Activity identification and application of apple tree valsa ceratosperma micro-like RNA (Ribonucleic Acid) coding peptide
By identifying and regulating the encoding peptides Vm-milPEP1-1 and Vm-milPEP2 of the apple tree rot pathogen, and controlling the expression of the pathogenic factor Vm-milR1, the problem of apple tree rot disease control has been solved, and the development of highly efficient and low-toxicity biological pesticides and novel antibacterial drugs has been achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-31
- Publication Date
- 2026-04-10
AI Technical Summary
Current technologies have failed to effectively identify and regulate the pathogenic mechanism of Cytospora mali, the causative agent of apple tree rot, and lack effective control measures.
By identifying and overexpressing the peptides Vm-milPEP1-1 and Vm-milPEP2 encoded by the primary transcript of Vm-milR1 in apple tree rot fungus, the expression level of the key pathogenic factor Vm-milR1 was regulated, reducing the pathogenicity of the fungus. These peptides were then synthesized and applied exogenously to further regulate the expression of the pathogenic factor.
It significantly reduces the pathogenicity of apple tree rot pathogens, provides a new control strategy, and lays the foundation for the development of highly efficient, low-toxicity, and residue-free biological pesticides and novel antibacterial drugs.
Smart Images
Figure CN121826016A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to the activity identification and application of two micro-like RNA-encoded peptides from apple tree rot fungi. Background Technology
[0002] Apple tree rot is caused by fungi of the genus *Black Rot* in the phylum Ascomycota. Cytospora mali (= Valsa mali , C. mali Caused by [unclear], this disease is a branch and trunk disease that mainly affects the trunk and large branches of apple trees, harming the quality and yield of the fruit. In severe cases, it can lead to the death of the fruit tree and is an important constraint on the healthy and sustainable development of the apple industry.
[0003] Micro-like RNAs (milRNAs) are an important class of non-coding sRNA molecules that participate in the growth, development, infection, and pathogenicity of pathogenic fungi at the post-transcriptional level by regulating the expression of target genes. MilRNAs of plant pathogenic fungi can not only regulate the expression of endogenous growth, development, and pathogenic genes, but also act as pathogenic factors to interfere with the expression of host resistance-related genes across species, thereby promoting pathogen infection and colonization. In recent years, a unique regulatory mechanism has been discovered where miRNA-encoded peptides (miPEPs) generated by functional short open reading frames hidden at the 5' end of the miRNA precursor pri-miRNA specifically target and increase the precursor transcription level of the corresponding miRNA, thereby regulating miRNA abundance. This mechanism was first discovered in 2015. miPEP171b in alfalfa and miPEP165a in Arabidopsis thaliana can increase the transcriptional level of their derived pri-miRNAs and enhance the accumulation of corresponding mature miRNAs. Simultaneously, external application of synthetic miPEP171b and miPEP165a peptides can specifically trigger the accumulation of miR171b and miR165a. This mechanism was subsequently validated in grapes, soybeans, rice, and tomatoes, indicating that it is relatively conserved in plant cells. Furthermore, when miPEP171d from grapes was exogenously applied to Arabidopsis thaliana seedlings, the expression of homologous miRNAs in Arabidopsis thaliana remained unchanged, indicating that this regulatory mechanism is unique to the original plant. miPEPs can be used exogenously as activators of their homologous miRNA expression, giving them significant application value. However, this regulatory mechanism has not yet been found in plant pathogenic fungi. Therefore, exploring the existence and regulatory mechanism of milPEPs in plant pathogenic fungi will help to further understand the pathogenic mechanism of pathogenic fungi, assess the application potential of such small peptides in diseases, and hopefully expand new control strategies. Summary of the Invention
[0004] To address the problems existing in the prior art, this invention provides the activity identification and application of two micro-like RNA-encoded peptides from apple tree rot pathogens.
