Recombinant humanized XVIII type collagen as well as production method and application thereof

Abstract

The invention provides recombinant humanized XVIII type collagen as well as a production method and application thereof, and belongs to the technical field of biosynthesis. The recombinant XVIII type humanized collagen has excellent cell adhesion activity and good biocompatibility, can be used for tissue repair, and does not generate immunological rejection and anaphylactic reaction when being applied to a human body.

Description

Technical Field

[0001] This invention belongs to the field of biosynthesis technology, specifically relating to recombinant humanized type XVIII collagen and its production method and application. Background Technology

[0002] Collagen is a type of protein that is widely distributed in human connective tissues and is the most abundant protein in the human body, accounting for 25% to 35% of the total protein. At least 28 collagen subtypes have been found in the human body, located in different tissues and organs.

[0003] Collagen XVIII is a member of the triple-helical collagen subfamily, with its trimerization domain located in the first 54 residues of the non-collagenous carboxyl-terminal (NC1) domain. This protein is widely expressed in the human body, particularly enriched in ocular tissues. Immunohistochemical and proteomic analyses have shown that collagen XVIII is present in most of the basal layers of the human eye, especially in the lens capsule; it has also been detected in the iris epithelium, scleral venous sinuses, trabecular meshwork, and muscle cells of the ciliary body and iris. Furthermore, endostatin fragments derived from this protein have been found in ocular fluid samples such as tears, aqueous humor, and vitreous humor. These fragments have been shown to have inhibitory activity against angiogenesis and tumor growth (M. Pehrsson, et al. Chapter 18-Type XVIII collagen[J]. Biochemistry of Collagens, Laminins and Elastin, 2024, 161-173.).

[0004] Furthermore, the physiological importance of collagen XVIII has been confirmed in multiple studies. The journal *Human Mol Genet* (2000) reported a homozygous mutation at the AG common receptor splicing site of COL18A1 intron 1 in 12 patients with Knobloch syndrome (KS). This mutation predicted the production of a stop codon in exon 4, leading to a truncation of a short form of α1 (XVIII) collagen expressed in the adult human retina (Sertié Andréa Laurato, et al. Collagen XVIII, containing an endogenous inhibitor of angiogenesis and tumor growth, plays a critical role in the maintenance of retinal structure and in neural tube closure (Knobloch syndrome)[J]. Human Molecular Genetics, 2000(13):2051-2058.). This finding genetically confirms that intact collagen XVIII is crucial for maintaining normal retinal structure and neural tube closure. In addition, several other studies have revealed the important functions of type XVIII collagen in maintaining the integrity of the basement membrane and regulating cell behavior, further confirming its basic biological value.

[0005] Despite the promising applications of type XVIII collagen, its commercial production faces significant challenges. Traditional methods for producing collagen primarily rely on extraction from animal tissues (such as bovine and porcine skin) using acid, alkali, or enzymatic methods. These methods have significant drawbacks: the extraction process disrupts the natural three-dimensional structure of collagen, leading to a loss of its biological activity; furthermore, the xenogeneic immunogenicity carried by animal-derived collagen cannot be eliminated, potentially triggering an immune rejection response in humans, severely limiting its application in the biomedical field.

[0006] In summary, existing research has fully revealed the key physiological functions of type XVIII collagen; however, these findings are primarily focused on basic biological research. Effective technical solutions are still lacking for its recombinant production methods, especially for large-scale preparation processes with high activity and high purity that can meet commercial requirements. This technological bottleneck significantly hinders the translation of this protein from basic research findings into practical biomedical applications.

[0007] Therefore, there is an urgent need in this field for a recombinant XVIII type humanized collagen that can be directly mass-produced and does not cause immunogenic reactions, so as to be used as a human structural material for tissue repair. Summary of the Invention

[0008] To address current needs, this invention utilizes synthetic biology and structural biology techniques to develop recombinant humanized type XVIII collagen with good biological activity and the ability to function as human collagen.

[0009] In one aspect, the present invention provides recombinant humanized type XVIII collagen comprising n repeating units connected directly or via a linker, the repeating units comprising the amino acid sequence shown in SEQ ID NO:1 or a variant thereof;

[0010] The variant is (1) an amino acid sequence obtained by substituting, adding, deleting or inserting one or more amino acids based on SEQ ID NO:1; or (2) an amino acid sequence that has at least 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:1.

[0011] In some implementations, n is an integer from 1 to 20.

[0012] In some implementations, n is 9.

[0013] In some embodiments, the recombinant humanized type XVIII collagen comprises the amino acid sequence shown in SEQ ID NO:2.

[0014] In some embodiments, the recombinant humanized type XVIII collagen comprises an amino acid sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity with SEQ ID NO:2.

[0015] In some embodiments, the recombinant humanized type XVIII collagen comprises an amino acid sequence obtained by substitution, addition, deletion or insertion of one or more amino acids based on SEQ ID NO:2.

