DsRNA expression engineering strain constructed by using yarrowia lipolytica MP181-2 strain as chassis bacterium as well as preparation method and application of dsRNA expression engineering strain

By constructing the Yeast M. lipophilus MP181-2 strain to express Botrytis cinerea dsRNA, the problems of high synthesis cost and poor stability of dsRNA in plant disease and pest control were solved, achieving efficient and stable control of Botrytis cinerea.

CN121825762APending Publication Date: 2026-04-10QINGDAO AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
QINGDAO AGRI UNIV
Filing Date
2025-12-31
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

The current application of dsRNA in plant disease and pest control suffers from high synthesis costs, poor stability, and low delivery efficiency, which limits the commercialization of SIGS technology. The lack of mature genetic transformation systems for some crops also restricts the promotion of HIGS technology.

Method used

A dsRNA expression engineered strain was constructed using Yersinia lipophila MP181-2 as the substrate fungus. By colonizing and expressing dsRNA targeting Botrytis cinerea on the plant surface, the expression of its key genes BcRpd3, BcNat1, and BcArd1 was interfered with. The resulting fermentation broth was then used for spraying to control Botrytis cinerea.

Benefits of technology

This method enables low-cost, efficient, and stable synthesis of dsRNA on plant surfaces, improving the environmental stability and delivery efficiency of dsRNA, significantly inhibiting the growth and spore germination of Botrytis cinerea, and effectively controlling Botrytis cinerea disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121825762A_ABST
    Figure CN121825762A_ABST
Patent Text Reader

Abstract

The invention provides a dsRNA expression engineering strain constructed by using a yarrowia lipolytica MP181-2 strain as a chassis bacterium as well as a preparation method and application of the dsRNA expression engineering strain, and belongs to the technical field of crop disease prevention and control genes. The preservation number of the strain of the yarrowia lipolytica MP181-2 is CCTCC (China Center for Type Culture Collection) NO: M 20242701. The strain can be colonized on the surface of a plant leaf. The dsRNA is a double-stranded RNA fragment which is artificially designed by taking three key genes BcRpd3, BcNat1 and BcArd1 of botrytis cinerea as targets, and the dsRNA can simultaneously interfere with the expression of the three target genes, so that the infection of the botrytis cinerea is effectively inhibited. The engineering strain is a dsRNA expression engineering strain which is obtained by transferring a carrier containing a dsRNA expression framework into a yarrowia lipolytica MP181-2 strain and can be used for synthesizing a targeted target gene. Experiments prove that the engineering strain can effectively interfere the expression of a target gene, has a remarkable prevention and treatment effect on tomato gray mold, can be used for preparing biological agents for preventing and treating gray mold, and has a good market application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of disease control gene technology, specifically relating to a dsRNA expression engineered strain constructed using Yersinia lipophila MP181-2 strain as the substrate bacteria, its preparation method, and its application. Background Technology

[0002] RNA pesticides developed using RNA interference (RNAi) technology use dsRNA, which specifically targets key genes of pests, as their active ingredient. They possess advantages such as strong targeting, excellent efficacy, high environmental and ecological safety, and low likelihood of developing resistance, and are considered the "third revolution" in pesticide development history. Currently, there are two main approaches to the application of dsRNA in plant disease and pest control: one is to obtain transgenic plants expressing dsRNA through plant genetic transformation technology, using the dsRNA expressed by the host to interfere with the expression of target genes in pests—host-induced gene silencing (HIGS) technology; the other is to silence target genes by directly spraying dsRNA in vitro—spray-induced gene silencing (SIGS) technology. However, the lack of mature genetic transformation systems for some crops and the long transformation cycle greatly limit the promotion and application of HIGS technology; SIGS technology also suffers from problems such as poor environmental stability of dsRNA, low delivery efficiency to target organisms, and high costs of dsRNA synthesis and purification, thus limiting the commercialization of SIGS technology. Therefore, in order to effectively utilize dsRNA in the prevention and control of plant diseases and pests, it is necessary to find more effective application pathways for dsRNA.

