column was washed twice with 3 mL of buffer C, and the eluent was collected. The enriched CD8 cells were then analyzed using a LUNA automated cell counter (Logos Biosystems). + T cell counting is performed and used for downstream applications. FACS analysis is frequently used to check the purity of enriched T cells.
[0259] plasmids and constructs
[0260] For retroviral production, the pMP71 backbone is used for all transfections. The second-generation αmEpCAM chimeric antigen receptor (CAR) consists of a single-stranded variable fragment (scFv) fused to the CD8 hinge and CD28 transmembrane region, targeting the mouse EpCAM protein. Intracellularly, this CAR consists of a CD28 co-stimulatory domain and a CD3ζ stimulatory domain. For detection, a myc tag is inserted between the scFv and the hinge region. The pMP71-GFP plasmid is used as a control and for transducing tumor cell lines. All plasmids are visualized and generated at https: / / benchling.com.
[0261] PlatE cell transfection and virus production
[0262] For optimal virus production, split PlatE cells three times a week and culture them for no more than 12 weeks after thawing, as recommended by the supplier. One day before transfection, prepare 8 × 10⁸ cells... 5 PlatE cells were seeded into PlatE medium in 6-well plates treated with tissue culture and incubated overnight at 37°C and 5% CO2 to achieve approximately 70% confluence. On the day of transfection, the PlatE medium was discarded, and 3 mL of antibiotic-free DMEM supplemented with 10% FCS and 2 mM L-Glut was added to each well. Transfection was performed using the calcium precipitation method: 15 μL of calcium chloride (2.5 M) was mixed with 18 μg of transfer plasmid (pMP71-CAR or pMP71-CAR-GFP) and ddH2O in each well to a final volume of 150 μL. This mixture was slowly added dropwise to 150 μL of transfection buffer (1.6 g NaCl, 74 mg KCl, 50 mg Na2HPO4, and 1 g HEPES [all Sigma Aldrich] in 100 mL H2O, pH 7.1) while continuously vortexing. The mixture was incubated at room temperature for 30 min. Then, 300 μl of the transfection mixture was added to PlatE cells and incubated at 37°C and 5% CO2 for 6 hours. After incubation, the culture medium was discarded, 3 mL of DMEM++ was added, and the plate was placed at 37°C and 5% CO2 for 42 hours.
[0263] CD8 + T cell activation and CAR transduction culture
[0264] The 12-well plate was incubated overnight at 4°C with 5 μg / mL αCD3 antibody (BioXCell) in PBS solution. After negative selection on day 0, CD8... + T cells at a rate of 3 × 10 6 / mL was resuspended in CAR RPMI (RPMI 1640 + 10% FCS + 100UI / mL penicillin / streptomycin + 2mM L-glutamine + 1mM sodium pyruvate + 1mM HEPES + 50μM 2-mercaptoethanol). The coated plates were washed twice with 1x PBS, and then 3×10 6 T cells were seeded into pre-coated wells of CAR RPMI supplemented with 1 μg / mL αCD28 and 10 ng / mL IL-2. The plates were incubated overnight at 37°C and 5% CO2.
[0265] CD8 + T-cell retroviral transduction and CAR detection
[0266] Typically, CAR-T cells used in in vivo experiments are transduced with CAR and GFP reporter gene together, while CAR-T cells used in in vitro experiments are transduced with CAR only.
[0267] For viral transduction, untreated 24-well plates (Corning) were coated overnight at 4°C with 12.5 μg / mL reverse transcription solution (Takara) in 1x PBS. The next day, the plates were blocked at 37°C for 30 min with 2% BSA fractionated ddH2O. Simultaneously, the supernatant containing CAR viral particles was harvested from PlatE cells and filtered through a 0.45 μm cellulose acetate syringe filter (Sartorius). 2 mL of fresh DMEM+++ was added to PlatE cells, and the supernatant was harvested again after 24 hours. After blocking, the plates were washed with 1x PBS supplemented with 25 mM HEPES, and finally, 2 mL of viral supernatant was added to each well of the RN-coated plate, and the plates were centrifuged at 3000 x g for 2 hours at 4°C.
[0268] One hour before the end of centrifugation, CD8 was prepared. + T cells. Approximately 22 hours after plate-bound activation, T cells were harvested and counted using a LUNA automated cell counter. T cells were adjusted to 1 × 10T in CAR RPMI supplemented with 10 ng / mL IL-2 and mouse αCD23 / CD28 activating magnetic beads (Gibco) at a ratio of one bead / T cell (25 μl bead solution / mL). 6 / mL. After centrifugation, discard the viral supernatant, add 1 mL of T cell suspension to each well, and centrifuge at 800 xg for 30 min at 32°C in a benchtop centrifuge. Then incubate the plates overnight at 37°C with 5% CO2. The next day, harvest the viral supernatant from PlatE cells again and filter it through a 0.45 μm cellulose acetate syringe filter (Sartorius). Mix 0.5 mL of the supernatant containing viral particles with 0.5 mL of CAR RPMI, and add 1 mL of the mixture directly to the T cells. Then, centrifuge the plates a second time at 800 xg for 30 min at 32°C, and incubate for another 5 hours. After this final incubation, harvest the T cells, remove the activation beads, and count the T cells. Then, adjust the cell density to 1.5 × 10⁶ cells / mL in CAR RPMI supplemented with 10 ng / mL interleukin-15 (IL-15) and interleukin-7 (IL-7). 6 / mL, and inoculated into 24-well or 12-well plates. Cultures were maintained at 1.5 × 10⁻⁶ mL in medium containing IL-15 and IL-7. 6 / mL.
[0269] Transduction efficiency was assessed using αmyc-FITC antibody (Miltenyi; 1:400) or by flow cytometry with GFP.
[0270] For in vitro experiments, CAR-T cells were used on day 5 post-isolation, while for in vivo experiments, CAR-T cells were used on day 7.
[0271] Genome editing of CAR-T cells using CRISPR / Cas9
[0272] For CD8 + Rapid depletion of NR2F6 in (CAR) T cells was addressed using the NR2F6 / Cas9 system. In this study, (CAR) T cells from Cas9 transgenic mice were electroporated with synthetic NR2F6-targeting single-guide (sg)RNA (Horizon Discovery) at 48 hours post-T cell activation using an Amaxa mouse T cell nuclear factor kit (both from Lonza Biosciences) on a nuclear transfection 2b device. Different types of guides with different cleavage sites in the NR2F6 gene were used in this study. sgRNA 3 (sg03) was used directly, while cripr(cr)RNA 4 (crRNA 4) and non-targeted control (NTC) crRNA were compared with their corresponding tracer RNAs to generate fully qualified sgRNAs. Therefore, a 1:1 solution of 200 μM crRNA and 200 μM tracer RNA was heated to 95°C in a thermal cycler and then cooled to room temperature to allow for adequate complexation.
[0273] Five hours after the second centrifugation and transduction, the transduced T cells were harvested and counted. 7 × 10⁻⁶ cells were then... 6 Up to 1×10 7 T cell pellets were collected and transfected with 3.1 μM NR2F6 or NTC sgRNA solution. T cells were electroporated using the X-001 program on a Nucleofector 2b device (Lonza) and immediately recovered in 12-well plates supplemented with 10% FCS, 2 mL M L-Glut, 100 IU / mL Pen / Strep, and media components A and B, according to the manufacturer's protocol. After standing for 1 hour, 1 mL of CAR RPMI containing 20 ng / mL IL-7 and IL-15 was added to each mL of T cells. T cells were passaged the following day.
[0274] NR2F6-crRNA4 5' CTCAAGAAGTGCTTCCGGGT 3' (SEQ ID No. 1);
[0275] NR2F6-sgRNA3 5'CCGCAATCTCAGCTACACCT 3'U (SEQ ID No. 2).
[0276] Evaluation of gene editing efficiency
[0277] On day 5 post-electroporation, genomic (g)DNA was isolated from one million highly transduced gene-edited T cells using the NucleoSpin Tissue Kit (Macherey-Nagel) according to the manufacturer's instructions. PCR amplification of the NR2F6 sgRNA-targeted locus was performed in 20 μl reactions using a 100 ngg DNA template from NR2F6 and samples treated with NTC sgRNA. Cycling conditions were as follows: 98°C for 10 s, 66°C for 10 s, 72°C for 12 or 13 s, followed by a final extension step at 72°C for 60 s, for a total of 30 cycles. Annealing temperature was determined using the T from Thermofisher. m The online calculator was evaluated (Thermo F. Tm Calculator [Online Tool] [from: https: / / www.thermofisher.com / at / en / home / brands / thermo-scientific / molecular-biology / molecular-biology-learning-center / molecular-biology-resource-library / thermo-scientific-web-tools / tm-calculator.html). The extension time (15 seconds / kbps) was calculated according to the manufacturer's protocol. PCR products were cleaned using the PCR Clean Up kit according to the manufacturer's instructions (New England Biolabs). The purified DNA fragments were Sanger sequenced by Eurofin Genomics. Data were analyzed using the TIDE algorithm to track insertions / deletions (Brinkmann et al., 2014).
[0278] sgRNA3 forward primer: GGTGAGCCACTAAGTTGGCC (SEQ ID No. 3), sgRNA3 reverse primer: AGCACCTGCACGCATGTATC (SEQ ID No. 4). cRNA4 forward primer: ATGGGGCTGGTGTTCTCAGA (SEQ ID NO. 5), crRNA4: reverse primer CTCTGAGTGGCTGCCTCCAGGT (SEQ ID NO. 6).
