Recombinant humanized XVI type collagen and application thereof

By constructing recombinant humanized XVI type collagen, the problem of large-scale production difficulties in existing technologies has been solved, achieving efficient and safe collagen preparation, which can be applied to a variety of biomaterials and cosmetics to promote skin repair and barrier function.

CN121824734APending Publication Date: 2026-04-10SHANXI JINBO BIO PHARMACEUTICAL CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-08
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

The lack of safe, efficient, and scalable recombinant XVI humanized collagen in existing technologies leads to immunogenic reactions and ethical controversies in its clinical application. Furthermore, traditional animal-derived extraction methods are costly and pose risks of disease transmission.

Method used

Using synthetic biology and structural biology techniques, recombinant humanized type XVI collagen was developed. By constructing repeating units containing specific amino acid sequences, large-scale fermentation and purification were carried out using host cells such as bacteria or yeast to prepare recombinant collagen with good biological activity, which can be fused with purification tags and precursors.

Benefits of technology

It has achieved high-yield, low-immunogenic production of recombinant humanized XVI type collagen, significantly improving cell adhesion activity, promoting skin damage repair and enhancing skin barrier function, and is suitable for various applications such as bio-dressings and human biomimetic materials.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121824734A_ABST
    Figure CN121824734A_ABST
Patent Text Reader

Abstract

The invention provides recombinant humanized XVI type collagen and application thereof, and belongs to the technical field of biosynthesis. The recombinant humanized XVI type collagen has excellent cell adhesiveness, biocompatibility and a function of promoting cell viability, and can effectively promote tissue repair and enhance skin barrier. The protein can be used for preparing biological dressings, tissue engineering materials, cosmetic fillers, organoid culture scaffolds, cosmetics and the like, and has wide application prospects in the fields of skin repair, medical cosmetology and tissue engineering.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biosynthesis technology, specifically relating to recombinant humanized type XVI collagen and its applications. Background Technology

[0002] Collagen is a type of protein that is widely distributed in human connective tissues and is the most abundant protein in the human body, accounting for 25% to 35% of the total protein. At least 28 collagen subtypes have been found in the human body, located in different tissues and organs.

[0003] Collagen XVI is a member of the fibrillary-associated collagen family with a discontinuous triple helix (FACIT) structure. Its molecule contains 10 collagen domains, spaced by 11 non-collagenous regions. The protein is composed of homotrimers of approximately 210 kDa α1 chains, and its structural stability primarily depends on disulfide bonds formed by 32 cysteine ​​residues in the non-collagenous regions located at the collagen domain boundaries. Furthermore, two of the three potential N-glycosylation sites in the molecule are located in the N-terminal NC11 region. Studies have shown that collagen XVI is widely expressed in various tissues during early mouse development, co-distributed with major fibrous collagen, particularly showing high expression in differentiated chondrocytes, dermal fibroblasts, cardiac smooth muscle cells, and spinal root nerve fibers. It has also been detected in the renal and ovarian cortex. In adult skin, collagen XVI is mainly distributed at the dermal-epidermal junction or in narrow perivascular areas of the dermis, and is generally not expressed in deep dermal tissues.

[0004] As research deepens, the biological importance of type XVI collagen is becoming increasingly prominent, and its potential in disease diagnosis and other areas has been reported (see, for example, patent CN111602056B). However, whether as a diagnostic biomarker or a structural material, its clinical application faces a common fundamental bottleneck: the lack of safe, efficient, and scalable production methods. Currently, mammalian cell-based production systems are costly and have low yields; while traditional animal-derived extraction methods face high immunogenicity and disease transmission risks (such as viral or prion contamination), which not only raises concerns about patient safety but also triggers ethical controversies and regulatory obstacles.

[0005] Therefore, there is an urgent need for a recombinant XVI type humanized collagen that can be mass-produced from the human body and will not cause an immunogenic reaction, so as to be used as a structural material for tissue repair. Summary of the Invention

[0006] To address current needs, this invention utilizes synthetic biology and structural biology techniques to develop recombinant humanized XVI type collagen with good biological activity and the ability to function as human collagen.

[0007] This invention provides recombinant humanized type XVI collagen, comprising one or more repeating units, wherein the repeating unit comprises:

[0008] (1) The amino acid sequence shown in SEQ ID NO:1; or

[0009] (2) An amino acid sequence in which one or more amino acid residues have been mutated in the amino acid sequence shown in SEQ ID NO:1; or

[0010] (3) It has at least 80% identical amino acid sequence to the amino acid sequence shown in SEQ ID NO:1;

[0011] The number of repeating units is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20; each repeating unit is directly connected by peptide bonds or by a linker of one or more amino acids.

[0012] In some specific embodiments of the present invention, mutation is substitution, insertion, deletion or addition.