[0003] Using non-pathogenic microorganisms colonizing the surface or interior of plants as substrate bacteria, engineered strains that efficiently express dsRNA (dsRNA) targeting harmful organisms are constructed. This allows for the efficient synthesis and delivery of dsRNA to plant pests, effectively solving problems such as high dsRNA synthesis costs, poor dsRNA stability, and short application intervals. This approach has significant research and application value in the development and field application of RNA pesticides. *Yarrowia lipolytica* (…) Yarrowia lipolyticaYersinia lipolytica is widely used in industrial production as an oil-producing yeast and is considered a non-pathogenic microorganism. In recent years, it has also been reported as a biocontrol agent for plant fungal diseases, capable of colonizing the epidermis of plant fruits. Yersinia lipolytica has a solid research foundation in biological characteristics and exhibits good safety to non-target organisms such as plants and the environment, making it a suitable chassis microorganism for constructing engineered strains. Furthermore, Yersinia lipolytica has advantages such as ease of cultivation, large-scale production, and low production costs, giving it broad application prospects in the biological control of plant diseases and pests. Summary of the Invention

[0004] This invention aims to solve the above-mentioned problems and provides a dsRNA expression engineered strain constructed using *Yarrowia lipolytica* strain MP181-2 as the substrate fungus, its preparation method, and its application. The dsRNA expression engineered strain utilizes *Yarrowia lipolytica* MP181-2 to express dsRNA targeting key genes of *Botrytis cinerea*. This engineered strain can effectively interfere with the expression of three key genes of *Botrytis cinerea* (BcRpd3, BcNat1, and BcArd1), thereby exhibiting a significant control effect on gray mold disease.

[0005] To achieve the above-mentioned objectives, the present invention is implemented through the following solution: This invention provides a *Yarrowia lipolyticis* strain MP181-2, which is classified as *Yarrowia lipolyticis*. Yarrowia lipolytica, It is deposited at the China Center for Type Culture Collection, with accession number CCTCCNO: M 20242701.

[0006] This invention provides a dsRNA that simultaneously interferes with the expression of three key genes in Botrytis cinerea, namely BcRpd3, BcNat1, and BcArd1 genes; the sequence of the dsRNA is shown in SEQ ID No. 6.

[0007] Furthermore, the nucleotide sequence of the gene BcANR corresponding to the dsRNA is shown in SEQ ID No. 2.

[0008] The present invention provides a dsRNA expression engineered strain Yl-dsANR constructed using the aforementioned Yersinia lipolytica MP181-2 strain as the substrate bacteria. The engineered strain Yl-dsANR is obtained by transferring the dsRNA expression framework BcANR-dsRNA into the aforementioned Yersinia lipolytica MP181-2 strain.

[0009] Furthermore, the expression framework BcANR-dsRNA consists of arm sequences with identical but opposite orientations at both ends and a central sequence that serves as a connector. The sequence of the expression framework BcANR-dsRNA is shown in SEQ ID No. 4, the arm sequences are shown in SEQ ID No. 2, and the central sequence is shown in SEQ ID No. 3.

[0010] This invention provides a method for preparing the dsRNA expression engineered strain Yl-dsANR, the method comprising the following steps: (1) Synthesize the expression framework BcANR-dsRNA for dsRNA, and link the expression framework BcANR-dsRNA to the multiple cloning site of a vector containing the constitutive promoter hp4d suitable for Yeast lipophila, and construct a plasmid containing the expression framework of dsRNA. (2) The plasmid containing the BcANR-dsRNA expression framework was linearized and transformed into competent cells of Yersinia lipophila MP181-2 by chemical transformation. Positive transformants were screened to obtain the dsRNA expression engineered strain Yl-dsANR.

[0011] The present invention also provides the application of the dsRNA or the dsRNA-expressing engineered strain Yl-dsANR in the prevention and control of gray mold.

[0012] Furthermore, the fermentation broth of the engineered strain Yl-dsANR can effectively inhibit the mycelial growth and spore germination of Botrytis cinerea.

[0013] Furthermore, the fermentation broth of the engineered strain Yl-dsANR can effectively prevent and control gray mold in tomatoes and gray mold in alfalfa.

[0014] Furthermore, the preparation method of the fermentation broth of the engineered strain Yl-dsANR is as follows: the engineered strain Yl-dsANR is inoculated into YPD liquid medium, shaken and cultured, and the culture product is the strain fermentation broth; when using, the fermentation broth is diluted with water to OD. 600 It is 0.5-0.8.

[0015] Furthermore, the application is that the fermentation broth of the engineered strain Yl-dsANR can effectively interfere with the expression of three key target genes in Botrytis cinerea: BcRpd3, BcNat1, and BcArd1.