[0016] In one aspect, the present invention provides a fusion protein comprising the recombinant humanized type XVIII collagen described herein and proteins for promoting collagen secretion, separation and / or purification.

[0017] In some embodiments, the protein is selected from restriction enzyme site sequences, signal peptides, and purification tags.

[0018] In some embodiments, the restriction site sequence is a TEV protease restriction site sequence.

[0019] In some implementations, the protein tag is selected from His tag, GST tag, MBP tag, SUMO tag, or NusA tag.

[0020] In one aspect, the present invention provides polynucleotides that encode the collagen or fusion protein described herein.

[0021] In some embodiments, the polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:3.

[0022] In one aspect, the present invention provides a carrier comprising the polynucleotides described herein.

[0023] In some implementations, the carrier is an expression carrier.

[0024] In some embodiments, the vector includes a control element operatively linked to a polynucleotide.

[0025] In some implementations, the control element is selected from promoters, terminators, and / or enhancers.

[0026] In one aspect, the present invention provides a host cell comprising the polynucleotides described herein, or the vectors described herein.

[0027] In some implementations, the host cell is a eukaryotic cell or a prokaryotic cell.

[0028] In some implementations, the eukaryotic cells are yeast cells, animal cells, and / or insect cells, and / or the prokaryotic cells are Escherichia coli cells, such as Escherichia coli BL21.

[0029] In one aspect, the present invention provides a method for producing the recombinant humanized type XVIII collagen or the fusion protein described herein, comprising the following steps:

[0030] (1) Culture the host cells described herein under suitable culture conditions;

[0031] (2) Harvest host cells and / or culture medium containing type XVIII humanized collagen or fusion protein;

[0032] (3) Purify recombinant humanized type XVIII collagen or fusion protein.

[0033] In one aspect, the present invention provides compositions comprising one or more of the recombinant humanized type XVIII collagen, fusion protein, polynucleotide vector, and host cell described herein.

[0034] In some embodiments, the composition is a pharmaceutical composition or a cosmetic composition.

[0035] In some embodiments, the composition is one or more of the following: bio-dressings, human biomimetic materials, plastic and cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection fillers, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials and pharmaceutical excipients.

[0036] In some embodiments, the composition is a surface composition, an injectable composition, or an oral composition.

[0037] In some embodiments, the composition is a composition in the form of a solution, lyophilized powder, gel, sponge, or fiber.

[0038] In one aspect, the present invention provides the use of the recombinant humanized type XVIII collagen, fusion protein, polynucleotide, carrier and / or host cell described herein in the preparation of one or more of the following: bio-dressings, human biomimetic materials, plastic and cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection filling materials, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials and pharmaceutical excipients.

[0039] In one aspect, the present invention provides the use of the recombinant humanized type XVIII collagen and / or compositions described herein in the preparation of products having cell adhesion and proliferation-promoting effects.

[0040] In one aspect, the present invention provides the use of the recombinant humanized type XVIII collagen and / or compositions described herein in the preparation of products that improve the basement membrane and / or promote skin wound repair and / or enhance skin barrier function and / or anti-aging.

[0041] The beneficial effects of this invention are:

[0042] (1) This invention provides the core functional region of recombinant humanized XVIII type collagen and successfully constructs recombinant humanized XVIII type collagen with good biological activity based on the core functional region.

[0043] (2) The amino acid composition of the recombinant humanized XVIII type collagen provided by the present invention is 100% identical to the corresponding part of the amino acid sequence of natural human XVIII type collagen, and will not produce immune rejection or allergic reaction when applied to the human body.

[0044] (3) The recombinant humanized XVIII type collagen of the present invention has excellent cell adhesion activity, can effectively promote the biological functions of human fibroblasts and keratinocytes, and plays an important role in skin wound healing, barrier function consolidation and skin rejuvenation by supporting basal cell repair.

[0045] (4) The preparation method of the present invention is simple and can produce high-yield recombinant humanized type XVIII collagen on a large scale. Attached Figure Description

[0046] Figure 1 Electrophoresis diagram of recombinant humanized type XVIII collagen (rhCol XVIII);

[0047] Figure 2 To investigate the adhesion of recombinant humanized XVIII type collagen to NIH / 3T3 cells;

[0048] Figure 3 To assess the adhesion of recombinant humanized type XVIII collagen to HSF cells;

[0049] Figure 4 The effect of different concentrations of rhCol XVIII on the viability of HaCaT cells. Detailed Implementation

[0050] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0051] Terminology Definition

[0052] As used in this article, the term "recombinant collagen" refers to a new type of biomaterial that uses cutting-edge structural biology, genetic engineering and other technologies to screen and prepare a product with the same or similar amino acid sequence as human collagen, using the gene encoding the functional region of a specific type of human collagen as a template.