[0013] In this invention, the recombinant humanized XVI type collagen comprises:

[0014] (1) The amino acid sequence shown in SEQ ID NO:2; or

[0015] (2) Has at least 80% identical amino acid sequence to the amino acid sequence shown in SEQ ID NO:2; or

[0016] (3) An amino acid sequence in which one or more amino acid residues have been mutated in the amino acid sequence shown in SEQ ID NO:2.

[0017] In some specific embodiments of the present invention, mutation is substitution, insertion, deletion or addition.

[0018] This invention provides a fusion protein comprising the recombinant humanized type XVI collagen described herein and a purified tag and / or precursor.

[0019] In some specific embodiments of the present invention, the purification tag is selected from His tag, GST tag, MBP tag, SUMO tag or NusA tag.

[0020] This invention provides polynucleotides that encode the collagen or fusion protein described herein.

[0021] In some specific embodiments of the present invention, the polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:3 or a degenerate sequence thereof.

[0022] This invention provides a vector comprising the polynucleotides described herein.

[0023] In some specific embodiments of the present invention, the vector comprises a nucleotide encoding a purification tag, a nucleotide encoding a leader, and / or a regulatory element.

[0024] The present invention provides a host cell comprising the polynucleotides described herein, or the vectors described herein.

[0025] In some specific embodiments of the present invention, the host cell is a bacterium, fungus, or animal cell.

[0026] In some specific embodiments of the present invention, the bacteria include Escherichia coli.

[0027] In some specific embodiments of the present invention, the fungus includes yeast.

[0028] This invention provides a method for producing the recombinant humanized type XVI collagen described herein, comprising the following steps:

[0029] (1) Culture the host cells described in this article;

[0030] (2) Obtaining host cells and / or culture medium containing the recombinant humanized type XVI collagen; and

[0031] (3) Purify the recombinant humanized XVI type collagen.

[0032] The present invention provides compositions comprising one or more of the recombinant humanized type XVI collagen, fusion protein, polynucleotide, vector, and host cell described herein.

[0033] In some specific embodiments of the present invention, the composition is one or more of the following: biological dressings, human biomimetic materials, plastic or cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection filling materials, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials and pharmaceutical excipients.

[0034] This invention provides the use of the recombinant humanized type XVI collagen, fusion protein, polynucleotide, carrier and / or host cell described herein in the preparation of one or more of the following: bio-dressings, human biomimetic materials, plastic and cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection filling materials, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials and pharmaceutical excipients.

[0035] This invention provides the use of the recombinant humanized type XVI collagen, fusion protein and / or composition described herein in the preparation of medicaments or kits for promoting cell adhesion or cell fixation.

[0036] This invention provides the use of the recombinant humanized type XVI collagen described herein in the preparation of functional products for promoting skin damage repair and / or enhancing the skin barrier and / or improving the basement membrane.

[0037] The beneficial effects of this invention are:

[0038] This invention provides a novel core functional region for recombinant humanized XVI type collagen and successfully constructs a recombinant humanized XVI type collagen with good biological activity based on this novel core functional region. The amino acid composition of the collagen protein is 100% identical to the corresponding part of the amino acid sequence of natural human XVI type collagen, and its application in humans will not cause immune rejection or allergic reactions. Furthermore, the recombinant humanized XVI type collagen of this invention exhibits excellent cell adhesion activity, significantly enhancing the vitality of key skin cells such as keratinocytes. It has strong biocompatibility and can not only promote the repair of skin surface damage but also provide a stable microenvironment for skin cells by improving the structure and function of the basement membrane, thereby helping to maintain the healthy state of skin cells, enhance skin barrier function, and improve signs of skin aging. In addition, the preparation method of this invention is simple and can produce high-yield recombinant XVI type humanized collagen on a large scale. Attached Figure Description

[0039] Figure 1 Electrophoresis diagram of recombinant humanized XVI type collagen (rhCol-XVI);

[0040] Figure 2 To observe the adhesion of recombinant humanized XVI type collagen to NIH / 3T3 cells;

[0041] Figure 3 The effects of different concentrations of recombinant humanized type XVI collagen on the viability of HaCaT cells. Detailed Implementation

[0042] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0043] As used in this article, "recombinant humanized collagen" is a full-length or partial amino acid sequence fragment encoded by a specific type of human collagen gene prepared by DNA recombination technology, or a combination containing functional fragments of human collagen.

[0044] As used herein, "fusion protein" refers to a fusion of a protein comprising recombinant humanized type XVI collagen and another functional portion. In some embodiments, the other functional portion is a protein for promoting collagen secretion, separation, and / or purification. Proteins for promoting collagen secretion, separation, and / or purification are well known to those skilled in the art and include, but are not limited to, restriction enzyme sites, signal peptides, and purification tags.