[0016] Furthermore, in application, the fermentation broth of the engineered strain Yl-dsANR is evenly sprayed onto tomato leaves and alfalfa leaves.

[0017] Compared with existing technologies, this invention has the following advantages and beneficial technical effects: This invention utilizes the *Yarrowia lipolytica* strain MP181-2, which can colonize plant surfaces, as a chassis strain to express dsRNA of key target genes of pathogens. This allows for low-cost production of dsRNA and continuous release of dsRNA to exert its effect, improving the stability of dsRNA in the environment. The *Yarrowia lipolytica* engineered strain Yl-dsANR provided by this invention can effectively interfere with the expression of three key target genes in *Botrytis cinerea*, exhibiting high interference efficiency and good control effect. It can be used for the creation of novel biological pesticides for the control of *Botrytis cinerea*. The biocontrol engineered strain provided by this invention can be prepared into a fermentation broth for use; the preparation and application methods are simple and convenient, and it has good market application prospects. Attached Figure Description

[0018] Figure 1 This is a plate culture diagram of the Yersinia lipophila MP181-2 strain.

[0019] Figure 2 This is a microscopic image of the cells of the *Yarrowia lipophila* strain MP181-2.

[0020] Figure 3 This is a schematic diagram of the expression framework for dsRNA expression using engineered bacteria.

[0021] Figure 4 These are the PCR results of positive transformants of the engineered strain Yl-dsANR. The NL1+NL4 primers amplified the D1 / D2 region of the 28S rDNA, serving as an internal control for the strain.

[0022] Figure 5 The colony morphology and growth curve of the dsRNA-expressing engineered strain Yl-dsANR are shown.

[0023] Figure 6 The dsRNA expressed by the engineered strain was detected using quantitative real-time PCR. YlActin was used as an internal reference gene.

[0024] Figure 7 The fermentation broth of engineered strain Yl-dsANR inhibits the growth of Botrytis cinerea mycelia on agar plates.

[0025] Figure 8 The fermentation broth of the engineered strain Yl-dsANR inhibits the germination of conidia of Botrytis cinerea.

[0026] Figure 9 The study investigated the control effects of fermentation broth from the engineered strain Yl-dsANR on gray mold in tomatoes and gray mold in alfalfa.

[0027] Figure 10This study investigates the silencing effect of the fermentation broth of the engineered strain Yl-dsANR on the expression of three key target genes in Botrytis cinerea. Detailed Implementation

[0028] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods and will not be described in detail; unconventional experimental operations are detailed below. Unless otherwise specified, the experimental materials, reagents, instruments, etc., used in the following embodiments are all commercially available products. The quantitative statistics in the following embodiments are all based on three repeated experiments, and the average value is taken.

[0029] Example 1: Isolation and Identification of Yersinia lipophila MP181-2 strain 1. Isolation of Yersinia lipophila MP181-2 strain Greenhouse tomato leaves were collected and disinfected with 0.1% sodium hypochlorite for 3 min, 70% ethanol for 1 min, and rinsed three times with sterile water. The leaves were then chopped and inoculated into a yeast enrichment medium (1% yeast extract, 2% peptone, 2% glucose, 0.01% chloramphenicol) at 26℃ and 160 rpm for 48 h. The obtained yeast enrichment solution was diluted to 10 μL with sterile water. -6 Yeast extract was diluted and plated on standard YPD plates (1% yeast extract, 2% peptone, 2% glucose, 1.5-2% agar) to obtain single yeast colonies. These single colonies were then streaked onto new YPD plates to obtain new single clones, which were then purified. After three streak purifications, the obtained colonies showed consistent morphology, and one single colony was named strain MP181-2. A photograph of the plate culture of strain MP181-2 is shown below. Figure 1 As shown, the colony edges are wrinkled. Microscopic images are as follows. Figure 2 As shown, the cells are round or oval and have budding properties.

[0030] 2. Classification and identification of MP181-2 strain Molecular identification was performed using the molecular sequence characteristics of the D1 / D2 26S rDNA region. The D1 / D2 26S rDNA fragment of MP181-2 was amplified by conventional PCR using NL1: GCATATCAATAAGCGGAGGAAAAG and NL4: GGTCCGTGTTTCAAGACGG. The obtained PCR products were recovered by gel electrophoresis and sent to a sequencing company for sequencing. The D1 / D2 26S rDNA sequence of strain MP181-2 is as follows (SEQ ID No. 1): .