[0279] Tumor inoculation and ACT using gene-edited CAR-T cells
[0280] PanC02-EpCAM was cultured as described above, and EpCAM expression was examined by flow cytometry prior to injection. The day before, tumor cells were separated at a 1:2 ratio to ensure sufficient in vivo transplantation. Several days prior to tumor cell injection, mice used in in vivo experiments were shaved to reduce stress. To simulate clinical conditions, 1 million PanC02-EpCAM tumor cells were subcutaneously injected (sc) into the right abdomen of 8- to 12-week-old immunocompetent female mice. Two days later, when the tumor reached approximately 50 mm... 3 Based on tumor size, tumor-bearing mice were randomly assigned to different treatment groups and intravenously (iv) injected with 3.6 × 10⁻⁶ ppm of PBS. 6 CAR-T cells edited with NTC or NR2F6 CRISPR / Cas9 genes. As controls, NTC- and NR2F6-depleted polyclonal T cells were injected into tumor-bearing mice. Tumor growth and mouse weight were assessed three weeks weekly using electronic calipers and a scale, and tumor size was calculated using the following formula: Tumor measurements were performed using a blind method. When a tumor exceeding 1500 mm was observed... 3 Mice were euthanized when they lost 20% of their body weight or when the animals were morbid. For survival analysis, tumor size was collected in the Kaplan-Meier plot.
[0281] For the use of immunodeficient RAG1 - / - In the mouse experiment, 5 × 10 5 Animals were inoculated with PanC02-EpCAM, and on day 2 after tumor injection, 1×10 6 Treatment of gene-edited CAR-T cells.
[0282] CAR-T cells and innate immune cells were detected in tumor-bearing mice using multicolor flow cytometry.
[0283] As described above, Ly5.1 receptor mice were stimulated with PanC02-EpCAM tumors and treated with NTC or NR2F6-depleted CAR-T cells two or three days later.
[0284] For CAR-T cell assays over time, blood was collected from tumor-bearing mice on days 6 and 13 post-tumor injection using a lancet and EDTA-containing blood collection tube. Red blood cells (RBCs) were lysed using 40 μL of blood and internal Erylysis buffer. Cells were thoroughly washed with buffer C and then FcR-blocking agent (BD) was added to prevent nonspecific binding. Cells were then stained for viability using fixable viability staining agent (FVS) 780 (1:2000) and the following surface antibodies: CD45.1 Pb (Biolegend; 1:200), CD45.2 PE (eBiosciences; 1:100), CD4 V500 (BDBiosciences; 1:400), CD8 APC (Thermo Scientific; 1:200), and CD3 PeCy7 (eBiosciences; 1:200). Samples were then run at a moderate flow rate on a BD FACS Canto II. CAR-T cells were identified by CD45.1-CD45.2+GFP+ staining in FlowJo software (v10.9.0).
[0285] To analyze the compartments of innate immune cells, this invention uses a multicolor FACS system. Therefore, mice were sacrificed on day 8 post-tumor injection. Spleens were harvested and sieved through a mesh to produce a single-cell suspension. After RBC lysis, spleen cells were counted, and 2 × 10⁻⁶ cells were collected. 6 The antibody was transferred to a 96-well circular plate and stained for viability using FVS440 according to the manufacturer's instructions (1:1000; BD Biosciences). Next, FcR blocking agent was added, followed by 50 μL of the total antibody mixture.
[0286] Use the following antibodies:
[0287]
[0288] Notably, bright staining buffer (1:10; BD Biosciences) was added to the antibody mixture to prevent clogging by the bright stain. After 20 min of incubation, the cells were washed twice and acquired on a Cytek Aurora machine (5-laser configuration). Separation was performed using a mixture of cell and magnetic bead samples, and single-stained cell samples were examined. A fluorescence minus one (FMO) control was used to validate the population. Data were analyzed in FlowJo (v10.9.0).
[0289] Interferon-gamma blocking experiment
[0290] As described above, mice carrying PanC02-EpCAM tumors were treated with CAR-T cells edited with NTC or NR2F6. Starting from the day of ACT, the animals were injected intraperitoneally (ip) with 200 μg / mL αIFNγ or IgG solution (BioXcell) every other day for a total of 4 times. Tumor growth and body weight were monitored frequently, and mice were sacrificed if the termination criteria were met.
[0291] Tumor re-activation without remission
[0292] Prior to re-challenge, EpCAM-positive and EpCAM-negative cells of PanC02-EpCAM tumor cells were enriched using flow sorting and maintained in DMEM++. Thirteen weeks after the first tumor challenge, mice that showed complete remission (CR) after treatment with acutely depleted CAR-T cells of NTC and NR2F6 were injected with 2.5 × 10⁻⁶ cells into their right and left flanks, respectively, after examination by a veterinarian at the Innsbruck Animal Center. 6 One EpCAM positive and 1×10 6 EpCAM-negative PanC tumor cells were collected. Female C57BL / 6 mice with "PanC initiation" were used as controls and injected with the same tumor load. Tumor-bearing mice were monitored as described above.
[0293] Retroviral transduction of tumor cell lines
[0294] Supernatant containing retroviruses was produced as described above. For PanC02-EpCAM-GFP: PlatE cells were transfected with 18 μg of transfer plasmid (pMP71-GFP) to generate viral particles. One day before transduction, PanC cells were seeded into 6-well plates and incubated overnight at 37°C and 5% CO2. The next day, the medium was replaced with 2 mL of DMEM+++ supplemented with 8 μg / mL polybrene. Then, 2 mL of filtered viral supernatant was added directly, and the plates were centrifuged at 800g for 2 hours at 32°C. Transduction efficiency was assessed by flow cytometry, with 70% being GFP-positive. GFP+ cells were enriched by flow cytometry sorting.
[0295] Incucyte Continuous Kill Test
[0296] To ensure sufficient target expression, PanC02-EpCAM-GFP was flow cytometry-sorted one week prior to the experiment. Tumor cells were stained with αEpCAM-APC (Miltenyi; 1:400), and the EpCAM-high GFP-positive population was sorted directly in DMEM+++ on the FACS Aria (Beckton and Dickinson) machine at the FACS Core Laboratory (Dr. Sopper) of the Medical University Innsbruck. The flow cytometry-sorted tumor cells were then processed at 1×10⁻⁶. 6 Cells were cultured in T175 tissue culture flasks and then expanded for serial killing assays. On day one of the assays, 6 × 10⁶ cells were cultured in T175 tissue culture flasks. 4 PanC-EpCAM hi -GFP cells were seeded into CAR RPMI in 96-well flat-bottom plates and allowed to adhere for several hours.
[0297] After CAR-T production and evaluation of transduction efficiency (~70%), a large number of transduced T cells were counted and adjusted to 3 × 10⁻⁶. 6 CAR+ / mL. Then, tumor cells were supplemented with 3×10⁻⁶ CAR RPMI at a 5:1 effector:target ratio (E:T) in cytokine-free CAR RPMI. 5 CAR-T cells. Live cell imaging was performed using the Incucyte® live cell analysis system (Sartorius) with a 10x objective. Fluorescence images were taken every two hours for up to 10 days.
[0298] Every 48 hours, co-cultures were retrieved from the Incucyte machine, and CAR-T cells were re-stimulated with fresh target cells. For this purpose, PanC-EpCAM was harvested from T175 tissue culture flasks. hi -GFP cells, and at 6×10 5 / mL resuspended in CAR RPMI. 100 μl of culture medium was removed from the co-culture and stored at -20°C for cytokine assessment. Then, 100 μl of tumor cell suspension was added, and the plate was returned to the Incucyte. At least one hour was allowed between re-enlargement and the next scan to allow tumor cells to settle.
[0299] Cytotoxicity was determined by reducing GFP fluorescence and plotted relative to the first scan after each re-excitation (integrated green intensity / mm). 2(Compared to the first scan after re-excitation). Analysis was performed using the built-in analysis software (Sartorius). CAR-T cells from a single mouse were obtained in duplicate and considered biological replicates.
[0300] Antibody staining on the surface and inside of mouse CAR-T cells
[0301] In 96 circular base plates (Thermo Fisher), using up to 1×10 6 (CAR)T cells were stained.
[0302] For viability assessment, T cells were washed twice with Hanks' buffered saline (HBSS) containing magnesium and calcium. Then, 100 μl of HBSS supplemented with a final dilution of 1:2000 containing a viability-fixing dye (BD Bioscience) was added, and the cells were incubated in the dark at room temperature for 10 min. After incubation, the cells were washed with buffer C and stained with surface antibodies. The following antibodies were used to stain the surface antigens for 20 minutes in a reaction solution of 40 μL in buffer C at 4°C: myc-FITC (Miltenyi, 1:400), Ly108-Pb (Biolegend, 1:200), PD-1-bv510 (Biolegend, 1:200), Tim3-PerCp-Cy5.5 (Biolegend, 1:200), Lag3-Pe-Cy7 (Biolegend, 1:200), CD39-PE (Biolegend, 1:400), CD45-APC (Biolegend, 1:200), CD44-PeCy7 (Biolegend, 1:200), and CD62L-APC (Biolegend, 1:200).
[0303] For intracellular (IC) cytokine staining, CAR-T cells were transferred to 96-well round-bottom plates and stained with surface antibodies as described above. Cells were fixed for 20 minutes using a fixation kit from Biolegend. After fixation, cells were permeabilized by washing twice with Perm / Wash buffer from the kit. In Perm / Wash buffer, intracellular proteins were stained at 4°C for at least 30 min to 1 h using the following antibodies: IFNγ-PeCy7 (Biolegend; 1:200), TNFα-PerCpCy5.5 (Biolegend; 1:200), IL2-APC (Biolegend; 1:200), and GzmB-PE (Biolegend; 1:200).
[0304] For intracellular transcription factor staining, PanC-EpCAM was used.hi -GFP long-term stimulation of CAR-T cells. On the fourth day of co-culture, wells were collected and transferred to 96-well round-bottom plates for surface antigen staining. Finally, cells were fixed at 4°C for 30 min using a Foxp3 fixation kit (eBiosciences). Cells were permeabilized twice with Perm / Wash and stained with IC antibodies at 4°C for 1 hour: TCF7-Pb (Cell Signaling; 1:100) and TOX-APC (Miltenyi; 1:100).