[0045] As used herein, "polynucleotide" refers to a plurality of nucleotides linked by nucleotide bonds (e.g., phosphodiester bonds). The polynucleotides described herein may contain sequences encoding the collagen of this invention. For ease of subsequent processing of the collagen, the polynucleotide may also contain sequences encoding purification tags (e.g., His tags, GST tags, MBP tags, SUMO tags, or NusA tags), and, when necessary, nucleotide sequences encoding leader sequences.

[0046] As used herein, "vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, animal cell viruses, mammalian cell viruses, or other vectors well-known in the art. In short, any plasmid and vector can be used as long as it can replicate and remain stable within the host. An important characteristic of expression vectors is that they typically contain an origin of replication, a promoter, a marker gene, and translational control elements.

[0047] As used in this article, a "host cell" is a cell into which nucleic acid molecules have been introduced using molecular biology techniques. These techniques include transfection with viral vectors, transformation with plasmid vectors, and accelerated introduction of naked DNA via electroporation, lipid transfection, and particle gun techniques. Host cells can be bacterial, fungal, or animal cells. For example, bacteria can be *Escherichia coli*; fungi include yeasts, such as *Saccharomyces cerevisiae*.

[0048] As used herein, "improving the basement membrane" refers to the process of optimizing the structure and composition of the basement membrane to enhance its core functions as a cell attachment substrate, a molecularly selective filter, and a cell signaling regulation platform, thereby providing crucial support for the stability, barrier function, and repair and regeneration capabilities of the superstructure. Specifically, the recombinant humanized XVI type collagen of this invention helps improve the composition and structure of the basement membrane, thereby providing the necessary microenvironmental support for enhancing the barrier function of related tissues, promoting repair and regeneration, and maintaining homeostasis.

[0049] As used in this article, “promoting skin damage repair” means that recombinant humanized XVI type collagen can promote the damage repair process at the cellular and tissue levels by promoting the adhesion, migration and proliferation of skin cells (including but not limited to fibroblasts and keratinocytes), enhancing the formation of granulation tissue and the ability of epithelial regeneration.

[0050] As used in this article, “enhancing skin barrier function” means that recombinant humanized XVI type collagen can improve the vitality and integrity of keratinocytes, promote the synthesis of key barrier structural components such as ceramides and keratin, thereby reducing transepidermal water loss, improving skin moisturizing ability, and enhancing resistance to external stimuli.

[0051] Recombinant humanized type XVI collagen

[0052] This invention provides recombinant humanized type XVI collagen, comprising one or more repeating units, wherein the repeating unit comprises:

[0053] (1) The amino acid sequence shown in SEQ ID NO:1; or

[0054] (2) An amino acid sequence in which one or more amino acid residues have been mutated in the amino acid sequence shown in SEQ ID NO:1; or

[0055] (3) It has at least 80% identical amino acid sequence to the amino acid sequence shown in SEQ ID NO:1;

[0056] The number of repeating units is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20; each repeating unit is directly connected by peptide bonds or by a linker of one or more amino acids.

[0057] In some implementations, mutations are substitutions, insertions, deletions, or additions.

[0058] In some implementations, the mutation can be a substitution, such as a conserved amino acid substitution.

[0059] In some embodiments, the repeating unit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or any percentage identity between 80% and 99% with the amino acid sequence shown in SEQ ID NO:1.

[0060] In some implementations, the number of repeating units is 9.

[0061] In some implementations, the repeating units are directly connected.

[0062] In some embodiments, each repeating unit is spaced apart by one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10) amino acid residues.

[0063] In some embodiments, the recombinant humanized XVI type collagen comprises the amino acid sequence shown in SEQ ID NO:2.

[0064] In some embodiments, the recombinant humanized type XVI collagen comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with SEQ ID NO:2, or comprises an amino acid sequence obtained by substituting, deleting, inserting, or adding one or more amino acid residues based on SEQ ID NO:2.

[0065] Recombinant humanized type XVI collagen encodes nucleic acid

[0066] This invention provides a polynucleotide encoding recombinant humanized type XVI collagen for expression.

[0067] In some embodiments, the polynucleotide is codon-optimized for the host cell in which it is expressed.

[0068] In some implementations, the polynucleotide encoding recombinant humanized type XVI collagen can be operatively linked to expression control elements, such as promoters, terminators, and / or enhancers, to form a nucleic acid or expression cassette.

[0069] In some embodiments, the polynucleotide encoding recombinant humanized type XVI collagen may also include nucleotides encoding purification tags, such as His tags, GST tags, MBP tags, SUMO tags, or NusA tags, or nucleotides encoding leader sequences to facilitate peptide purification or secretion.