[0053] As used herein, the term "recombinant humanized type XVIII collagen" refers to a recombinant protein consisting of or substantially consisting of sequences derived from human type XVIII collagen. In this context, recombinant humanized type XVIII collagen may consist of or substantially consist of fragments or multiple repeats of fragments derived from human type XVIII collagen.

[0054] As used herein, the term "repetitive unit" refers to the amino acid sequence that serves as the base sequence in recombinant humanized type XVIII collagen. The recombinant humanized type XVIII collagen of this invention can be obtained by repeated units in tandem. In this invention, recombinant humanized type XVIII collagen may contain one repeating unit or a tandem repeat containing multiple repeating units. The repeating unit contains the amino acid sequence shown in SEQ ID NO:1 or the amino acid sequence after one or more amino acid residue mutations (substitution, addition, insertion, or deletion). The number of repeating units can be 1-20. For example, the number of repeating units is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In particular, the mutation can be a substitution, such as a conserved amino acid substitution. Those skilled in the art can obtain collagen that retains the functions of the collagen of this invention, such as cell adhesion ability, by appropriately mutating the collagen sequence or by having appropriate spacer sequences.

[0055] As used herein, the term "fusion protein" refers to a fusion of a protein comprising recombinant humanized type XVIII collagen and another functional portion. In some embodiments, the other functional portion is a protein for promoting collagen secretion, separation, and / or purification. Proteins for promoting collagen secretion, separation, and / or purification are well known to those skilled in the art and include, but are not limited to, restriction enzyme sites, signal peptides, and purification tags.

[0056] As used herein, the term “expression” includes any step involved in peptide production, including but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0057] As used herein, the term "vector" is a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector enables the expression of a protein encoded by the inserted polynucleotide, it is called an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material elements they carry to be expressed in the host cells. Vectors are well known to those skilled in the art and include, but are not limited to: plasmids; phage particles; Cos plasmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC); bacteriophages such as λ phage or M13 phage, and animal viruses. Vectors may contain various elements controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, vectors may contain a replication initiation site. Vectors may contain the nucleic acids of this invention for introduction into cells for expression. Vectors may contain expression control elements operatively linked to the nucleic acids, such as promoters, terminators, and / or enhancers.

[0058] As used herein, the term "expression vector" refers to a straight or circular DNA molecule containing a polynucleotide encoding a polypeptide and operatively linked to a control sequence provided for its expression. In this paper, the expression vector is an *E. coli* expression vector.

[0059] As used herein, the term "control sequence" refers to the nucleic acid sequence necessary for the expression of the polynucleotide encoding the mature polypeptide of the present invention. Each control sequence may be native (i.e., from the same gene) or exogenous (i.e., from a different gene) for the polynucleotide encoding the polypeptide, or native or exogenous relative to each other. Such control sequences include, but are not limited to, leader sequences, polyadenylated sequences, propeptide sequences, promoters, signal peptide sequences, and transcription terminators. At a minimum, control sequences include promoters and transcription and translation termination signals. These control sequences may be provided with multiple linkers for the purpose of introducing specific restriction sites that facilitate the linking of control sequences to the coding region of the polynucleotide encoding the polypeptide.

[0060] As used herein, the term "host cell" refers to a cell into which nucleic acid molecules have been introduced using molecular biology techniques. These techniques include transfection with viral vectors, transformation with plasmid vectors, and accelerated introduction of naked DNA via electroporation, lipid transfection, and particle gun techniques. Host cells can be eukaryotic or prokaryotic cells. For example, eukaryotic cells include yeast cells, animal cells, and / or insect cells. Prokaryotic cells can be E. coli cells.

[0061] As used in this article, the term "bio-dressing" refers to a medical material with a specific structure (such as membrane, sponge, gel, etc.) formed by cross-linking or processing biological materials (such as collagen, hyaluronic acid, etc.) through physical or chemical methods. It is used to cover and protect skin wounds and promote wound healing and tissue regeneration.

[0062] As used in this article, the term "bionic material" refers to materials developed by imitating various characteristics or properties of living organisms. Generally, artificial materials designed and manufactured in accordance with the operational patterns of living systems and the structural principles of biological materials are called biomimetic materials. Human biomimetic materials are artificial materials designed and manufactured in accordance with the operational patterns of human living systems and the structural principles of biological materials. The recombinant humanized type XVIII collagen presented in this article has the effect of promoting cell adhesion, and therefore can be used in human biomimetic materials.

[0063] As used herein, the term "cosmetic material" refers to materials used in cosmetic procedures. Those skilled in the art know that collagen can be applied to the human body in cosmetic procedures.

[0064] As used herein, the term "organoid culture material" refers to materials used for culturing organoids. The recombinant humanized type XVIII collagen described in this paper has the effect of promoting cell adhesion and therefore can be used for organoid culture.

[0065] As used herein, the term "cardiovascular stent material" refers to the material used in the fabrication of cardiovascular stents. The recombinant humanized type XVIII collagen described in this article can be coated onto the surface of a cardiovascular stent.