[0305] After antibody staining, the cells were washed twice and resuspended in 200 μl of buffer C, and then collected on FACS Canto II (BD Biosciences).
[0306] For absolute cell counting, Biolegend precision counting microspheres were used. Therefore, cells were stained directly in the culture medium at 4°C for 20 min. Plates were centrifuged, and cells were resuspended in 100 μL of buffer C. 100 μL of Biolegend precision counting microspheres were added to each sample, and the cells were collected on a FACS Canto II. Total cell counts were calculated according to the manufacturer's recommendations.
[0307] Data were analyzed using FlowJo software (BD Biosciences, version 10.9.0).
[0308] Cytokine production trials
[0309] On the 5th day of CAR-T production, 6×10 4 PanC-EpCAM hi -GFP cells were seeded into 96-well flat-bottom plates and incubated for several hours to allow them to adhere. Then, 3 × 10⁻⁶ cells were added at a 5:1 effector:target (E:T) ratio. 5 CAR+ T cells were incubated overnight in CAR RPMI without cytokines. The next day, 6 hours before antibody staining and IC FACS analysis, Golgi Plug and Stop (1:250 and 1:500; BD Bioscience) were added.
[0310] Gasdermin E shear test
[0311] 1.5×10 6 CAR-T cells and PanC-EpCAM hi -GFP was co-cultured in 24-well plates at a 5:1 E:T ratio. Every other day, 3 × 10⁻⁶ mg / L of GFP was added. 5Fresh tumor cells were used to restimulate CAR-T cells. On day 4, 6 hours after restimulation, the cells were harvested from the wells via trypsin digestion. Briefly, cell culture medium was collected in 15 mL Falcon tubes, the wells were washed with 1x PBS, and 400 μL of TrypLE Express was added to each well. When adherent cells began to detach, 800 μL of CAR RPMI was added to stop the reaction, and the medium was transferred to 15 mL tubes. After washing with ice-cold 1x PBS, the cells were resuspended in 30 μL of RIPA buffer supplemented with a mixture of EDTA and protease inhibitors (Sigma) and incubated on ice for 30 min with frequent vortexing. The lysates were then centrifuged at 15000 x g for 15 min at 4 °C. The supernatant was transferred to a buffer supplemented with 5 μL of Pierce... TM Samples were placed in new 1.5 mL Eppendorf tubes containing lane label reduction sample buffer (Thermo Fisher Scientific) and frozen at -80°C. After thawing, the samples were heated to 95°C and immunoblotted using the following antibodies: Gasdermin E (Abcam, 1:1000) and actin (Santa Cruz; 1:1000). Bands were quantified using ImageJ and visualized using GraphPad Prism.
[0312] UMAP and FlowSOM analysis
[0313] Unmixed files in the multicolor FACS panel of this invention were gated with live CD3-CD19-NK1.1- cells, and the populations were downsampled using the DownSample (v3.3.1) plugin in FlowJo to obtain uniform representation. Downsampled populations of three independent mice from each treatment regimen were cascaded, and Uniform Manifold Approximation and Projection (UMAP) analysis (v4.1.1) was applied using the following parameters: CD11b, CD11c, XCR1, CD8, CD4, Ly6c, F4 / 80, MHCII, CD86. Clusters were defined using the FlowSOM plugin (v4.1.0) in FlowJo (v10.9.0).
[0314] Detection of cytokines in supernatant
[0315] Cytokine release in the supernatant was measured using Luminex xMAP technology. Briefly, the frozen supernatant was thawed and diluted in CAR RPMI. Assays for INFγ (Biorad) and GzmB (ThermoFisher) were performed on a Bio-Plex 200 instrument (Biorad) according to the manufacturer's instructions. Absolute concentrations were determined using standard curves and plotted in GraphPad Prism (v9.5.1).
[0316] RNA isolation and qRT-PCR
[0317] To evaluate NR2F6 induction during CAR-T production, 1-2 × 10⁻⁶ samples were harvested. 5 Each T cell was washed once with 1x PBS and resuspended in 350 μL RLT buffer (Qiagen) and stored at -80°C.
[0318] For co-culture samples, cells were harvested and viable (CAR)T cells were enriched by density gradient centrifugation. Briefly, cells were resuspended in 80% Percoll solution (Sigma Aldrich) in HBSS. A 40% Percoll layer was loaded onto the top and centrifuged at 250g for 30 minutes without a brake. After centrifugation, the interfacial layer was harvested and CAR-positive selection was performed using α-biotin microbeads (Miltenyi) and αmyc-biotin (Biolegend; 1 μg / mL) according to the manufacturer's instructions. Then 1–2 × 10⁻⁶ cells were added. 5 One CAR+ T cell was resuspended in 350 μL of RLT buffer and stored at -80°C.
[0319] For quantitative real-time PCR (qRT-PCR), total RNA was isolated using the RNeasy Mini kit (Qiagen) according to the manufacturer's instructions, and cDNA was synthesized using the Omniscript RT kit (Qiagen) in 20 μL reactions with random hexamers and poly-A primers. qRT-PCR was performed twice on a 7500 Real-Time PCR instrument (Applied Biosystems) using the LUNA Mastermix (New England Biolabs) and pre-designed NR2F6 Taqman primers (Fisher Scientific). Target gene expression was normalized to Rlp13a using the ΔΔct method. A Ct value greater than 32 was considered as no expression. Primers used for qPCR: Mm01340321_m1, Mm01612986_gH
[0320] Hippocampus test
[0321] To analyze oxidative phosphorylation (OxPhos), 2 × 10⁻⁶ 5 (CAR)T cells were seeded into polylysine-pre-coated Seahorse culture plates in XF RPMI without phenol red and supplemented with 20 mM glucose, 2 mM glutamine, and 1 mM pyruvate (all Agilent). Experiments were performed using a mitochondrial stress assay kit on a hippocampal XFp device (Agilent). Briefly, the hippocampal plates were placed in a CO2-free incubator for 1 hour to allow for equilibration. Mitochondrial respiration was first analyzed by assessing basal respiration, followed by injection of 1.5 μM of the ATP synthase inhibitor oligomycin, 1 μM of the uncoupling agent carbonyl cyanide-4-(trifluoromethoxy)-phenylhydrazone (FCCP), and finally 0.5 μM rotenone / antimycin A. Results were analyzed using SeahorseWave software (Agilent) and visualized in GraphPad Prism.
[0322] Flow cytometry sorting of tumors and CAR-T cells
[0323] PanC02-EpCAM tumor cells were harvested as described above. The cells were then transferred to FACS tubes, with a maximum of 1 × 10⁻⁶ cells per tube. 7 One cell line was stained in 100 μl of buffer C containing αEpCAM-APC (Miltenyi, 1:400) antibody at 4°C for 20 minutes. After incubation, PanC cells were washed twice with buffer C, and finally stained with 1×10⁻⁶ saturated solution. 7 / mL resuspended in ice-cold DMEM+++ supplemented with 2mM EDTA. Harvest CAR-T cells from the co-culture and transfer them to FACS tubes for antibody staining. Up to 10 7 One cell was resuspended in 100 μl of buffer C containing αmyc FITC (Miltenyi, 1:400), αCD45 APC-Cy7 (Biolegend, 1:200), and αEpCAM APC (Miltenyi, 1:400) and incubated at 4°C for 20 min. The cells were then washed twice with buffer C and incubated with 1×10⁻⁶ cells / mL. 7 / mL were resuspended in ice-cold CAR RPMI supplemented with 2mM EDTA. Cells were flow cytometry sorted using the BD FACS Aria (Beckton and Dickinson) at the FACS Core Laboratory of the Medical University of Innsbruck. For viability staining, 10 μl of 4′,6-diamidinyl-2-phenylindole (DAPI) was added directly to 1 ml of cell suspension prior to collection. Viable EpCAM-positive tumor cells were directly sorted into DMEM+++ and immediately seeded into T175 flasks after sorting. 1×10 5 One surviving CD45+ CAR+ T cell was directly sorted into 200 μl RLT buffer (Qiagen) in 0.5 mL Eppendorf tubes without RNase, supplemented with 5 μL of 14.3 M 2-mercaptoethanol (βME) and 2.5 μL of RNAsin (Promega) for batch RNA sequencing (RNAseq).
[0324] Batch RNA sequencing
[0325] For batch RNA sequencing (RNAseq), total RNA was isolated using the RNeasy Micro Kit (Qiagen) according to the manufacturer's instructions. RNA was eluted in the kit's elution buffer and stored at -80°C before quality control (QC). Quality control, library preparation, and sequencing were performed by the MultiOmics Core Laboratory at Innsbruck Medical University.
[0326] Statistical analysis
[0327] Statistical analysis was performed using GraphPad Prism software (v9.5.1). Unless otherwise stated, data are presented as mean ± standard error of the mean (SEM). Comparisons between two groups were calculated using a two-tailed unpaired Student's t-test or a nonparametric Mann-Whitney test, as illustrated in the legend of the attached figures. Two-way ANOVA with Geisser-Greenhouse correction was used to analyze comparisons between two or more groups with different variables. In the case of multiple comparisons, corrections were performed using the Šídák method. Batch RNA sequencing and scRNA sequencing data were analyzed as described above. Survival data were collected from Kaplan-Meier curves and tested using the log-rank test. A p-value <0.05 was considered significant. p≤0.05, p≤0.01, p≤0.001, p≤0.0001
[0328] Human cell culture
[0329] Jurkat-TAg T cells were cultured in RPMI-1640 supplemented with 10% FCS, 2 mM L-Glut, 100 U / mL penicillin, 100 μg / mL streptomycin (all from PAN Biotech), 1 mM sodium pyruvate, and 1x non-essential amino acid mixture (Sigma) (cRPMI from here). Primary human T cells (CD3+, sorted from PBMCs; Biolegend, 480131) were cultured in cRPMI containing 10 ng / mL IL-2 (Biolegend; 589106).