[0031] After comparison with the NCBI database, the MP181-2 strain to be tested was found to be similar to *Yersinia lipophila* (…). Yarrowia lipolytica The 26S rDNA sequences of multiple strains showed extremely high similarity. Among them, it was similar to *Yarrowia lipolytica* (…). Yarrowia lipolytica The similarity between strain P27 (GenBank: ON242298.1) and *Yersinia lipolyticis* was 99.62%; Yarrowia lipolytica The similarity of strain CFP00979 (GenBank: OM439636.1) was 99.43%, indicating that strain MP181-2 is *Yarrowia lipolyticis*. Yarrowia lipolytica ).

[0032] The lipophilic yeast (Yersinia lipophila) screened by this invention Yarrowia lipolytica The MP181-2 strain was deposited at the China Center for Type Culture Collection (CCCGC), Wuhan University, Wuhan, China, on December 3, 2024. Yarrowia lipolytica The accession number for MP181-2 is CCTCC NO: M 20242701.

[0033] Example 2: Preparation of Yl-dsANR, an engineered strain of Yersinia lipophila expressing dsRNA 1. Construction of plasmids containing dsRNA expression framework The dsRNA expression framework consists of arm sequences with identical sequences at both ends but opposite orientations and a central sequence serving as a connector. The arm sequences contain partial sequences of three key genes from *Botrytis cinerea*: BcRpd3, BcNat1, and BcArd1. Experimental validation showed that each gene sequence fragment exhibited optimal silencing efficiency for the target gene. The three fragments from these genes were further tandemly, and the resulting sequence was named BcANR (the arm sequence), as shown in SEQ ID No. 2. The central sequence is the first intron of the *Botrytis cinerea* endogenous gene BcTubB (Bcin02g01790), as shown in SEQ ID No. 3. The arm sequences (SEQ ID No. 2) were complementary, forward and reverse-directed, to both ends of the central sequence, constructing the expression framework for the target gene dsRNA, as shown in the specific structure below. Figure 3 As shown in SEQ ID No. 4, the sequence of the dsRNA expression framework for BcANR (BcANR-dsRNA) is complementary to sequence 2 (forward sequence - reverse sequence 3). The BcANR-dsRNA expression framework was ligated to the multiple cloning site (MCS) of the commercially available pINA1312 vector, which contains the constitutive promoter hp4d suitable for Yersinia lipophila. The pINA1312 vector contains the URA3 gene and can be used as a selection marker for transformants. The dsRNA expression framework for GFP was obtained in the same manner, and its sequence is shown in SEQ ID No. 5.

[0034] The nucleotide sequence of BcANR is shown in SEQ ID No. 2: CACACAGTTTGATTATGAATTATGGAGTCTACCAGAAAATGGAGATTTATCGAGCAAAACCAGCAACCCGACACGAAATGACCCAATTTCATACCGATGAATATATTGACTTTCTTCAGAGAGTCACTCCCGACAACATGGATTCTTTCGCTAAGGAACAAGGGAAGTACAACGTTGGAGATGATTGTCCTCTGCCAAATATCAACTTAGAAATGATGAAAACGAAAACGCCTTGAAGACTATGGGTATGTTTACAAGAGCTGAGACTGTGGGTGGGCCGCTAGCAGATCTTCATGATATGCAATGTGTCTGGTTTTTGACAGAGGACGGAGAGTCTTATGCTCGCCAAAACAAAATTGGCCTGGCTCTCAAGAGATTTACGGCAGTTTACAACATTTTTGATGTCTGGTATGAAGATCAGTTTGATTTCCATTCTTTCTTCTTACGTAAGGGTCGGATATTCCGCATGTTCAACATGCCAACATCACCAATCTCCCCGAAAACTATTTCATGAAATATTA。

[0035] The sequence of BcTubB-intron 1 is shown in SEQ ID No.3: GTAAATAAACAATTCAATTCTGACTTGAACAACGCACTACACTGCCTCCCTCACACACCAATTGCTTCACTACTTCCCTCGAGTAGCATATCTCGTCTCTGTCTACTGATTCAATGTATTCGCGTCGCAATGATATGATTGGTAATTGACAAAGCATTCATTATAG。

[0036] The complete sequence of the BcANR-dsRNA expression cassette is shown in SEQ ID No.4:

[0037] The sequence of the GFP-dsRNA expression framework is shown in SEQ ID No. 5:

[0038] The sequence of the generated BcANR-dsRNA is shown in SEQ ID No. 6: CACACAGUUUGAUUAUGAAUUAUGGAGUCUACCAGAAAAUGGAGAUUUAUCGAGCAAAACCAGCACCCGACACGAAAUGACCCAAUUUCAUACCGAUGAAUAUAUUGACUUUCUUCAGAGAGUCACUCC CGACAACAUGGAUUCUUUCGCUAAGGAACAAGGGAAGUACAACGUUGGAGAUGAUUGUCCUCUGCCAAAUAUCAACUUAGAAAUGAUGAAAACGAAAACGCCUUGAAGACUAUGGGUAUGUUUACAAGAGC UGAGACUGUGGGUGGGCCGCUAGCAGAUCUUCAUGAUAUGCAAUGUGUCUGGUUUUUGACAGAGGACGGAGAGUCUUAUGCUCGCCAAAACAAAAUUGGCCUGGCUCUCAAGAGAUUUACGGCAGUUUAC AACAUUUUGAUGUCUGGUAUGAAGAUCAGUUUGAUUUCCAUUCUUUCUUCUUACGUAAGGGUCGGAUAUUCCGCAUGUUCAACAUGCCAACAUCACCAAUCUCCCCGAAAACUAUUUCAUGAAAUAUUA.

[0039] 2. Transform the plasmid containing the dsRNA expression framework into the *Yarrowia lipophila* strain MP181-2. The successfully constructed plasmid containing GFP-dsRNA and BcANR-dsRNA expression frameworks was linearized and transformed into competent cells of Yersinia lipolytica MP181-2 strain via chemical transformation. The plasmid was then used in SD / Ura... - Positive transformants were screened using culture medium. The transformants were then validated for the target gene by PCR, with results as follows: Figure 4 As shown, bands of the same size as those on the plasmid were detected in different transformants, while no bands were detected in the wild-type MP181-2 strain, indicating that the dsRNA expression framework was successfully transferred into the chassis strain.

[0040] The chassis strains containing GFP-dsRNA and BcANR-dsRNA expression frameworks were named the engineered strains Yl-dsGFP and Yl-dsANR, respectively. The engineered strain Yl-dsGFP, which expresses GFP dsRNA, was used as a control.

[0041] Example 3: Detection of the activity and dsRNA expression of engineered strains 1. Analysis of the growth status of engineered strains The *Yersinia lipolytica* strain MP181-2 and the engineered strains Yl-dsGFP and Yl-dsANR were each plated with bacterial suspensions of the same concentration on YPD plates and incubated at 28°C for 3 days. The colony counts were observed and analyzed to determine the survival rate of each strain. The three strains were then inoculated into YPD liquid medium at the same concentration and cultured in a microbial growth curve analyzer with the following parameters: culture temperature 28°C, shaking frequency 250 rpm, and OD measured every 8 hours. 600 Value. Result as follows Figure 5 As shown, there was no significant difference in the colony count of the three strains on YPD plates, and the growth curves of the three strains showed basically the same trend. OD at each time point... 600 The values ​​showed no significant difference, indicating that the expression of dsRNA had no significant effect on the growth and development of Yeast lipolyticis.

[0042] 2. Detection of dsRNA expression in engineered strains Total RNA was extracted from the cells of *Yeastra lipolytica* strains MP181-2, Yl-dsGFP, and Yl-dsANR using Trizol reagent. The total RNA was reverse transcribed to obtain cDNA. Using the *Yeastra lipolytica* YlActin gene as the gene sample, dsRNA was detected by quantitative real-time PCR. The results are as follows: Figure 6 As shown, compared with the MP181-2 strain, the Cq values ​​of GFP amplification in the Yl-dsGFP strain and BcANR amplification in the Yl-dsANR strain were significantly reduced, indicating that the total RNA of the two engineered strains contained RNA of the target gene.