[0066] As used herein, the term "tissue-injectable filler" refers to material that can be injected into the human body and used as a filler. The recombinant humanized type XVIII collagen discussed herein can be used as a tissue-injectable filler.

[0067] In this article, unless otherwise specified, recombinant humanized type XVIII collagen may encompass collagen in single-chain and / or triple-helix form.

[0068] In some implementations, the repeating units are directly connected.

[0069] In some implementations, the repeating units are connected by a linker that contains one or more amino acid residues.

[0070] In some implementations, the number of repeating units is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.

[0071] In this invention, the recombinant humanized XVIII type collagen may contain certain mutations. For example, one or more amino acid sequences in these portions may have substitutions, deletions, additions, or insertions of amino acid residues. That is, variants may be used in this invention, as long as the variants retain the cell adhesion-promoting activity. Specifically, the variants may have a certain percentage identity with the specified sequence, for example, at least 50%, 60%, 70%, 75%, 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity. The specified sequence may be any sequence of this invention, such as SEQ ID NO:1 or SEQ ID NO:2, but preferably these variants retain the function of the recombinant humanized XVIII type collagen of this invention. The recombinant humanized XVIII type collagen of this invention can have good cell adhesion efficacy.

[0072] In this invention, the recombinant humanized type XVIII collagen can be prepared by any suitable method, such as by synthesis.

[0073] In some implementations, the polynucleotides described herein are codon-optimized for the host cell in which they are expressed.

[0074] In some implementations, the polynucleotide encoding recombinant humanized type XVIII collagen can be operatively linked to expression control elements, such as promoters, terminators, and / or enhancers, to form a nucleic acid or expression cassette.

[0075] In some implementations, the polynucleotide encoding recombinant humanized type XVIII collagen may also contain nucleotides encoding purification tags, such as His tags, GST tags, MBP tags, SUMO tags, or NusA tags, or nucleotides encoding leader sequences to facilitate peptide purification or secretion.

[0076] In this invention, recombinant humanized type XVIII collagen can be prepared into a composition. The composition may comprise the recombinant humanized type XVIII collagen described herein, nucleic acids, a carrier, and / or host cells. The composition may also comprise a pharmaceutically and / or cosmetically acceptable carrier or solvent. The composition may be a pharmaceutical composition or a cosmetic composition for pharmaceutical and / or cosmetic purposes. For example, the composition is one or more of the following: bio-dressings (e.g., collagen bio-dressings), biomimetic materials, plastic surgery materials, organoid culture materials, cardiovascular scaffold materials, coating materials, tissue injection fillers, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D-printed artificial organ biomaterials, cosmetic raw materials, and pharmaceutical excipients.

[0077] Cosmetic compositions can be those with anti-wrinkle, oil-controlling, skin-repairing, and / or skin-soothing effects. There are no particular restrictions on the application area of ​​the cosmetic composition; it can be the face, hands, legs, torso, etc. For example, oil-controlling effects refer to oil-controlling effects on the face.

[0078] There are no particular limitations on the form of the composition, as long as it can achieve the intended function. For example, the composition can be in the form of a solution, lyophilized powder, gel, sponge, or fiber.

[0079] The composition can be applied in any suitable manner, such as for oral and / or topical application. The composition can also be prepared as a kit. The kit may contain additional ingredients, such as excipients like buffers.

[0080] In this invention, "promoting cell adhesion" means that the recombinant humanized type XVIII collagen or a composition containing it can provide specific recognition and binding sites for cells (such as human keratinocytes) through its unique structure and function, enhance the cell's ability to attach, spread and migrate on the material surface or damaged site, thereby accelerating cell layer formation and tissue connection. This is the core functional basis for realizing biomedical applications such as skin repair and tissue regeneration.

[0081] In this invention, "promoting cell proliferation" means that recombinant humanized type XVIII collagen can effectively accelerate the cell cycle process of specific cells (including but not limited to human immortalized keratinocytes HaCaT and human skin fibroblasts HSF) by providing a suitable extracellular matrix microenvironment and corresponding biological signals, resulting in enhanced cell division activity and a significant increase in the number of cell populations.

[0082] In this invention, "skin wound repair" refers to the process by which recombinant humanized type XVIII collagen promotes the adhesion, migration and proliferation of skin cells (including fibroblasts and keratinocytes), accelerates wound re-epithelialization and granulation tissue formation, thereby promoting the restoration of the structural and functional integrity of skin tissue.

[0083] In this invention, "enhancing skin barrier function" means that recombinant humanized XVIII collagen can improve the vitality and integrity of keratinocytes, promote the synthesis of key barrier structural components such as ceramides and keratin, thereby reducing transepidermal water loss, improving skin moisturizing ability, and enhancing resistance to external stimuli.