[0330] Combination NR2F6 and CBLB inhibition in primary human T cells:
[0331] NR2F6 knockout was achieved through stable integration of the hEF1a-driven puromycin resistance gene and Cas9 with U6-driven sgRNAs (Dharmacon; GSGH11935-247620068 and GSGH11935-247640844 targeting NR2F6; DH-GSGC11963 serving as a non-targeting control). LentiArt was used. TM Lentiviral particles were produced using a viral packaging kit (CreativeBiolabs; CART-027CL) and administered using Lenti-X according to the manufacturer's instructions. TMConcentration was performed using a concentrator (Takara, 631232). Transduction was performed in the presence of 8 μg / mL polybrene (Sigma; TR-1003-G) on primary T cells pre-stimulated with T-activator immunomagnetic beads (Thermo Fisher; 11131D) at a 1:1 cell-to-bead ratio for 1 day. Transduced cells were enriched by treatment with puromycin (1 μg / mL for Jurkat cells and 2.5 μg / mL for primary T cells for 3 days throughout culture). Immunoblot analysis of NR2F6 levels in Jurkat cells was performed using an anti-NR2F6 antibody (60117-2-Ig) from Protintech. NR2F6-deficient primary human T cells were stimulated with 0.3125 μg / mL anti-CD3 antibody and 1 μg / mL soluble anti-CD28 antibody (BioXcell; BE0001-2 & BE0248) coated on plates in the presence of DMSO or 1 μM Nurix, and analyzed by flow cytometry as described above (with the addition of brefeldtamicin A and monensin (BD BioSciences; 555029 & 554724) after 45 min for intracellular staining). The following antibodies were used: CD25 PerCP-Cy5.5 (356112), CD69 A647 (310918), IL-2 PE (500307), IFNγ PE-Cy7 (502528), and grzBFITC (515403) (all purchased from Biolegend).
[0332] Example 1 ( Figure 3 ):
[0333] Reverse transcription polymerase chain reaction (RT-PCR) analysis of tumor-infiltrating lymphocytes (TILs) relative to lymph nodes (draining and non-draining) and spleen provides valuable insights into gene expression profiles and immune responses associated with these different cell types. Tissue Collection: Tissue samples were collected from tumors, draining lymph nodes, non-draining lymph nodes, and the spleen. These tissues represent different microenvironments with varying immune cell populations and activities, thus defining how the tumor microenvironment influences NR2F6 gene expression in infiltrating lymphocytes. RNA Extraction: Total RNA was extracted from each tissue sample. This RNA included messenger RNA (mRNA) and non-coding RNA, which could be analyzed to understand gene expression patterns. Reverse Transcription: The extracted RNA was then reverse transcribed into complementary DNA (cDNA) using reverse transcriptase. This step converts the RNA into a form that can be analyzed by PCR. RT-PCR Analysis: RT-PCR was performed on the cDNA sample from each sample. This technique amplifies and quantifies the selected NR2F6 mRNA levels. The results of the quantitative PCR (qPCR) shown illustrate the NR2F6 gene expression levels. Data Analysis: Statistical analysis was performed on the results of RT-qPCR analysis to compare gene expression profiles among different samples. Findings from the RT-qPCR analysis provided insights into how the NR2F6 gene expression pattern in TILs compared to that in lymph nodes (draining and non-draining) and the spleen, revealing that NR2F6, as an immune-related gene, is strongly upregulated in response to the solid tumor microenvironment.
[0334] Example 2 ( Figure 4 ):
[0335] Metabolic analysis using the Seahorse XFp analyzer is a powerful technique for studying cellular metabolism. The Seahorse XFp analyzer measures the rate of cellular oxygen consumption (OCR) and the rate of lactate production (extracellular acidification rate, ECAR). These parameters indicate different aspects of cellular metabolism.
[0336] Cell seeding: Target cells are seeded onto specialized microplates, which typically contain wells with sensors. These sensors allow for real-time measurement of oxygen and pH.
[0337] Reagent loading: Before the experiment, specific compounds are loaded into the wells of the microplate. For OCR measurements, mitochondrial inhibitors such as oligomycin, FCCP, and antimycin A are used. For ECAR measurements, glycolysis regulators are applied.
[0338] Measurements: During the experiments, the XFp analyzer injected these compounds into wells under specific experimental settings. Seahorse software analyzed the data generated from OCR and ECAR measurements, allowing the present invention to derive key metabolic parameters, including basal respiration, ATP production, proton leakage, reserve respiration capacity, and glycolysis rate. Using these experimental conditions, NR2F6 genetic manipulation defined how NR2F6 negatively impacts the cellular metabolism of primary T cells. This data reveals how NR2F6-modified T cells utilize energy better, adapt better to different environments, and respond better to metabolic stressors. In summary, the Seahorse Stress Assay Kit is a valuable tool for metabolic analysis, providing mechanistic insights into the cellular energy metabolism of NR2F6-modified cells. To maintain CD8... + The killing ability of cytotoxic T cells, especially their killing ability under harsh time conditions, CD8 + Cytotoxic T cells depend on high metabolic activity. Therefore, this invention next uses hippocampal technology to evaluate the metabolic profile of the CAR-T cells of this invention during long-term stimulation. Therefore, this invention uses positive magnetic separation to enrich co-cultures of CAR+T cells and decides to perform hippocampal mitochondrial stress tests on them on day 4 of co-culture, where the invention has observed the greatest difference in the Tpex / Ttex ratio. Analysis showed that NR2F6-modified CAR-T cells exhibited superior stress test curves compared to wild-type CAR-T cells, with higher basal oxygen consumption and maximum oxygen consumption (OCR). Furthermore, knockout CAR-T cells showed a significantly higher extracellular acidification rate (ECAR) due to increased glycolytic potential. Gene ontology of bulk RNA sequencing data from day 4 of long-term stimulation also showed enrichment in various metabolic pathways. GSEA analysis between knockout and wild-type CAR-T cells showed that gene sets associated with oxidative phosphorylation, glycolysis, and fatty acid oxidation (FAO) were significantly upregulated in NR2F6-modified CAR-T cells. The results of this invention demonstrate that NR2F6 knockout in CAR-T cells alters performance by increasing and maintaining the production of effector cytokines, and prevents terminal exhaustion and differentiation, respectively, by preserving Tpex cell pools in vitro. Mechanistically, the loss of the transcription factor NR2F6 leads to metabolic reprogramming, specifically a shift to oxidative phosphorylation and glycolysis to meet energy demands during repeated stimulation.
[0339] Example 3 ( Figure 5 ):
[0340] CAR-T cell co-culture and serial killing assays using IncuCyte involve monitoring the interaction between CAR-T cells and tumor cells over time using live-cell imaging techniques. Cell preparation: CAR-T cells: T cells are isolated, cultured, and engineered to express a chimeric antigen receptor (CAR) specific to the EpCAM tumor antigen. Tumor cells: EpCAM-positive PanC02 tumor cells are cultured and labeled with fluorescent GFP for tracking. Co-culture setup: CAR-T cells and EpCAM-positive PanC02 tumor cells are mixed together in a culture dish or microplate to initiate co-culture. The ratio of CAR-T cells to tumor cells is controlled, typically at different effector-to-target (E:T) ratios, to assess different levels of cytotoxicity. Plating: The co-culture is plated in the wells of a microplate suitable for IncuCyte imaging. These microplates have a transparent bottom for live-cell imaging. Incubation: The plated co-culture is placed in the IncuCyte system within a cell culture incubator. This system maintains controlled temperature, humidity, and CO2 levels. Imaging and Analysis: The IncuCyte system captures images of co-cultures at defined time intervals over hours or days. Images can be analyzed using IncuCyte software to track various parameters such as cell confluence, tumor cell death, and CAR-T cell activity. Continuous killing refers to the observation of multiple rounds of tumor cell killing by CAR-T cells over time. The IncuCyte system generates quantitative data, including kinetic curves of CAR-T cell cytotoxicity, tumor cell death, and other relevant parameters. This assay provides data to evaluate the effectiveness of CAR-T cell-mediated tumor killing at different E:T ratios and time points. In summary, the IncuCyte live-cell imaging system allows for real-time monitoring and quantification of CAR-T cell-mediated tumor cell killing, providing valuable information for optimizing CAR-T cell therapies and understanding their mechanisms of action.