[0043] Example 4: Inhibitory effect of engineered strain Yl-dsANR on Botrytis cinerea Three *Yarrowia lipolyticis* strains, MP181-2, Yl-dsGFP, and Yl-dsANR, were inoculated into YPD liquid medium and cultured at 28°C and 180 rpm for 3 days with shaking. The OD600 value of the fermentation broth was measured using a spectrophotometer, and the broth was diluted with sterile water to an OD600 of approximately 1.2. The diluted fermentation broth was added to melted PDA medium at a final concentration of 50%, and plates containing the fermentation broth were prepared. *Botrytis cinerea* was inoculated onto different plates and incubated at 25°C for 3 days. The diameter of *Botrytis cinerea* colonies was observed and measured. The results are as follows: Figure 7As shown, compared with strains MP181-2 and Yl-dsGFP, the mycelial growth of *Botrytis cinerea* on plates supplemented with fermentation broth from strain Yl-dsANR was slow, and the colony diameter was significantly reduced. The fermentation broth prepared above was mixed with *Botrytis cinerea* conidia at a final concentration of 50%, added dropwise onto a glass slide, and incubated in a dark box with humidity for 4 hours. Spore germination was observed and statistically analyzed under a microscope. The results are as follows: Figure 8 As shown, compared with strains MP181-2 and Yl-dsGFP, the germination rate of *Botrytis cinerea* spores in the culture with added fermentation broth from strain Yl-dsANR was significantly reduced. These results indicate that the fermentation products of the engineered strain Yl-dsANR can effectively inhibit mycelial growth and conidial germination of *Botrytis cinerea*.

[0044] Example 5: Application of biocontrol engineered strain Yl-dsANR in the control of gray mold Tomato seedlings or alfalfa seedlings of uniform growth, aged 4-5 weeks, were selected and placed on moist filter paper. They were randomly divided into 3 groups, with 8-9 leaves in each group. Fermentation broths of three *Yersinia lipolytica* strains (MP181-2, Yl-dsGFP, and Yl-dsANR) were prepared according to the method described in Example 3. The broths were diluted with water to an OD600 of approximately 0.6 and sprayed evenly onto the leaves using a small spray bottle. One group of leaves was treated with each dsRNA. Conidia were collected from PDA plates containing *Botrytis cinerea*, counted, and diluted to a conidia concentration of 10-1. 6 After the liquid on the treated leaf surface has air-dried naturally, 4-6 μL of *Botrytis cinerea* spore solution is inoculated onto the leaves. The mixture is kept moist for 60-96 hours, and the infection status of *Botrytis cinerea* is observed. The diameter of the lesions is measured using the cross-hatching method, and the lesion area on the two groups of leaves is statistically analyzed. Leaves of the same size containing lesions are taken, and total DNA from the plant and *Botrytis cinerea* is extracted. Using the tomato Tubulin gene or the alfalfa Actin gene as internal reference genes, the content of the *Botrytis cinerea* gene BcActin in the samples is detected by real-time quantitative PCR to represent the biomass of *Botrytis cinerea* in the leaves. The primers used are shown below. Results are as follows: Figure 9 As shown, the lesions on tomato leaves or alfalfa leaves treated with fermentation broth of strain Yl-dsANR were significantly smaller than those on leaves treated with fermentation broth of strains MP181-2 and Yl-dsGFP, and the biomass of gray mold on the former lesions was significantly reduced.

[0045] Total RNA was extracted from *Botrytis cinerea* lesions, and cDNA was obtained by reverse transcription. Using the *Botrytis cinerea* gene *BcActin* as an internal control, the mRNA levels of the target genes were detected by quantitative real-time PCR. The fermentation broth of strain MP181-2 was used as a control. The simultaneous interference effects of fermentation broths of strains Yl-dsGFP and Yl-dsANR on three target genes (BcRpd3, BcNat1, and BcArd1) were analyzed. The primers used for quantitative real-time PCR are shown below, and the results are as follows. Figure 10 As shown in the figure. Compared with the control treatment, there was no significant difference in the mRNA levels of the three target genes after treatment with the fermentation broth of Yl-dsGFP strain. However, after treatment with the fermentation broth of Yl-dsANR strain, the mRNA levels of the three target genes decreased significantly, indicating that the fermentation broth of Yl-dsANR strain can effectively interfere with the expression of the three target genes simultaneously.