[0084] In this invention, "anti-aging" refers to the comprehensive biological effect of recombinant humanized type XVIII collagen in delaying skin aging by promoting fibroblast proliferation and collagen synthesis, thereby enhancing the structural integrity of the dermis and improving keratinocyte function and epidermal renewal capacity. This effect is specifically manifested in improved skin elasticity, reduced wrinkle formation, enhanced skin barrier function, and increased skin hydration.

[0085] In this invention, "improving the basement membrane" refers to the process of optimizing the structure and composition of the basement membrane to enhance its core functions as a cell attachment substrate, a molecularly selective filter, and a cell signaling regulation platform, thereby providing crucial support for the stability, barrier function, and repair and regeneration capabilities of the superstructured tissues. Specifically, the recombinant humanized type XVIII collagen of this invention helps improve the composition and structure of the basement membrane, thereby providing the necessary microenvironmental support for enhancing the barrier function of related tissues, promoting repair and regeneration, and maintaining homeostasis.

[0086] The following embodiments are provided to illustrate the present invention. Those skilled in the art should understand that the embodiments are merely illustrative and not restrictive. The invention is limited only by the scope of the appended claims.

[0087] Example 1: Screening of functional regions of type XVIII collagen

[0088] Large-scale functional region screening of natural human-derived type XVIII collagen yielded the following different protein functional regions.

[0089] GSKGERGSPGPKGEKGEPGSI (SEQ ID NO:1)

[0090] To ensure the purification and stability of recombinant humanized XVIII type collagen, the amino acid fragments in these regions were optimized by repeated n times and directly linked to obtain recombinant humanized XVIII type collagen rhCol XVIII, the corresponding amino acid sequence of which is shown in SEQ ID NO:2.

[0091] The amino acid sequence (9 repeats) of recombinant humanized type XVIII collagen rhCol XVIII:

[0092] GSKGERGSPGPKGEKGEPGSI

[0093] GSKGERGSPGPKGEKGEPGSI

[0094] GSKGERGSPGPKGEKGEPGSI

[0095] GSKGERGSPGPKGEKGEPGSI

[0096] GSKGERGSPGPKGEKGEPGSI

[0097] GSKGERGSPGPKGEKGEPGSI

[0098] GSKGERGSPGPKGEKGEPGSI

[0099] GSKGERGSPGPKGEKGEPGSI

[0100] GSKGERGSPGPKGEKGEPGSI (SEQ ID NO:2)

[0101] The nucleotide sequence corresponding to the above amino acid sequence is as follows:

[0102] GGGTCAAAAGGAGAGCGTGGTTCCCCGGGTCCGAAAGGTGAGAAAGGCGAGCCGGGTAGCATTGGTAGCAAAGGCGAACGCGGTAGCCCGGGTCCGAAGGGCGAGAAGGGTGAACCGGGTTCCATCGGTAGCAAAGGCGAACGTGGTAGCCCAGGCCCAAAAGGTGAAAAGGGTGAGCCGGGTTCTATCGGTTCGAAAGGCGAAAGAGGCTCTCCGGGTCCGAAAGGCGAGAAAGGCGAGCCTGGCTCTATTGGCAGCAAGGGCGAACGTGGTAGCCCGGGTCCGAAGGGCGAGAAGGGCGAGCCGGGTAGCATTGGCTCCAAAGGCGAGCGTGGTTCACCGGGTCCGAAGGGCGAAAAGGGCGAACCGGGTTCGATCGGCAGCAAGGGTGAGCGCGGTTCCCCGGGTCCCAAGGGCGAGAAAGGTGAACCGGGTTCTATCGGGAGTAAGGGTGAACGTGGTAGCCCGGGTCCGAAAGGCGAAAAGGGGGAACCAGGCAGCATCGGCTCCAAAGGCGAGCGCGGTAGCCCGGGTCCGAAAGGCGAGAAGGGCGAACCGGGTAGCATT (SEQ ID NO:3)

[0103] Example 2: Preparation and expression of recombinant humanized type XVIII collagen

[0104] The gene functional region synthesized in Example 1 was inserted into the pET-28a-Trx-His expression vector to obtain the corresponding recombinant expression plasmid. The successfully constructed expression plasmid was transformed into E. coli competent cells BL21(DE3). The specific process is as follows:

[0105] (1) Take out Escherichia coli competent cells BL21(DE3) from the ultra-low temperature freezer and place them on ice. When they are half-thawed, take 2 μL of the plasmid to be transformed and add it to Escherichia coli competent cells BL21(DE3), and mix it slightly 2-3 times.

[0106] (2) Place the mixture on ice for 30 minutes, then heat shock it in a 42°C water bath for 45-90 seconds, and then place it on ice for 2 minutes.

[0107] (3) Transfer to a biosafety cabinet and add 700 μL of liquid LB medium, then incubate at 37°C and 220 rpm for 60 min.

[0108] (4) Take 200 μL of bacterial solution and spread it evenly on LB agar plates containing kanamycin sulfate.

[0109] (5) Incubate the plates in a 37°C incubator for 15-17 hours until uniform colonies grow.