[0341] Example 4 ( Figure 6 ):
[0342] Based on data obtained from scRNA sequencing analysis, this invention investigated NR2F6 depletion in the context of synthetic immunotherapy using chimeric antigen receptor (CAR) T cells. To test the hypothesis, this invention used an investigational second-generation CAR targeting mouse EpCAM. The CAR consists of an scFv region fused with intracellular CD28 and CD3ζ domains via a CD8 hinge and CD28 transmembrane region. This invention used the pancreatic ductal adenocarcinoma PanC02 cell line engineered to express mouse EpCAM as a target. Our laboratory has previously demonstrated that NR2F6 is a negative regulator of T cells, induced by TCR stimulation via αCD3 / CD28. This invention now identifies NR2F6 induction in WT NR2F6-proficient T cells during CAR-T production. A dramatic increase in NR2F6 mRNA levels, up to tenfold, was observed, leading to NR2F6 depletion in the tested CAR-T cells. NR2F6 was not observed during CAR-T production. - / - Or wild-type CD8 + Any differences in CAR transduction efficiency or expansion of T cells. To investigate the quality of tumor cell death induction, this invention quantifies Gasdermin E (GSDME) cleavage during co-culture of tumor cells and NR2F6-deficient or wild-type CAR-T cells (harvested after long-term stimulation), and restimulates with PanC02-EpCAM tumor cells for 6 hours (biological replicates, n=6, two independent experiments). As a significant result, NR2F6-deficient CAR-T cells induced pyroptosis in co-cultured tumor cells. Pyroptosis represents the major form of ICD. Mechanistically, as demonstrated by tumor-inherent GSDME cleavage, increased production of GRZB and IFNγ leads to the desired qualitative alterations in ICD and pyroptosis. These data represent functional validation of the NR2F6 pathway in inducing immunogenic cell death (ICD) in tumor cells via NR2F6-modified CAR-T cells. In summary, NR2F6-modified CAR-T cells exhibited a perforin-granzyme B-dependent killing of their targets, which in turn led to activation of the apoptosis pathway via Caspase 3 and cleavage of gasdermine E (GsdmE) in tumor target cells that ultimately resulted in tumor cell death. Notably, gasdermins (GsdmE) are activated by proteolytic removal of the self-inhibitory C-terminal domain, producing an active N-terminal fragment, thereby converting non-inflammatory apoptosis into pyroptosis, a highly immunogenic form of programmed cell death (Mamokin et al., 2015; Zhan et al., 2020). To further validate the efficacy of NR2F6 at the target tumor cell level... - / -To assess the high-quality killing phenotype observed in CAR-T cells, this invention utilizes Western blotting to evaluate GsdmE cleavage on day four after long-term stimulation in PanC-EpCAM. Quantitative analysis showed that tumor cells co-cultured with NR2F6-modified CAR-T cells exhibited significantly increased GsdmE cleavage activity from full-length GsdmE to N-GsdmE compared to wild-type CAR-T cells.
[0343] Example 5 ( Figure 4 ):
[0344] Batch RNA sequencing (RNA-seq) analysis of gene signatures during T cell exhaustion is a technique for gaining a deeper understanding of the molecular mechanisms and signaling pathways involved in this process. T cell isolation: Isolating T cells, particularly CD8 cells, from mouse tissue or blood samples. + Cytotoxic T cells. RNA extraction and library preparation: Total RNA is extracted from isolated T cells. This RNA includes mRNA transcripts that provide information about gene expression. The extracted RNA is converted into cDNA libraries using reverse transcription. These cDNA libraries represent the transcripts present in the T cells. RNA sequencing: High-throughput RNA sequencing is performed on the cDNA libraries, producing millions of short reads corresponding to the RNA molecules present in the sample. The sequencing data undergoes quality control to remove low-quality reads and ensure data reliability. Alignment: Sequence reads are aligned or mapped to a reference genome or transcriptome to determine which genes are expressed and at what levels. Differential expression analysis: This invention identifies differentially expressed genes associated with T cell activation and exhaustion by comparing gene expression levels between exhausted T cells and non-exhausted T cells (e.g., WT or NR2F6-deficient mice after single or repeated stimulation, respectively). Gene characterization: Researchers define gene characterization by selecting a set of genes that are consistently upregulated or downregulated in activated and exhausted T cells. These characterizations can be used to characterize the exhaustion phenotype. Functional enrichment analysis: Gene ontology (GO) analysis or pathway enrichment analysis is performed to understand the biological processes, molecular functions, and pathways associated with the identified gene signatures. Biological insights: These results allow for deeper understanding of the molecular processes and regulatory networks contributing to T cell activation and exhaustion. In summary, RNA sequencing analysis of gene signatures during T cell exhaustion provides a comprehensive view of gene expression changes in exhausted T cells, helping to understand the underlying biology and potential therapeutic targets for immune-related diseases.
[0345] Granzymes A, C, and D are enzymes found in cytotoxic immune cells, particularly natural killer (NK) cells and cytotoxic T lymphocytes (CTLs). These enzymes play a crucial role in the immune system's defense against tumor cells by inducing cell death in target tumor cells. These granzymes are typically expressed and released into the immune synapse when CTLs recognize and bind to target tumor cells. Once inside the target cell, the granzyme triggers a series of proteolytic events that lead to tumor cell death. Therefore, this process is essential for eliminating cancer cells. Understanding the expression of these granzymes is important in the context of immunology and cancer research because it can inform the development of therapies that enhance anti-tumor immune responses.
[0346] After acute stimulation of CAR-T cells overnight with PanC02-EpCAM at an effector-to-target (E:T) ratio of 5:1, NR2F6 - / - CAR-T cells produced significantly more effector cytokine IFNγ, as assessed by flow cytometry. Using FACS analysis, this invention proposes to determine the phenotypic characteristics of the CAR-T cells of this invention during long-term stimulation. This invention observed that NR2F6 deficiency led to a diminished terminal differentiation status assessed by co-staining of CD62L and CD44. Long-term stimulated knockout CAR-T cells showed a significantly greater number of CD62L / CD44 double-positive cells, which tended to favor a central memory (CM)-like phenotype. This invention then speculates whether this increase in double-positive CAR-T cells with sustained cytokine secretion also contributes to the difference in exhaustion performance. Indeed, when this invention examined PD1+ CAR-T cells, a significant difference in the ratio of progenitor exhausted T cells (Tpex, Ly108+Tim3-) to terminally exhausted T cells (Ttex, Ly108-Tim3+) (Tpex / Ttex) was noted as a potential mechanism for the benefits of NR2F6-modified CAR-T cells. Furthermore, FACS analysis showed that NR2F6- / - CAR-T cells expressed more TCF7 protein on day 4 of co-culture, consistent with previously published data showing that Tpex cells remained TCF7 positive (Utzschneider et al., 2020). Finally, this invention performed bulk RNA sequencing (RNAseq) on CAR-T cells before and during long-term stimulation to elucidate transcriptional differences. Gene ontology (GO) analysis using DEG revealed cytotoxic pathways such as the promotion / expansion of T cell trafficking and supporting the superior killing phenotype consistently observed in NR2F6-modified CAR-T cells. Figure 7 L+M).
[0347] Example 6 ( Figure 9 ):
[0348] Using subcutaneous tumor models and CAR-T cell therapy to study tumor growth inhibition in mice is a common approach in cancer research. Tumor Model Selection: This invention selects a specific tumor cell line, PanC02, expressing EpCAM and subcutaneously injects these cells into mice. This generates localized solid tumors in the mice. CAR-T Cell Therapy: Chimeric antigen receptor T (CAR-T) cells are specialized immune cells engineered to target specific tumor antigens. This invention uses CAR-T cells to recognize EpCAM present on the surface of the PanC02 tumor cells under study. These CAR-T cells are then produced in the laboratory. Treatment Administration: Once the tumors reach a certain size, the mice are divided into experimental groups. One group receives NR2F6-modified CAR-T cell therapy, while the control group receives conventional CAR-T cells or no treatment. Monitoring Tumor Growth: Over time, the size of the tumors in the treatment and control groups is measured and recorded periodically. This is typically done using calipers to measure the size of the subcutaneous tumors, allowing for quantification of the tumor growth rate in the treated mice compared to the control group. Tumor growth inhibition is determined by comparing the size and growth rate of the tumors in the treatment group with those in the control group. Data Interpretation: The data collected from these experiments provide information on the efficacy of CAR-T cell therapy in inhibiting tumor growth, allowing the present invention to assess whether the therapy leads to tumor regression, stabilization, or delayed growth compared to the control group. In summary, this preclinical mouse model approach strongly validates the superior efficacy of the NR2F6-modified CAR-T cell therapy of the present invention and provides robust experimental data to support future clinical trials in human patients.
[0349] Based on the significant results obtained from in vitro experiments, this invention tested the antitumor efficacy of NR2F6-modified CAR-T cells in an in vivo mouse model of solid tumors. Due to translational reasons, this invention decided to switch from germline knockout to a more clinically relevant approach, using NR2F6 gene editing in primary T cells using CRISPR / Cas9. Therefore, this invention uses the Cas9 transgenic (Cas9tg) CD8... + T cells were used to deliver synthetic single-guide (sg) RNA targeting the NR2F6 locus via electroporation. For in vivo experiments, one million PanC-EpCAM cells were subcutaneously seeded into fully immunized mice. Due to the lack of antibodies recognizing the initial NR2F6 in primary mouse T cells at the Western blot level, the knockout efficiency was determined using TIDE analysis. The efficiency of sgRNA (sg)03 production frequently exceeded 90%, while the efficiency of sg04 production was lower, at 40%. (Compared to NTC...) - Compared to animals treated with CAR-T cells, those treated with NR2F6 crispr- / -CAR-T cell treatment in tumor-bearing mice resulted in reduced tumor growth and prolonged overall survival. Notably, 40% (6 / 15) of animals in the knockout treatment group showed a complete response after tumor challenge, in contrast to 7% (1 / 14) in the NTC treatment group. In vivo experiments using independent and sequence-non-overlapping sgRNAs showed similar results, suggesting that NR2F6 knockout is the cause of the superior antitumor response. However, NR2F6 depletion in CD8... + The failure of T cells to induce an anti-tumor immune response indicates the need for CARs. Multiple clinical studies have highlighted the importance of CAR-T cells for durable clinical outcomes (Melenhorst et al., 2022; Shiqi et al., 2023). Therefore, this invention attacked Ly5.1 mice with PanC-EpCAM tumors and treated the mice with CAR-T cells as described above. On day 6 after adoptive cell transfer (ACT), this invention did not observe NR2F6 depletion or NTC. - Any difference in the number of CAR-T cells in the spleen among CAR-T treated animals. However, it is noteworthy that when analyzed after 7 days, CAR-T cells were again undetectable in the spleen of all animals regardless of the treatment regimen (see [link to study]). Figure 8 ).