[0070] Composition

[0071] The present invention provides a composition comprising recombinant humanized type XVI collagen.

[0072] In this document, the composition may be a pharmaceutical composition or a cosmetic composition for pharmaceutical and / or cosmetic purposes. For example, the composition is one or more of the following: bio-dressings (e.g., collagen bio-dressings), biomimetic materials, plastic and cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection fillers, ophthalmic materials, biomaterials for gynaecology, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic ingredients, and pharmaceutical excipients.

[0073] In some embodiments, the cosmetic composition may be a composition that promotes skin damage repair, enhances skin barrier function, and / or improves the structure and function of the basement membrane. There are no particular limitations on the application site of the cosmetic composition; it may be the face, hands, legs, torso, etc. For example, when the composition is used to improve the facial skin barrier, its effects may include enhanced moisturizing, soothing irritation, or improving overall skin health.

[0074] In this document, there are no particular limitations on the form of the composition, as long as it can achieve the intended function. For example, the composition may be a solid, liquid, or gel composition.

[0075] In some embodiments, the composition may also contain a pharmaceutically or cosmetically acceptable carrier, excipient, stabilizer, preservative or other active ingredient.

[0076] In this document, the compositions can be applied in any suitable manner, such as compositions for oral and / or topical application. The compositions can also be prepared as kits. Kits may contain additional ingredients, such as excipients like buffers, and include instructions for use. In particular, the compositions can be formulated into suitable formulations, such as liquid formulations. Formulations may contain buffers, such as D-PBS buffer or PBS buffer.

[0077] Construction and production method of recombinant humanized type XVI collagen

[0078] The present invention also provides a method for constructing recombinant humanized type XVI collagen, including functional region screening and strain construction, large-scale bio-fermentation, protein induction expression, purification and optional enzymatic digestion steps.

[0079] In some embodiments, the functional region screening and strain construction steps include: (1) large-scale functional region screening to obtain the target gene functional region; (2) inserting the obtained target gene functional region into an expression vector (e.g., PET-28a-Trx-His) to obtain a recombinant expression plasmid; (3) transforming the recombinant expression plasmid into competent Escherichia coli cells (e.g., BL21(DE3)) and screening to obtain positive Escherichia coli genetically engineered bacteria.

[0080] In some embodiments, the large-scale bio-fermentation step includes: adding the screened positive Escherichia coli genetically engineered bacteria to a shake flask containing an antibiotic stock solution and culturing it in a constant temperature shaker at 220 rpm and 37°C.

[0081] In some embodiments, the steps of inducing protein expression include: (1) cooling the cultured shake flask to 16-30°C; (2) adding IPTG stock solution to induce expression; and (3) collecting the bacterial cells after inducing expression by placing the bacterial culture in a centrifuge bottle and centrifuging at 6000 rpm and 4°C for 12 min.

[0082] In some embodiments, the purification and optional enzymatic digestion steps of recombinant humanized XVI type collagen include: (1) crude purification of recombinant humanized XVI type collagen on a Ni affinity chromatography column; (2) enzymatic digestion with TEV enzyme added in a certain proportion; and (3) purification of recombinant humanized XVI type collagen on an ion exchange column.

[0083] The following embodiments are provided to illustrate the present invention. Those skilled in the art should understand that the embodiments are merely illustrative and not restrictive. The invention is limited only by the scope of the appended claims.

[0084] Example 1: Screening of functional regions of type XVI collagen

[0085] Large-scale functional region screening of natural human-derived type XVI collagen yielded the following different protein functional regions.

[0086] GPKGEKGESGALPGPSGLPGSTGEKGQKGEK (SEQ ID NO: 1)

[0087] The amino acid fragments in these regions were optimized by repeating them n times and directly linking them to obtain recombinant collagen rhCol-XVI, and the corresponding amino acid sequence as shown in SEQ ID NO:2.

[0088] rhCol-XVI:

[0089] GPKGEKGESGALPGPSGLPGSTGEKGQKGEK

[0090] GPKGEKGESGALGPSGLPGSTGEKGQKGEK

[0091] GPKGEKGESGALGPSGLPGSTGEKGQKGEK

[0092] GPKGEKGESGALGPSGLPGSTGEKGQKGEK

[0093] GPKGEKGESGALGPSGLPGSTGEKGQKGEK

[0094] GPKGEKGESGALGPSGLPGSTGEKGQKGEK

[0095] GPKGEKGESGALGPSGLPGSTGEKGQKGEK

[0096] GPKGEKGESGALGPSGLPGSTGEKGQKGEK

[0097] GPKGEKGESGALGPSGLPGSTGEKGQKGEK (SEQ ID NO:2)

[0098] The nucleotide sequence corresponding to the above amino acid sequence is as follows:

[0099] GGGCCCAAAGGAGAGAAAGGCGAGTCCGGCGCGCTGGGCCCAAGCGGTCTTCCGGGTTCTACGGGCGAGAAGGGCCAGAAAGGCGAAAAGGGCCCGAAAGGTGAAAAGGGCGAAAGCGGTGCTCTGGGTCCGTCCGGTTTGCCGGGCAGCACCGGCGAAAAAGGTCAGAAAGGTGAAAAGGGACCGAAAGGCGAAAAAGGCGAATCTGGCGCATTGGGCCCGTCCGGTCTGCCGGGTAGCACCGGTGAGAAGGGCCAAAAAGGCGAGAAGGGTCCGAAGGGCGAGAAGGGCGAGTCAGGCGCGCTGGGTCCGAGCGGTCTGCCGGGTAGCACCGGTGAGAAGGGACAAAAAGGTGAGAAAGGTCCGAAAGGCGAAAAGGGCGAAAGCGGCGCGCTGGGTCCGAGCGGTTTACCGGGTAGCACCGGTGAAAAGGGTCAGAAAGGCGAAAAAGGTCCGAAAGGTGAGAAGGGCGAGTCGGGTGCCCTGGGTCCGTCTGGCTTGCCTGGTAGCACCGGTGAGAAGGGTCAGAAAGGTGAAAAGGGCCCAAAAGGTGAAAAAGGTGAGTCCGGTGCGCTGGGTCCGTCCGGCCTCCCTGGTTCTACGGGTGAGAAGGGTCAAAAAGGCGAAAAGGGTCCGAAAGGTGAGAAGGGGGAGAGCGGTGCATTGGGCCCAAGTGGCCTGCCGGGTTCGACCGGTGAGAAGGGCCAGAAGGGCGAAAAGGGCCCGAAAGGTGAGAAGGGCGAGAGCGGTGCTCTGGGTCCGAGCGGCCTGCCGGGTAGCACTGGTGAAAAAGGCCAAAAAGGCGAAAAG (SEQ ID NO:3)

[0100] Example 2: Preparation and Expression of Recombinant Humanized Collagen XVI

[0101] 1 Experimental Methods

[0102] 1.1 Plasmid Transformation and Protein Expression

[0103] The gene functional region synthesized in Example 1 was inserted into the pET-28a-Trx-His expression vector to obtain the corresponding recombinant expression plasmid. The successfully constructed expression plasmid was transformed into E. coli competent cells BL21(DE3). The specific steps are as follows:

[0104] (1) Take out Escherichia coli competent cells BL21(DE3) from the ultra-low temperature freezer and place them on ice. When they are half-thawed, take 2 μL of the plasmid to be transformed and add it to Escherichia coli competent cells BL21(DE3), and mix it slightly 2-3 times.

[0105] (2) Place the mixture in an ice bath for 30 min, then heat shock it in a water bath at 42℃ for 45-90 s, and then place it in an ice bath for 2 min.

[0106] (3) Transfer to a biosafety cabinet and add 700 μL of liquid LB medium, then incubate at 37°C and 220 rpm for 60 min.

[0107] (4) Take 200 μL of bacterial solution and spread it evenly on LB agar plates containing kanamycin sulfate.

[0108] (5) Incubate the plates in a 37°C incubator for 15-17 h until uniform colonies grow.

[0109] (6) Pick 5-6 single colonies from the transformed LB plate and place them in a shake flask containing antibiotic stock solution (100 mg / L kanamycin sulfate). Incubate the flasks at 220 rpm and 37°C for a certain period of time until they appear as a mist. Then cool the shake flasks to 16-30°C, add IPTG (0.5 mM) to induce expression for a period of time, then aliquot the bacterial culture into centrifuge bottles and centrifuge at 6000 rpm and 4°C for 12 min. Collect the bacterial cells, record the cell weight, and take samples for electrophoresis detection.

[0110] 1.2 Cell disruption

[0111] The collected bacterial cells were resuspended in a balanced working solution (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole). The bacterial suspension was cooled to ≤15℃ and homogenized twice or sonicated to disrupt the cells. After the cell disruption was completed, the bacterial suspension was collected. The disrupted bacterial suspension was aliquoted into centrifuge bottles and centrifuged at 17000 rpm and 4℃ for 30 min. The supernatant was collected.

[0112] 1.3 Protein purification and enzymatic digestion

[0113] (1) Crude and pure

[0114] a. Equilibrate the column: Equilibrate the column using equilibration buffer (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole) at a flow rate of 10 mL / min. b. Load the sample: Add the supernatant collected in step 1.2 to the column until the liquid has completely flowed out, at a flow rate of 5 mL / min. c. Wash away contaminating proteins: Add 100 mL of washing buffer (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole) until the liquid has completely flowed out, at a flow rate of 10 mL / min. d. Collect the target protein: Add 20 mL of elution buffer (200 mM sodium chloride, 25 mM Tris, 250 mM imidazole) at a flow rate of 10 mL / min, collect the flow-through, and perform electrophoresis. e. Wash the column with 1 M imidazole working solution at a flow rate of 10 mL / min.