[0110] Pick 5-6 single colonies from the transformed LB agar plates and place them in a shake flask containing LB broth containing the antibiotic (kanamycin sulfate). Incubate the flasks at 220 rpm and 37°C in a constant temperature shaker for a certain period of time until they become misty. Then, cool the shake flasks to 16-30°C, add IPTG (0.5 mM) to induce expression for a period of time, aliquot the bacterial culture into centrifuge bottles, centrifuge at 6000 rpm and 4°C for 12 min, collect the bacterial cells, record the cell weight, and perform electrophoresis analysis.

[0111] The collected bacterial cells were resuspended in a balanced working solution (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole). The bacterial suspension was cooled to ≤15℃ and homogenized twice or sonicated to disrupt the cells. After the cell disruption was completed, the bacterial suspension was collected. The disrupted bacterial suspension was aliquoted into centrifuge bottles and centrifuged at 17000 rpm and 4℃ for 30 min. The supernatant was collected.

[0112] The recombinant humanized type XVIII collagen was purified and enzymatically digested. The specific process was as follows:

[0113] (1) Crude Purification: a. Equilibrate the column: Equilibrate the column with equilibration buffer (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole) at a flow rate of 10 mL / min. b. Load the sample: Add the supernatant after centrifugation to the column until the liquid has completely flowed out at a flow rate of 5 mL / min. c. Wash away contaminating proteins: Add 100 mL of washing buffer (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole) until the liquid has completely flowed out at a flow rate of 10 mL / min. d. Collect the target protein: Add 20 mL of elution buffer (200 mM sodium chloride, 25 mM Tris, 250 mM imidazole) at a flow rate of 10 mL / min and collect the flow-through. e. Wash the column with 1 M imidazole working solution at a flow rate of 10 mL / min.

[0114] (2) Enzyme digestion: Add TEV enzyme at a ratio of total protein to total TEV enzyme of 20:1 and digest at 16℃ for 2 h. Place the digested protein solution into a dialysis bag and dialyze at 4℃ for 2 h, then transfer it to a new dialysis solution (20 mM sodium chloride, 20 mM Tris) and dialyze overnight at 4℃.

[0115] (3) Purification: a. Equilibrate the column: Equilibrate the column with solution A (20 mM Tris, 20 mM sodium chloride) at a flow rate of 10 ml / min. b. Load the sample: Load the sample at a flow rate of 5 mL / min and collect the flow-through sample. Perform electrophoresis and store the protein at 4°C. c. Elute: Wash the column with solution B (1 M sodium chloride, 20 mM Tris) for 5 CVs. d. Wash the column.

[0116] SDS-PAGE analysis of purified recombinant humanized type XVIII collagen; electrophoresis results are shown below. Figure 1 .like Figure 1 It can be seen that recombinant humanized type XVIII collagen was successfully expressed and prepared.

[0117] In the electrophoretic analysis of recombinant humanized type XVIII collagen, the molecular weight of the target protein was verified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The theoretical molecular weight calculated based on the amino acid sequence was 17956.49 Da, and the actual electrophoresis results showed (e.g.) Figure 1 As shown in the figure, the target band migration position corresponds to a molecular weight of approximately 23 kDa (±1.5 kDa), which is a certain potential shift compared to the theoretical value, and this is a reasonable phenomenon. Electrophoresis results show that the purified protein, apart from the target band, contains no other contaminating protein bands, proving that this implementation scheme can effectively separate the proteins.

[0118] The above results confirm that: 1) the recombinant expression system successfully produced type XVIII collagen with the corresponding molecular weight; 2) the chromatography purification protocol can effectively separate the target protein from host cell impurities, meeting the requirements of biomaterials; 3) the molecular weight shift is an expected phenomenon and does not affect the protein's functional activity.

[0119] Experimental Example 1: Cell Adhesion Experiment with Recombinant Humanized Type XVIII Collagen

[0120] 1. Experimental Methods

[0121] (1) The concentration of the protein samples to be tested was detected by ultraviolet absorption method, including bovine type I collagen (China National Institutes for Food and Drug Control, No.: 380002) and recombinant humanized collagen rhCol XVIII provided in this invention. The ultraviolet light absorption of the samples at 215 nm and 225 nm was measured respectively, and the protein concentration was calculated using the empirical formula C(μg / mL) = 144 × (A215 - A225), where C represents the protein concentration in the sample to be tested, A215 represents the absorbance of the sample to be tested at a wavelength of 215 nm, and A225 represents the absorbance of the sample to be tested at a wavelength of 225 nm. Note that the detection should be performed when A215 < 1.5. After the protein concentration was detected, the concentration of all the proteins to be tested was adjusted to 0.5 mg / mL with PBS.

[0122] (2) Add 100 μL of various protein solutions and blank PBS solution control (NC) to a 96-well plate and let it stand at room temperature for 60 min.