[0350] Example 7 ( Figure 7 ):
[0351] Creating a research model involving Rag1 knockout mice lacking an adaptive immune system and investigating CAR-T cell therapy in the context of subcutaneous tumor burden provides valuable insights into the role of the adaptive immune system in anti-tumor immune responses. Rag1 knockout mice, lacking mature B and T lymphocytes due to Rag1 gene disruption, were chosen as the experimental model because they possess a severely compromised adaptive immune system.
[0352] To explore the potential mechanisms of tumor rejection in NR2F6-modified CAR-T cells, this invention hypothesizes that CAR therapy in this treatment group must lead to immunogenic cell death (ICD), known to promote sensitization and activation of the endogenous immune system, ultimately resulting in polyclonal and durable tumor cell clearance. To test this ICD-mediated tumor epitope spread (ES) hypothesis as a secondary event of NR2F6-modified CAR-T therapy, this invention introduces immunodeficient RAG1 cells lacking endogenous T cell / adaptive immune compartments. - / - The recipient was injected with PanC-EpCAM and then administered NR2F6 two days later. crispr- / - or NTC -CAR-T cells were subsequently processed. In stark contrast to the results obtained in fully immune-active WT receptor mice, the NR2F6-modified CAR-T treatment cohort no longer showed benefits in tumor growth and survival. The loss of treatment benefit in the RAG1- / - receptor group suggests that the superior tumor control achieved via NR2F6-modified CAR-T cell protocols requires an endogenous T-cell response. As previously mentioned, NR2F6-deficient CAR-T cells produce more IFNγ, which is crucial for amplifying the immune response (Schorder et al., 2004).
[0353] Subcutaneous tumor cells (e.g., the PanC02 cell line expressing a specific EpCAM antigen) were injected into the flank of Rag1 knockout mice to establish subcutaneous solid tumors. Chimeric antigen receptor (CAR) T cells were engineered to express a CAR specific to the EpCAM tumor antigen and infused into Rag1 knockout mice with established subcutaneous PanC02 solid tumors. This step aimed to investigate the effects of CAR-T cell therapy in the absence of an adaptive endogenous immune response. Tumor growth in mice was monitored periodically by measuring the size of the subcutaneous tumor, as described above. Figure 7 A and Figure 9 As shown in B, whether CAR-T cell therapy can lead to subcutaneous tumor regression or delay tumor growth in the absence of adaptive immunity provides insight into the indirect role of the adaptive endogenous immune system. The failure of CAR-T cell therapy, defined in the absence of an adaptive immune response, is strongly validated by epitope diffusion in the context of the NR2F6-modified CAR-T cell therapy of this invention, which is strictly dependent on the endogenous adaptive immune system. In summary, this study provides strong validation that CAR-T cells alone cannot exert an anti-tumor effect on the EpCAM tumor antigen heterogeneous PanC-02 tumor burden in the absence of endogenous adaptive immune cells, a key finding impacting the NR2F6-modified CAR-T cell therapy strategy of this invention.
[0354] Example 8 ( Figure 10 ):
[0355] This invention observes that immunogenic GFP-positive CAR-T cells are rejected by the host immune system within one week. This highlights the immunogenicity of CAR-T cells, which are engineered to express exogenous proteins, such as GFP (green fluorescent protein), which can be recognized by the host immune system as foreign substances, thereby triggering an immune response against the CAR-T cells themselves. Because the host immune system recognizes CAR-T cells as foreign substances and generates a robust immune response, it allows for rapid elimination of CAR-T cells in less than one week. In summary, the rapid rejection of immunogenic CAR-T cells by the host immune system underscores the transient time-limited (less than 1 week) therapeutic approach triggered by the NR2F6-modified CAR-T cells of this invention, which is sufficient to induce a secondary immune response (epitope diffusion) from the endogenous immune system while maximizing its effectiveness in targeting heterologous tumor burden.
[0356] Example 9 ( Figure 7 ):
[0357] Rechallenging complete responders to NR2F6-modified CAR-T therapy with EpCAM antigen-positive and antigen-negative tumors is a common approach in the context of cancer immunotherapy to study antigen cross-sensitization and epitope diffusion. Primary tumor challenge: Initially, mice are injected with EpCAM antigen-positive tumor cells to establish a primary tumor. Subsequently, anti-EpCAM CAR-T cell therapy is applied to stimulate an immune response against the tumor. Survival analysis: Mice that respond to immunotherapy and survive without visible signs of a primary tumor are identified (see [link to study]). Figure 11 A) Re-challenge phase with EpCAM antigen-positive or antigen-negative tumors: Completely responsive mice treated with NR2F6-modified CAR-T cells were grouped. One group was re-challenged with the same EpCAM antigen-positive tumor cells used for primary tumor stimulation. Another group was re-challenged with EpCAM antigen-negative tumor cells. These tumor cells did not express the CAR-T cell-targeted specific EpCAM antigen during primary tumor stimulation. Tumor growth in the re-challenged mice was monitored over a period of time to assess whether the immune response generated during the initial stimulation provided protection against tumor re-challenging not only against EpCAM antigen-positive tumors but also against EpCAM antigen-negative tumors, when directly compared to the initial mice (epitope spread).
[0358] Therefore, the therapy of knocking out CAR-T cells with NR2F6 aims to establish a durable, high-quality memory response triggered by epitope diffusion (ES). To ultimately validate NR2F6... crispr- / -Whether CAR-T cell therapy promotes endocrine disruption (ES) and subsequent activation of the endogenous immune system, this invention stimulated long-term complete responders with simultaneous injections of EpCAM-positive and EpCAM-negative PanC tumors, respectively, into the right and left ventricular regions. The hypothesis of this invention was confirmed: each NR2F6-modified CAR-T complete responder rapidly and equally eradicated both EpCAM-positive and EpCAM-negative tumors, exhibiting superior survival compared to untreated control mice. Importantly, this occurred regardless of whether EpCAM was expressed on the PanC02 tumor cells used.
[0359] Therefore, as a potential mechanism of action, antigen cross-sensitization / epitope diffusion has occurred, as mice previously exposed to EpCAM antigen-positive tumors similarly exhibited delayed growth of EpCAM antigen-negative tumors. This data validates that the immune response induced during primary challenge has initiated a secondary response (epitope diffusion) of endogenous T cells capable of recognizing other tumor antigens. Epitope diffusion occurs when the immune response diversifies to target tumor-specific antigens other than the initially targeted tumor-specific antigen, as in the case of EpCAM in this invention. Because mice show clear evidence of epitope diffusion, it also implies a broader and more robust polyclonal anti-tumor immune response through the endogenous immune compartment. The observed successful protection against tumor re-challenge also indicates the development of immune memory, where the immune system “remembers” different antigens of a given tumor and can respond more effectively upon re-challenge. In summary, these key experimental findings help this invention understand the dynamics of the immune response against tumor cells and, in particular, confirm the therapeutic benefits of effective antigen cross-sensitization and epitope diffusion, a key aspect of the NR2F6-modified CAR-T immunotherapy of this invention. The NR2F6-modified CAR-T cells of this invention have achieved curative effects in the treatment of solid tumors, allowing for the determination of the optimal CAR-T cell dose and time range for infusion scheduling to maximize efficacy. Furthermore, the time-limited transient treatment regimen of the NR2F6-modified CAR-T formulation of this invention reduces the severe side effects of CAR-T cell therapy, making treatment safer and more tolerable.
[0360] Example 10 ( Figure 11 ):
[0361] To clarify NR2F6 crispr- / - How do CAR-T cells promote the endogenous immune system? This invention utilizes multicolor FACS plates, focusing on the innate immune compartment and ELISPOT to assess tumor antigen-specific T cell responses. The experimental procedures are outlined in... Figure 12 In A. On day 8 post-tumor injection, the present invention received NR2F6. crispr- / - and NTC -Spleen cells were isolated from animals and subjected to multicolor flow cytometry. Using the uniform manifold approximation and projection (UMAP) and FLOWSOM analysis of the flow cytometry data (live cells CD3-CD19-NK1.1-), seven populations were revealed. Therefore, NR2F6 was used... crispr- / - CAR-T cell-treated fully immunized WT mice showed enrichment in population 5, characterized by expression of CD11c, MHC-II, CD8, and XCR1 as marker genes typically expressed by conventional dendritic cell type 1 (cDC1). Furthermore, manual gating revealed significant differences in cDC1 levels among NR2F6-modified CAR-T-treated animals. cDC1 has been shown to be indispensable for antitumor immunity, primarily by initiating and supporting the differentiation of cytotoxic T lymphocytes (CTLs) (Hildner et al., 2008). In the presence of DCs loaded with peptide pools of primary PanC02 tumors, PanC02 cell line lysates, or previously disclosed PanC02 neoantigens (Kinkead et al., 2018), the ELISPOT assay using isolated primary CD3+ T cells assessed polyclonal T cell activation responses in the presence or absence of CAR-targeted tumor antigens. Therefore, this invention enables the confirmation of cDC1-mediated ES by T cell sensitization: with NR2F6 crispr- / - CAR-T therapy (but not or much less NTC) - Treatment with CAR-T therapy (as well as in control CAR-T-untreated mice) resulted in enhanced endogenous T-cell responses, as demonstrated by enhanced GzmB production similarly triggered by recall of CAR-targeted and non-CAR-targeted tumor antigens. Effective tumor clearance in the complete absence of CAR-T cells can be explained by this underlying mechanism. In summary, the data from this invention demonstrate that NR2F6-modified (but not NTC) CAR-T cell therapy induces a robust increase in cDC1 cell structure and differentiation required for its T-cell sensitization capacity, which clearly leads to robust secondary and polyclonal immune responses in the endogenous T-cell compartment of this particular cohort.