[0115] (2) Enzyme digestion

[0116] Add TEV enzyme at a ratio of total protein to total TEV enzyme of 20:1, and digest at 16°C for 2 h. Place the digested protein solution into a dialysis bag and dialyze at 4°C for 2 h, then transfer it to a new dialysis buffer (20 mM sodium chloride, 20 mM Tris) and dialyze overnight at 4°C.

[0117] (3) Pure

[0118] a. Equilibrate the column: Equilibrate the column using solution A (20 mM Tris, 20 mM sodium chloride) at a flow rate of 10 mL / min. b. Load the sample: Load the sample at a flow rate of 5 mL / min and collect the flow-through sample. Perform electrophoresis and store the protein at 4°C. c. Elute: Wash the column with solution B (1 M sodium chloride, 20 mM Tris) for 5 CVs. d. Wash the column.

[0119] 2 Results Analysis

[0120] A process for the expression and purification of recombinant humanized XVI type collagen (rhCol-XVI) has been successfully developed and optimized. The protein was efficiently expressed in the host system. Initial capture was achieved using a fusion histidine tag strategy, followed by complete tag removal via enzymatic digestion under mild conditions (25°C) for 3 hours. The purification process employed a two-step chromatographic strategy: first, affinity chromatography effectively enriched the target protein, followed by further purification via ion exchange chromatography, significantly improving product purity.

[0121] After process optimization, high-quality rhCol-XVI protein was successfully obtained. SDS-PAGE electrophoresis results showed that the final product exhibited a single main band in the gel, indicating extremely low levels of contaminating proteins and achieving high-purity protein preparation. This result not only confirms the effectiveness of the expression system and upstream processes but also verifies the good reliability and efficiency of the downstream purification process (affinity capture—enzyme cleavage detacking—ion exchange purification). Figure 1 As shown, the rhCol-XVI band after two-step purification is single and has low impurity content, indicating that the protein has been successfully expressed and prepared.

[0122] In the electrophoretic analysis of recombinant humanized type XVI collagen, the molecular weight of the target protein was verified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The theoretical molecular weight calculated based on the amino acid sequence was 25281.64 Da, and the actual electrophoresis results showed (e.g.) Figure 1 As shown in the image, the target band is clear and free of impurities. The charge on the collagen itself causes the small molecular weight electrophoretic band to shift, which is a normal phenomenon.

[0123] The above results confirm that: 1) the recombinant expression line and purification scheme constructed in this invention successfully produced XVI type collagen; 2) the chromatography purification scheme can effectively separate the target protein from host cell impurities, meeting the purity requirements of biological materials; 3) the molecular weight shift is an expected phenomenon and does not affect the protein's functional activity.

[0124] Example 3: NIH / 3T3 fibroblast adhesion assay using recombinant humanized XVI type collagen

[0125] 1 Experimental Methods

[0126] 1.1 Materials and Reagents

[0127] (1) Protein sample

[0128] Experimental group: Recombinant humanized XVI type collagen (rhCol-XVI) prepared in Example 2.

[0129] Positive control group (PC): Bovine type I collagen (China National Institutes for Food and Drug Control, product number: 380002);

[0130] Negative control group (NC): Phosphate-buffered saline (PBS).

[0131] (2) Cell line: mouse embryonic fibroblasts (NIH / 3T3 cells).

[0132] (3) Main reagents: CCK-8 cell proliferation-toxicity assay kit (Beyotime, product catalog number C0038), DMEM complete culture medium, PBS buffer.

[0133] (4) Experimental equipment: 96-well cell culture plate, CO2 cell incubator, enzyme-linked immunosorbent assay (ELISA) reader.

[0134] 1.2 Experimental Procedure

[0135] (1) The concentration of the protein sample was detected by ultraviolet absorption method. The ultraviolet light absorption of the sample at 215 nm and 225 nm was measured respectively. The protein concentration was calculated using the empirical formula C (μg / mL) = 144 × (A215 - A225), where C represents the protein concentration in the sample, A215 represents the absorbance of the sample at 215 nm, and A225 represents the absorbance of the sample at 225 nm. Note that the detection must be performed when A215 < 1.5. The principle of this method is to measure the characteristic absorption of peptide bonds under far ultraviolet light, which is not affected by the content of chromophores, has few interfering substances, and is simple to operate. It is suitable for detecting human collagen and its analogues that are not colorimetric by Coomassie Brilliant Blue. After the protein concentration was measured, the concentration of all the proteins was adjusted to 0.5 mg / mL with PBS.