[0046] The primers used for real-time PCR are shown below, with primer sequences (5`→3`): Sltubulin-qF: GATTTGCCCACTAACCTCTCGT (SEQ ID No. 7); Sltubulin-qR:ACCTCCTTTGTGCTCATCTTACCC (SEQ ID No. 8); MsActin-qF1: CAAAAGATGGCAGATGCTGAGGAT (SEQ ID No. 9); MsActin-qR1: CATGCACCAGTATGACGAGGTCG (SEQ ID No. 10); Bcactin-qF: TGCTCCAGAAGCTTTGTTCCAA (SEQ ID No. 11); Bcactin-qR:TCGGAGATACCTGGGTACATAG (SEQ ID No. 12); BcRpd3-qF: TGAAGCCTCACAGAATAC (SEQ ID No. 13); BcRpd3-qR: CGAAGACAGGACAATCAT (SEQ ID No. 14); BcNat1-qF:GATCGTCACATCAATACCA (SEQ ID No. 15); BcNat1-qR: ACTGCCGTAAATCCTTG (SEQ ID No. 16); BcArd1-qF1:CAATCTCCCCGAAAACTATT (SEQ ID No. 17); BcArd1-qR1: TAACACTCAGACTGGTAATG (SEQ ID No. 18).

[0047] In summary, the engineered strain constructed by introducing a dsRNA expression cassette into the *Yarrowia lipophila* MP181-2 strain successfully expressed dsRNA and effectively interfered with the expression of target genes. The engineered strain Yl-dsANR, expressing dsRNA simultaneously targeting three key genes (BcRpd3, BcNat1, and BcArd1) of *Botrytis cinerea*, effectively inhibited the expression of all three target genes, thus exhibiting significant control effects against gray mold. This novel biocontrol engineered strain can be developed into a biological agent for the effective control of gray mold in various plants.

[0048] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A *Yarrowia lipophila* strain MP181-2, characterized in that, The MP181-2 strain was classified as *Yarrowia lipolyticis*. Yarrowia lipolytica, It is deposited at the China Center for Type Culture Collection, with accession number CCTCCNO: M 20242701.

2. A dsRNA that simultaneously interferes with the expression of three key genes in Botrytis cinerea, characterized in that, The three key genes of the Botrytis cinerea are BcRpd3, BcNat1, and BcArd1 genes; the sequence of the dsRNA is shown in SEQ ID No.

6.

3. The dsRNA according to claim 2, characterized in that, The nucleotide sequence of the gene BcANR corresponding to the dsRNA is shown in SEQ ID No.

2.

4. The dsRNA expression engineered strain Yl-dsANR constructed using the Yersinia lipolyticis MP181-2 strain as the substrate bacteria according to claim 1, characterized in that, The engineered strain Yl-dsANR was obtained by transferring the dsRNA expression framework BcANR-dsRNA into the above-mentioned Yersinia lipolytica MP181-2 strain.

5. The dsRNA expression engineered strain Yl-dsANR according to claim 4, characterized in that, The expression framework BcANR-dsRNA consists of arm sequences with identical but opposite orientations at both ends and a central sequence that serves as a connector. The sequence of the expression framework BcANR-dsRNA is shown in SEQ ID No. 4, the arm sequences are shown in SEQ ID No. 2, and the central sequence is shown in SEQ ID No.

3.

6. The method for preparing the dsRNA expression engineered strain Yl-dsANR according to claim 4, characterized in that, The preparation method includes the following steps: (1) Synthesize the expression framework BcANR-dsRNA for dsRNA, and link the expression framework BcANR-dsRNA to the multiple cloning site of a vector containing the constitutive promoter hp4d suitable for Yeast lipophila, and construct a plasmid containing the expression framework of dsRNA. (2) The plasmid containing the BcANR-dsRNA expression framework was linearized and transformed into competent cells of Yersinia lipophila MP181-2 by chemical transformation. Positive transformants were screened to obtain the dsRNA expression engineered strain Yl-dsANR.

7. The application of the dsRNA of claim 2 or the dsRNA-expressing engineered strain Yl-dsANR of claim 4 in the prevention and control of gray mold.

8. The application according to claim 7, characterized in that, The fermentation broth of the engineered strain Yl-dsANR can effectively inhibit the mycelial growth and spore germination of Botrytis cinerea.

9. The application according to claim 7, characterized in that, The fermentation broth of the engineered strain Yl-dsANR can effectively prevent and control gray mold in tomatoes and gray mold in alfalfa.

10. The application according to claim 9, characterized in that, The fermentation broth of the engineered strain Yl-dsANR is prepared as follows: The engineered strain Yl-dsANR is inoculated into YPD liquid medium and cultured with shaking. The culture product is the fermentation broth of the strain. Before use, the fermentation broth is diluted with water to OD0.

05. 600 It is 0.5-0.8.