[0362] Example 11 ( Figure 10 ):
[0363] NR2F6 knockout CAR-T cell therapy establishes epitope diffusion-triggered (ES), see Figure 12This invention aims to achieve a durable, high-quality memory response. Assuming that cDC1-mediated ES may have already occurred in a cohort of complete responders treated with NR2F6crispr- / - CAR-T as a mechanistic basis for the effective rejection of EpCAM-negative PanC02 tumors, this invention employs repeated challenge experiments with EpCAM-negative PanC02 tumors and assesses the characterization of the endogenous immune response to tumor-infiltrating CD45+ cells using scRNA and scTCR sequencing. Simultaneously, ACT was performed on spleen cells transferred from the complete responder cohort to PanC02 tumor antigen-naïve mice, followed by endogenous CD8+ on day 5 post-tumor injection. + In vitro experiments were conducted using T cells. Using NR2F6-modified CAR-T full responder spleen cells, antitumor therapy (ACT) was used to test whether they could confer anti-PanC02 tumor immune protection in tumor-bearing wild-type mice. Indeed, compared directly with animals treated with spleen cells from PanC antigen-naïve mice, mice treated with these spleen cells effectively controlled tumor growth and showed a survival benefit. To obtain mechanistic insights into tumor-infiltrating leukocytes in the NR2F6-modified CAR-T full responder cohort, the present invention performed scRNA and scTCR sequencing on CD45+ tumor-infiltrating cells. Based on their expression profiles, the present invention identified distinct clusters representing major immune cell types ( Figure 12 A). Significant differences in cellular composition were observed between NR2F6-modified CAR-T full responders and PanC antigen-naïve mice. NR2F6-modified CAR-T full responder mice exhibited a reduced number of depleted CD8+ cells. + And regulatory T cells, and CD8 was particularly evident among other changes. + Increased T cell proliferation and cDC1 levels. Notably, no CAR+ T cells were found in the tumor-infiltrating cells of the NR2F6-modified CAR-T full responder cohort; excluding them indeed contributed to tumor clearance. When examining CD8... + When examining T cell subsets, CD8 was indeed observed compared to control tumor-infiltrating cells. + Differences in gene expression in proliferating T cells ( Figure 12 C). Consistent with the working assumptions of this invention, DEG was analyzed using immune cell types, specifically in CD8. + Major changes in intergroup cellular structure were observed in T cell proliferation and T cell exhaustion, as well as in cDC1. Based on this line of reasoning, it was found that T cell subsets possess well-established upregulated pathways that positively regulate T cell function, while cDC1 showed upregulation of pathways related to migration, chemotaxis, T cell cytokine production, activation, and differentiation. Figure 13D). To further verify whether ES had developed, scTCR sequencing of TILs was used to determine the clonality and diversity of T cell receptors (TCRs). Therefore, compared to control mice, the NR2F6-modified CAR-T full responder cohort showed reduced clonality with increased diversity, indicating that T cells were sensitized to many epitopes without a particularly prominent one. In summary, the results suggest that NR2F6... crispr- / - CAR-T therapy leads to the establishment of polyclonal and durable memory immune responses, characterized by particularly low CD8 depletion in TILs and an increase in the number of cDC1 cells, explaining the endogenous CD8... + Increased TCR diversity and superior antitumor activity in T cell compartments. Together with ICD-mediated epitope diffusion (ES), this may promote robustly enhanced T cell sensitization as a secondary effect selectively observed in the NR2F6-modified CAR-T therapy cohort.
[0364] Example 12 ( Figure 14 ):
[0365] TCF1 is CD8 + NR2F6 is a key regulator of clonal memory and exhaustion resistance established in T cells. To investigate the functional interaction between NR2F6 and TCF1, CRISR / Cas9-mediated acute NR2F6 knockout technology and TCF1 DNA binding studies were performed in NTC or NR2F6crispr- / - mouse CAR-T cells under specific stimulation conditions, including DNA binding and transactivation assays. Complementarily, in human leukemia Jurkat T cells expressing NR2F6 or TCF1 WT or mutant proteins ectopically, promoter transactivation assays of TCF1 enhancer-driven luciferase reporter genes containing a minimal promoter (coupled to the TCF1 enhancer site upstream of the firefly luciferase gene) were performed, along with DNA binding analysis of TCF1 in nuclear extracts using electromigration assay (EMSA). Mechanistically, NR2F6 acts as a cofactor and / or regulator of TCF1 and specifically participates in the regulation of TCF1 DNA binding during prolonged antigen stimulation of T cells. In summary, these findings suggest the existence of TCF1:NR2F6 crosstalk, which may play a necessary and irreplaceable regulatory role in regulating T cell exhaustion. This functional interaction could be a promising target for improving response rates to cancer immunotherapy.
[0366] Example 13 ( Figure 15 ):
[0367] Lentiviral genes containing Cas9, sgRNA, and puromycin resistance were integrated into primary human T cells to knock out human NR2F6. Effector responses were then analyzed by flow cytometry as described above in the presence of DMSO or Nurix (an established and selective small-molecule inhibitor of CBLB). NR2F6-edited primary human T cells, already exhibiting significantly enhanced effector responses to antigen receptor stimulation, could be further enhanced by combined CBLB inhibition. Therefore, the combined inhibition of NR2F6 and CBLB in primary human T cells in vitro significantly synergistically enhances antigen receptor signaling in human T cells, thus validating the concept of such combination immunotherapy regimens.
[0368] Summarize( Figure 15 ):
[0369] This diagram illustrates an immunogenic cell death phenomenon mediated by NR2F6-modified CAR-T cells of the present invention, which activate innate immune cells in the solid tumor microenvironment. Distinct from prior art CAR-T cells, the NR2F6-modified CAR-T cells of the present invention allow for cross-sensitization, epitope diffusion, and subsequent immune cell infiltration and rejection by CAR-targeted negative tumors. Experimental findings validate the development of a time-limited transient strategy that uses the NR2F6-modified CAR-T cells of the present invention to trigger a secondary immune response and improve polyclonal immunity through endogenous T cell compartments providing a given antitumor immune response. This represents an innovative strategy capable of transforming prior art non-curative adoptive T-cell therapies into curative treatments for antigenically heterogeneous solid cancers.
[0370] References
[0371] European Cancer Information System (ECIS), website: https: / / ecis.jrc.ec.europa.eu, accessed on 27 / 04 / 2020 © European Union, 2020.
[0372] Dine, J., Gordon, R., Shames, Y., Kasler, MK & Barton-Burke, M. Immune Checkpoint Inhibitors: An Innovation in Immunotherapy for the Treatment and Management of Patients with Cancer. Asia-Pacific J. Oncol. Nurs. 4, 127–135 (2017).
[0373] Zhuang, X. et al. A high number of CD8+ T cells infiltrated in NSCLC tissues is associated with a favorable prognosis. Appl. Immunohistochem. Mol. Morphol. AIMM 18,24–28 (2010).
[0374] Marin-Acevedo, JA et al. Next generation of immune checkpoint therapy in cancer: new developments and challenges. J. Hematol. Oncol. 11, 39 (2018).
[0375] Fleischer, LC, Spencer, HT & Raikar, SS. Targeting T cell malignancies using CAR-based immunotherapy: challenges and potential solutions. J. Hematol. Oncol. 12, 141 (2019).
[0376] Holstein, SA & Lunning, MA. CAR-T cell therapy in hematologic malignancies: A Voyage in Progress. Clin. Pharmacol. Ther. 107, 112–122 (2020).
[0377] Depil, S., Duchateau, P., Grupp, SA, Mufti, G. & Poirot, L. 'Off-the-shelf' allogeneic CAR-T cells: development and challenges. Nat. Rev. Drug Discov. 19, 185–199 (2020).
[0378] Porter, DL et al. Chimeric antigen receptor T cells persist and induce sustained remissions in relapsed refractory chronic lymphocytic leukemia. Sci. Transl. Med. 7, 303ra139 (2015).
[0379] Guha, P., Heatherton, KR, O'Connell, KP, Alexander, IS & Katz, SC. Assessing the Future of Solid Tumor Immunotherapy. Biomedicines 10, 655 (2022).
[0380] Yan, T., Zhu, L. & Chen, J. Current advances and challenges in CAR-T cell therapy for solid tumors: tumor-associated antigens and the tumor microenvironment. Exp. Hematol. Oncol. 12, 14 (2023).
[0381] Maalej, KM, et al. CAR-Cell therapy in the era of solid tumor treatment: current challenges and emerging therapeutic advances. Mol. Cancer 22, 20 (2023).
[0382] Mamdani, H., et al., Immunotherapy in Lung Cancer: Current Landscape and Future Directions. Front Immunol 13, 823618 (2022).
[0383] Hosseinkhani, N. et al. Immune Checkpoints and CAR-T Cells: The Pioneers in Future Cancer Therapies? Int.J. Mol. Sci. 21, 8305 (2020).
[0384] Zhong, S., Cui, Y., Liu, Q. & Chen, S. CAR-T cell therapy for lung cancer: a promising but challenging future. J. Thorac. Dis. 12, (2020).
[0385] Füchsl, F. & Krackhardt, AM. Paving the Way to Solid Tumors: Challenges and Strategies for Adoptively Transferred Transgenic T Cells in the Tumor Microenvironment. Cancers 14, 4192 (2022).
[0386] Majzner, RG & Mackall, CL. Tumor Antigen Escape from CAR-T Cell Therapy. Cancer Discov. 8, 1219–1226 (2018).
[0387] Chen, S. et al. Anti-MUC1 CAR-T cells combined with PD-1 knockout engineered T cells for patients with non-small cell lung cancer (NSCLC): A pilot study. Ann. Oncol. 29, x11 (2018).
[0388] Hermann-Kleiter N. et al. The Nuclear Orphan Receptor NR2F6 Is a Central Checkpoint for Cancer Immune Surveillance, Cell Rep., 12(12), 2072-85 (2015).