[0123] (3) Add 10 to each hole 5 One well-cultured NIH / 3T3 or HSF cell (purchased from ATCC) was incubated at 37°C for 60 min.

[0124] (4) Wash each well with PBS 4 times.

[0125] (5) OD was detected using the CCK-8 assay kit (Beyotime, product catalog number C0038). 450 The absorbance is measured in nm. Based on the values ​​of the blank control, the cell adhesion rate can be calculated. The calculation formula is as follows:

[0126] Cell adhesion rate = {(test wells - blank wells) / (positive wells - blank wells)} × 100%.

[0127] Cell adhesion rate reflects collagen activity. Higher protein activity allows for a better external environment to be provided to cells in a shorter time, thus aiding cell adhesion.

[0128] 2. Results Analysis

[0129] The results are as follows Figure 2 and Figure 3 As shown in the comparison, compared with the positive control (PC) bovine type I collagen (ColI group, 0.5 mg / mL), the recombinant humanized collagen rhCol XVIII of the present invention has better bioadhesion activity and can more effectively promote the adhesion of NIH / 3T3 and HSF cells.

[0130] NIH / 3T3 cells are mouse embryonic fibroblasts, a classic model for skin wound repair research. Their excellent adhesion properties demonstrate that rhCol XVIII can significantly promote fibroblast adhesion and migration. This efficacy indicates its important application value in skin wound repair and regeneration. The collagen of this invention can be used to prepare medical dressings and repair agents that promote skin wound healing.

[0131] HSF cells are human skin fibroblasts that directly reflect the functional state of the dermis layer of human skin. Their strong adhesion ability proves that rhCol XVIII can effectively activate the function of human fibroblasts. This efficacy indicates its clear application potential in skin anti-aging and skin texture improvement. The collagen of this invention can be used to prepare anti-aging skin care products that improve skin elasticity and reduce wrinkles.

[0132] Experimental Example 2: Effect of recombinant humanized type XVIII collagen on HaCaT cell viability

[0133] Human keratinocytes (HaCaT) are immortalized epidermal keratinocyte cell lines widely used to study the mechanisms of skin biology, oxidative stress, cell proliferation, and apoptosis. HaCaT cells exhibit typical keratinocyte characteristics, including expression of keratin and differentiation markers (such as involucrin), and can maintain a certain level of proliferation and migration ability in vitro. HaCaT cells adhere to epithelial cells, exhibit epithelial-like morphology, and express keratin, keratinocyte cross-linking outer membrane proteins, and intermediate filament-associated proteins, making them an important tool for studying epidermal keratinization.

[0134] 1 Experimental Methods

[0135] 1.1 Experimental Materials

[0136] (1) Cell line: human immortalized keratinocytes (HaCaT cells), purchased from the Cell Bank of the Chinese Academy of Sciences;

[0137] (2) Test sample: The recombinant humanized type XVIII collagen prepared in Example 2, with a concentration of 1 mg / mL, was diluted to the required concentration with serum-free DMEM medium;

[0138] (3) Main reagents: DMEM high glucose medium (Gibco, catalog number 11965-092), fetal bovine serum (FBS, BI, catalog number 04-001-1A), trypsin-EDTA digestion solution (0.25%, Gibco, catalog number 25200-072), CCK-8 kit (Tongren Chemical, catalog number CK04);

[0139] (4) Main instruments: CO2 incubator (Thermo, model 3111), microplate reader (Bio-Tek, model ELx800), biosafety cabinet (Thermo, model 1300).

[0140] 1.2 Cell Culture

[0141] After resuscitating HaCaT cells, they were seeded into culture flasks in DMEM high-glucose medium containing 10% FBS and cultured in an incubator at 37°C, 5% CO2, and saturated humidity. The medium was changed every 2-3 days. When the cell confluence reached 80%-90%, the cells were passaged using 0.25% trypsin-EDTA digestion solution, and cells in the logarithmic growth phase were used for experiments.

[0142] 1.3 Grouping and Dosing

[0143] HaCaT cells in logarithmic growth phase were used at a rate of 1×10⁻⁶. 4 Cells were seeded at a density of 100 μL / well in 96-well plates and incubated for 24 h to allow cell adhesion. The supernatant was then discarded, and serum-free DMEM medium (100 μL / well) containing different concentrations of the test sample was added in the following groups:

[0144] (1) Blank control group (NC group): serum-free DMEM medium;

[0145] (2) Experimental group (rhCol XVIII group): Five concentration gradients were set up, namely 10 μg / mL, 50 μg / mL, 100 μg / mL, 200 μg / mL and 500 μg / mL recombinant humanized XVIII type collagen;

[0146] Each group has 5 replicates to ensure the repeatability of parallel experiments.

[0147] 1.4 CCK-8 Test

[0148] After drug administration, the 96-well plates were placed in an incubator and cultured for 24h, 48h, and 72h, and CCK-8 assays were performed.