[0136] (2) Add 100 μL of various protein solutions and blank PBS solution control (NC) to a 96-well plate and let it stand at room temperature for 60 min.

[0137] (3) Add 10 to each hole 5 A well-cultured NIH / 3T3 cell was incubated at 37°C for 60 minutes.

[0138] (4) Wash each well 4 times with PBS buffer.

[0139] (5) OD was detected using the CCK8 assay kit (Beyotime, product catalog number C0038). 450 The absorbance is measured in nm. Based on the values ​​of the blank control, the cell adhesion rate can be calculated. The calculation formula is as follows:

[0140] Cell adhesion rate = {(test wells - blank wells) / (positive wells - blank wells)} × 100%

[0141] Cell adhesion rate reflects collagen activity. Higher protein activity allows for a better external environment to be provided to cells in a shorter time, thus aiding cell adhesion.

[0142] 2 Results Analysis

[0143] like Figure 2As shown, the recombinant humanized XVI type collagen (rhCol-XVI) provided by this invention exhibits significant cell adhesion-promoting activity. Compared with the positive control (bovine type I collagen, Col I), at the same concentration (0.5 mg / mL), the humanized collagen rhCol-XVI of this invention has superior bioadhesion activity.

[0144] This experiment demonstrates that rhCol-XVI effectively promotes the adhesion of NIH / 3T3 fibroblasts. These cells are core effector cells that maintain skin structure and repair function. The superior adhesion ability indicates that rhCol-XVI can serve as a functional matrix, directly supporting cell spread and migration by mediating the interaction between cells and their microenvironment, which is crucial for accelerating wound healing. Simultaneously, stable adhesion is a key initial signal for activating fibroblasts and enhancing their extracellular matrix synthesis capacity, thereby potentially improving skin elasticity and anti-aging effects.

[0145] Example 4: Effect of recombinant humanized type XVI collagen on HaCaT cell viability

[0146] HaCaT cells, an immortalized human keratinocyte cell line, retain the key differentiation potential and functional expression profile of keratinocytes. They exhibit high stability, reproducibility, and no oncogenicity in vitro, making them a standardized model for in vitro skin-related research. HaCaT cells can synthesize keratin, lipids, and tight junction proteins to mimic the epidermal barrier function. Through proliferative activity and repair potential, they replicate skin renewal metabolism and wound healing processes. They can express inflammation-related cytokines and immunomodulatory molecules in response to immune defense and inflammatory regulation needs, and secrete natural moisturizing factors to participate in skin moisture balance regulation. This precisely corresponds to the core attributes of human skin barrier protection, repair and regeneration, immune regulation, and moisturizing. This embodiment uses this cell model to verify the regulatory effect of recombinant human collagen on skin-related functions. The experimental results can be reasonably extrapolated to the actual application effects on human skin, providing direct evidence to support the creativity and practicality of the technical solution.

[0147] 1 Experimental Methods

[0148] 1.1 Experimental materials, reagents and equipment

[0149] Cell line: HaCaT cells (human immortalized keratinocytes).

[0150] Main reagents: CCK-8 kit (Elabscience, catalog number E-CK-A362), recombinant humanized type XVI collagen (concentration 10-100 μg / mL, expressed and purified from the gene sequence described in this application), and DMEM medium (containing 10% fetal bovine serum).

[0151] Experimental equipment: CO2 incubator, microplate reader (450 nm detection wavelength), 96-well cell culture plate.

[0152] 1.2 Experimental Procedure

[0153] (1) Cell seeding and grouping:

[0154] HaCaT cells in logarithmic growth phase were collected by trypsin digestion, centrifuged, resuspended in serum-containing medium, and counted; the cell density was adjusted to 5 × 10⁶ cells / year. 4 Cells / mL were seeded at a rate of 100 μL per well in a 96-well plate (i.e., 5000 cells / well). Three groups were set up as follows:

[0155] Experimental group: Complete culture medium containing different final concentrations of rhCol-XVI (25, 50, 100 μg / mL) was added;

[0156] Control group: Add an equal volume of complete culture medium without rhCol-XVI;

[0157] Control group: only complete culture medium was added (no cells were inoculated).

[0158] (2) Processing and incubation

[0159] The culture plates were pre-cultured at 37°C and 5% CO2 for 24 hours to allow the cells to adhere. The original culture medium was then discarded, and fresh culture medium containing recombinant collagen was added to the experimental group. The control group and blank group were replaced with the same amount of ordinary culture medium. The incubation was continued for 48 hours (adjusted according to the cell proliferation cycle).