[0389] Brinkman EK, Chen T, Amendola M, van Steensel B. Easy quantitative assessment of genome editing by sequencetrace decomposition. Nucleic Acids Res. 2014;42(22):e168.
[0390] Nieto P, Elosua-Bayes M, Trincado JL, Marchese D, Massoni-Badosa R, Salvany M, et al. A single-cell tumor immuneatlas for precision oncology. Genome Res. 2021;31(10):1913-26.
[0391] Kim MV, Ouyang W, Liao W, Zhang MQ, Li MO. The transcription factor Foxo1 controls central-memory CD8+ T cell responses to infection. Immunity. 2013;39(2):286-97.
[0392] Tsui C, Kretschmer L, Rapelius S, Gabriel SS, Chisanga D, Knopper K, et al. MYB orchestrates T cell exhaustion and response to checkpoint inhibition. Nature. 2022;609(7926):354-60.
[0393] Liu Z, Guo Y, Tang S, Zhou L, Huang C, Cao Y, et al. Cutting Edge: Transcription Factor BCL6 Is Required for the Generation, but Not Maintenance, of Memory CD8(+) T Cells in Acute Viral Infection. J Immunol. 2019;203(2):323-7.
[0394] Delgoffe GM, Xu C, Mackall CL, Green MR, Gottschalk S, Speiser DE, et al. The role of exhaustion in CAR-T cell therapy. Cancer Cell. 2021;39(7):885-8.
[0395] Mamonkin M, Rouce RH, Tashiro H, Brenner MK. An AT cell-directed chimeric antigen receptor for the selective treatment of T cell malignancies. Blood. 2015;126(8):983-92.
[0396] Zhang Z, Zhang Y, Xia S, Kong Q, Li S, Liu X, et al. Gasdermin E suppresses tumor growth by activating anti-tumor immunity. Nature. 2020;579(7799):415-20.
[0397] Utzschneider DT, Gabriel SS, Chisanga D, Gloury R, Gubser PM, Vasanthakumar A, et al. Early precursor T cells establish and propagate T cell exhaustion in chronic infection. Nat Immunol. 2020;21(10):1256-66.
[0398] Melenhorst JJ, Chen GM, Wang M, Porter DL, Chen C, Collins MA, et al. Decade-long leukemia remissions with persistence of CD4(+) CAR-T cells. Nature. 2022;602(7897):503-9.
[0399] Shiqi L, Jiasi Z, Lvzhe C, Huailong X, Liping H, Lin L, et al. Durable remission related to CAR-T persistence in R / R B-ALL and long-term persistence potential of prime CAR-T. Mol Ther Oncolytics. 2023;29:107-17.
[0400] Schroder K, Hertzog PJ, Ravasi T, Hume DA. Interferon-gamma: an overview of signals, mechanisms and functions. J Leukoc Biol. 2004;75(2):163-89.
[0401] Hildner K, Edelson BT, Purtha WE, Diamond M, Matsushita H, Kohyama M, et al. Batf3 deficiency reveals a critical role for CD8alpha+ dendritic cells in cytotoxic T cell immunity. Science. 2008;322(5904):1097-100.
[0402] Kinkead HL, Hopkins A, Lutz E, Wu AA, Yarchoan M, Cruz K, et al. Combining STING-based neoantigen-targeted vaccine with checkpoint modulator enhances anti-tumor immunity in murine pancreatic cancer. JCI Insight. 2018;3(20).
Claims
1. A modified immune cell for treating a solid tumor in a subject, wherein, - The modified immune cells comprise one or more exogenous nucleic acid molecules that encode transgenic constructs that target antigens expressed in the cancer cells of the solid tumor. - In the said immune cells, the activity of nuclear receptor subfamily 2F member 6 (NR2F6) was inhibited (compared to control immune cells), and - The binding of the immune cells to the antigen is associated with the death of the cancer cells expressing the antigen and induces a secondary immune response against cancer cells of solid tumors in the subject, wherein the secondary immune response is nonspecific to the antigen targeted by the transgenic construct (epitope diffusion).
2. The modified immune cells for use according to claim 1, wherein, The secondary immune response targets one or more antigens expressed by the cancer cells, preferably one or more antigens expressed by the cancer cells intracellularly and / or extracellularly.
3. The modified immune cells for use according to the preceding claims, wherein, One or more antigens expressed by the cancer cells are non-autologous tumor antigens.
4. The modified immune cells for use according to any one of the preceding claims, wherein, The secondary immune response is a T-cell-mediated immune response, preferably a polyclonal T-cell-mediated immune response.
5. The modified immune cells for use according to any one of the preceding claims, wherein, Inhibition of NR2F6 is associated with resistance and / or reduced sensitivity of the cells to the tumor immune microenvironment (TIME) of the solid tumor, which inhibits cytolytic activity.
6. The modified immune cells for use according to any one of the preceding claims, wherein, Inhibition of NR2F6 is associated with the depletion resistance and / or reduced sensitivity of the cells to chronic tumor antigen stimulation within the tumor immune microenvironment (TIME).
7. The modified immune cells for use according to any one of the preceding claims, wherein, In these cells, the activity of the Casites B lineage lymphoma proto-oncogene-b (CBLB) was further inhibited (compared to control immune cells).
8. The modified immune cells for use according to any one of the preceding claims, wherein, The transgenic construct is transiently expressed in the immune cells.
9. The modified immune cells for use according to any one of the preceding claims, wherein, The transgenic construct is a chimeric antigen receptor (CAR), and / or wherein, The cells are T cells, preferably CD4 cells. + T cells or CD8 + T cells.
10. The modified immune cells for use according to any one of the preceding claims, wherein, In the cells, the activity of NR2F6 and optional CBLB is inhibited by at least 50% (compared to control immune cells), preferably at least 60%, more preferably at least 70%, or the activity of NR2F6 and optional CBLB is removed.
11. The modified immune cells for use according to any one of the preceding claims, wherein, Inhibition of NR2F6 activity and optional CBLB activity is achieved prior to administration of the cells to the subject by disrupting the expression and / or sequence of the NR2F6 gene and optional CBLB gene, preferably by disrupting the expression and / or sequence of the NR2F6 gene and optional CBLB gene via CRISPR-Cas, zinc finger nuclease (ZFN), integrase, site-specific recombinase, meganuclease, homing endonuclease or TALEN, more preferably by disrupting the expression and / or sequence of the NR2F6 gene and optional CBLB gene via CRISPR / Cas9.
12. The modified immune cells for use according to any one of the preceding claims, wherein, Inhibition of NR2F6 activity and optional CBLB activity is achieved by knocking down NR2F6 and optional CBLB, preferably by RNA interference of NR2F6 expression and optional CBLB expression, such as by small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), molar finol and / or antisense oligonucleotide (ASO).
13. The modified immune cells for use according to any one of the preceding claims, wherein, Inhibition of NR2F6 activity and optionally CBLB activity is achieved by treating the cells with an NR2F6 antagonist and optionally a CBLB antagonist, for example by treating the cells with a small molecule inhibitor of NR2F6 and optionally CBLB.
14. The modified immune cells for use according to any one of the preceding claims, wherein, Inhibition of NR2F6 activity and optional CBLB activity is obtained before and / or by administering the cells, along with the NR2F6 antagonist and optional CBLB antagonist, to the subject simultaneously or sequentially.
15. The modified immune cells for use according to any one of the preceding claims, wherein, The solid tumors are selected from glioblastoma, lung cancer, breast cancer, kidney cancer, pancreatic cancer, melanoma, colorectal cancer, ovarian cancer, prostate cancer, and colon cancer.
16. A modified immune cell comprising one or more exogenous nucleic acid molecules, said exogenous nucleic acid molecules encoding a transgenic construct targeting an antigen expressed in cancer cells of a solid tumor, wherein, In these cells, NR2F6 activity and Casitas B lineage lymphoma proto-oncogene-b (CBLB) activity were suppressed (compared to control immune cells).
17. A pharmaceutical composition suitable for treating solid tumors, said pharmaceutical composition comprising modified immune cells according to the preceding claims, and additionally comprising a pharmaceutically acceptable carrier.
18. An in vitro method for enhancing the cytolytic activity of modified immune cells, said immune cells comprising one or more exogenous nucleic acid molecules encoding a transgenic construct targeting an antigen expressed in cancer cells of a solid tumor, said method comprising: Inhibition of the activity of nuclear receptor subfamily 2F member 6 (NR2F6) and optionally the activity of the Casites B lineage lymphoma proto-oncogene-b (CBLB) in the immune cells, wherein inhibition of NR2F6 activity and optionally CBLB activity preferably includes: a. Genetic modification of the T cell genome by disrupting the expression and / or sequence of the NR2F6 gene and optionally the CBLB gene, preferably by disrupting the expression and / or sequence of the NR2F6 gene and optionally the CBLB gene through CRISPR-Cas, zinc finger nucleases (ZFNs), integrases, site-specific recombinases, meganucleases, homing endonucleases, or TALENs. b. Knock down NR2F6 and optional CBLB, preferably by RNA interference of NR2F6 expression and optional CBLB expression, for example by small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), molar finol and / or antisense oligonucleotides (ASO), or c. Treat the cells with an NR2F6 antagonist and optionally a CBLB antagonist, for example, with a small molecule inhibitor of NR2F6 and optionally CBLB.
Citation Information
Patent Citations
Activation and expansion of cells
US20060121005A1
Universal donor checkpoint inhibitor silenced / gene edited cord blood killer cells
US20170304418A1
Small molecule modulators of NR2f6 activity
US20190358224A1
NR2f6 inhibited chimeric antigen receptor cells
US20210317180A1
Recombinant immunoglobin preparations
US4816567A