[0149] (1) Add 10 μL of CCK-8 reagent to each well, mix gently, and incubate in a 37℃, 5% CO2 incubator for 2h;

[0150] (2) After incubation, the absorbance (OD) of each well was measured at a wavelength of 450 nm using a microplate reader. 450 ), record data;

[0151] (3) Calculate the cell proliferation rate using the following formula:

[0152] Cell proliferation rate (%) = (OD value of experimental group - OD value of blank control group) / OD value of blank control group × 100%.

[0153] 2 Results Analysis

[0154] The results are as follows Figure 4 As shown in the comparison, compared with the blank control (NC), different concentrations of recombinant humanized XVIII type collagen (rhCol XVIII) in the experimental group showed a certain supportive effect on the growth of HaCaT cells. Its cell activity was basically the same as that of the culture medium control group, and it did not show significant cytotoxicity.

[0155] HaCaT cells, as immortalized human keratinocytes, are key cells in maintaining the skin's epidermal structure and participating in the regulation of basement membrane function. The results of this experiment show that rhCol XVIII can effectively support the biological function of the basement membrane by enhancing keratinocyte viability, thereby strengthening the stability of the epidermal-dermal junction and promoting the repair of the skin's physical barrier and epidermal tissue renewal. Therefore, the recombinant humanized collagen rhCol XVIII of this invention has clear application value in repairing the skin barrier and improving dry and rough skin, and is suitable for the development of functional skincare products and medical dressings.

[0156] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. Recombinant humanized type XVIII collagen, characterized in that, It comprises n repeating units, which are connected directly or via a linker, and each repeating unit contains the amino acid sequence shown in SEQ ID NO:1 or a variant thereof; The variant is (1) an amino acid sequence obtained by substituting, adding, deleting, or inserting one or more amino acids based on SEQ ID NO:1; or (2) an amino acid sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:1; preferably, n is an integer from 1 to 20; preferably, n is 9; Preferably, the recombinant humanized type XVIII collagen comprises the amino acid sequence shown in SEQ ID NO:2 or an amino acid sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:2, or comprises an amino acid sequence obtained by substitution, addition, deletion, or insertion of one or more amino acids based on SEQ ID NO:

2.

2. A fusion protein comprising the recombinant humanized type XVIII collagen of claim 1 and proteins for promoting collagen secretion, separation and / or purification; Preferably, the protein is selected from enzyme cleavage site sequences, signal peptides, and purification tags; Preferably, the restriction enzyme cleavage site sequence is the TEV protease cleavage site sequence; Preferably, the purification tag is selected from His tag, GST tag, MBP tag, SUMO tag, or NusA tag.

3. A polynucleotide encoding the collagen of claim 1 or the fusion protein of claim 2; preferably, the polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

3.

4. A vector comprising the polynucleotide of claim 3; preferably, the vector is an expression vector; preferably, the vector comprises a control element operatively linked to the polynucleotide; preferably, the control element is selected from promoters, terminators, and / or enhancers.

5. A host cell comprising the polynucleotide of claim 3 or the vector of claim 4; preferably, the host cell is a eukaryotic cell or a prokaryotic cell; preferably, the eukaryotic cell is a yeast cell, an animal cell and / or an insect cell, and / or the prokaryotic cell is an Escherichia coli cell.

6. A method for producing the recombinant humanized type XVIII collagen of claim 1 or the fusion protein of claim 2, characterized in that, Includes the following steps: (1) The host cells of claim 5 are cultured under suitable culture conditions; (2) Harvest host cells and / or culture medium containing type XVIII humanized collagen or fusion protein; (3) Purify recombinant humanized type XVIII collagen or fusion protein.

7. The composition, characterized in that, It comprises one or more of the following: the recombinant XVIII humanized collagen of claim 1, the fusion protein of claim 2, the polynucleotide of claim 3, the vector of claim 4, and the host cell of claim 5; Preferably, the composition is a pharmaceutical composition or a cosmetic composition; Preferably, the composition is one or more of the following: biological dressings, human biomimetic materials, plastic and cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection filling materials, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials and pharmaceutical excipients; Preferably, the composition is a surface composition, an injectable composition, or an oral composition; Preferably, the composition is a composition in the form of a solution, lyophilized powder, gel, sponge, or fiber.

8. The use of the recombinant humanized type XVIII collagen of claim 1, the fusion protein of claim 2, the polynucleotide of claim 3, the carrier of claim 4, and / or the host cell of claim 5 in the preparation of one or more of the following: bio-dressings, human biomimetic materials, plastic and cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection filling materials, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials, and pharmaceutical excipients.

9. Use of the recombinant humanized type XVIII collagen of claim 1 and / or the composition of claim 7 in the preparation of products having the effect of promoting cell adhesion and proliferation.

10. Use of the recombinant humanized type XVIII collagen of claim 1 and / or the composition of claim 7 in the preparation of products that improve the basement membrane and / or promote skin wound repair and / or enhance skin barrier function and / or anti-aging.

Images