[0160] (3) CCK-8 detection:

[0161] Add 10 μL of CCK-8 solution to each well (avoiding air bubbles), gently shake to mix; incubate at 37°C in the dark for 2 hours (HaCaT cell color development time optimized and determined); measure absorbance (OD value) at 450 nm using an ELISA reader, with a reference wavelength of 600 nm.

[0162] 1.3 Data Calculation

[0163] The formula for calculating cell viability is as follows:

[0164] Cell viability (%) = [(OD experimental group - OD blank group) / (OD control group - OD blank group)] × 100%

[0165] 2 Results Analysis

[0166] like Figure 3As shown, compared with the control group without added collagen, HaCaT cells treated with different concentrations (25-100 μg / mL) of recombinant humanized XVI type collagen (rhCol-XVI) showed significantly improved cell viability, and the effect was well dose-dependent.

[0167] HaCaT cells, as immortalized human keratinocytes, are key cells in maintaining the skin's epidermal structure and participating in the regulation of basement membrane function. The results of this experiment show that rhCol-XVI can effectively support the biological function of the basement membrane by enhancing keratinocyte viability, thereby strengthening the stability of the epidermal-dermal junction and promoting the repair of the skin's physical barrier and epidermal tissue renewal. Therefore, the recombinant humanized collagen rhCol-XVI of this invention has clear application value in repairing the skin barrier and improving skin dryness and roughness, and is suitable for the development of functional skincare products and medical dressings.

[0168] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. Recombinant humanized type XVI collagen, comprising one or more repeating units, wherein the repeating unit comprises: (1) The amino acid sequence shown in SEQ ID NO:1; or (2) An amino acid sequence in which one or more amino acid residues have been mutated in the amino acid sequence shown in SEQ ID NO:1; or (3) It has at least 80% identical amino acid sequence to the amino acid sequence shown in SEQ ID NO:1; The number of repeating units is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20; each repeating unit is directly connected by peptide bonds or by a linker of one or more amino acids. Preferably, the mutation is a substitution, insertion, deletion, or addition.

2. The recombinant humanized type XVI collagen according to claim 1, characterized in that, The recombinant humanized XVI type collagen comprises: (1) The amino acid sequence shown in SEQ ID NO:2; or (2) Has at least 80% identical amino acid sequence to the amino acid sequence shown in SEQ ID NO:2; or (3) An amino acid sequence in which one or more amino acid residues have been mutated in the amino acid sequence shown in SEQ ID NO:2; preferably, the mutation is substitution, insertion, deletion or addition.

3. A fusion protein comprising the recombinant humanized type XVI collagen as described in claim 1 or 2 and a purified tag and / or precursor; preferably, the purified tag is selected from His tag, GST tag, MBP tag, SUMO tag or NusA tag.

4. A polynucleotide encoding the recombinant humanized type XVI collagen of claim 1 or 2 or the fusion protein of claim 3; preferably, the polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

3.

5. A vector comprising the polynucleotide of claim 4; preferably, the vector comprises a nucleotide encoding a purification tag, a nucleotide encoding a leader, and / or a regulatory element.

6. A host cell comprising the polynucleotide of claim 4 or the vector of claim 5; preferably, the host cell is a bacterium, fungus or animal cell; preferably, the bacterium comprises Escherichia coli; preferably, the fungus comprises yeast.

7. A method for producing the recombinant humanized type XVI collagen according to claim 1 or 2, characterized in that, Includes the following steps: (1) Culturing the host cells as described in claim 6; (2) Obtaining host cells and / or culture medium containing the recombinant humanized type XVI collagen; and (3) Purify the recombinant humanized XVI type collagen.

8. A composition, characterized in that, It comprises one or more of the following: the recombinant humanized type XVI collagen of claim 1 or 2, the fusion protein of claim 3, the polynucleotide of claim 4, the vector of claim 5, and the host cell of claim 6.

9. The composition according to claim 8, characterized in that, The composition is one or more of the following: biological dressings, human biomimetic materials, plastic or cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection filling materials, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials and pharmaceutical excipients.

10. The use of the recombinant humanized type XVI collagen of claim 1 or 2, the fusion protein of claim 3, the polynucleotide of claim 4, the carrier of claim 5, and / or the host cell of claim 6 in the preparation of one or more of the following: bio-dressings, human biomimetic materials, plastic and cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection filling materials, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials, and pharmaceutical excipients.

11. Use of the recombinant humanized type XVI collagen of claim 1 or 2, the fusion protein of claim 3, and / or the composition of claim 8 in the preparation of a medicament or kit for promoting cell adhesion or cell fixation.

12. Use of the recombinant humanized type XVI collagen of claim 1 or 2 in the preparation of functional products for promoting skin damage repair and / or enhancing the skin barrier and / or improving the basement membrane.