[0005] This invention is achieved by identifying and applying the activity of two apple tree rot pathogen micro-like RNA-encoded peptides, including: Step 1, Apple tree rot pathogens Cytospora mali (= Valsa mali , C. mali The two encoding peptides Vm-milPEP1-1 and Vm-milPEP1-2 generated from the primary transcript of Vm-milR1 in the ) are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. Step 2: Overexpressing the encoded peptides Vm-milPEP1-1 and Vm-milPEP1-2 in the wild-type strain significantly reduces the pathogenicity of apple tree canker by regulating the expression level of the key pathogenic factor Vm-milR1. Simultaneously, the exogenous synthesis and application of the encoded peptides Vm-milPEP1-1 and Vm-milPEP1-2 also significantly reduces the pathogenicity of canker by regulating the expression level of the key pathogenic factor Vm-milR1. Step 3: Using GFP reporter gene and genetic transformation technology, the application potential of encoded peptides Vm-milPEP1-1 and Vm-milPEP1-2 in the control of apple tree canker was clarified, providing technical support for the development of new agents for the control of apple tree canker.
[0006] Furthermore, the amino acid sequence of the encoded peptide Vm-milPEP1-1 is shown in SEQ ID NO: 1; The amino acid sequence encoding peptide Vm-milPEP1-2 is shown in SEQ ID NO: 2.
[0007] Furthermore, the activity of the peptide Vm-milPEP1-1 encoded by the primary transcript of Vm-milR1 was identified, and the peptide Vm-milPEP1-1-GUS vector was constructed and transformed into apple tree rot pathogen; the nucleotide sequence encoding peptide Vm-milPEP1-1 is shown in SEQ ID NO: 3. Activity of the peptide Vm-milPEP1-2 encoded by the primary transcript of Vm-milR1 was identified. The vector encoding the peptide Vm-milPEP1-2-GUS was constructed and transformed into *Pseudomonas aeruginosa*. The nucleotide sequence encoding the peptide Vm-milPEP1-2 is shown in SEQ ID NO: 4.
[0008] Furthermore, the application of the peptide Vm-milPEP1-1 encoded by the primary transcript of Vm-milR1 in the prevention and control of apple tree canker involves overexpressing the peptide Vm-milPEP1-1 to reduce the pathogenicity of canker to apple branches by regulating the expression level of the key pathogenic factor Vm-milR1 of the canker pathogen; the nucleotide sequence encoding the peptide Vm-milPEP1-1 is shown in SEQ ID NO: 3.
[0009] Furthermore, the application of the peptide Vm-milPEP1-2 encoded by the primary transcript of Vm-milR1 in the prevention and control of apple tree canker involves overexpressing the peptide Vm-milPEP1-2 to reduce the pathogenicity of the canker pathogen to apple branches by regulating the expression level of the key pathogenic factor Vm-milR1. The nucleotide sequence encoding the peptide Vm-milPEP1-2 is shown in SEQ ID NO: 4. The application of the peptide Vm-milPEP1-1, encoded by the primary transcript of Vm-milR1, in the control of apple tree canker: the exogenous synthesis and application of the peptide Vm-milPEP1-1 reduces the pathogenicity of canker to apple branches by regulating the expression level of Vm-milR1, a key pathogenic factor of canker. The amino acid sequence of the peptide Vm-milPEP1-1 is shown in SEQ ID NO: 1. The application of the peptide Vm-milPEP1-2, encoded by the primary transcript of Vm-milR1, in the control of apple tree canker: the exogenous synthesis and application of the peptide Vm-milPEP1-2 reduces the pathogenicity of canker to apple branches by regulating the expression level of Vm-milR1, a key pathogenic factor of canker. The amino acid sequence of the peptide Vm-milPEP1-2 is shown in SEQ ID NO: 2.
[0010] Furthermore, the vector for identifying the activity of the encoded peptide is a PKNTG-GUS vector; The amplified full-length peptide nucleotide fragment was ligated into the target vector PKNTG-GUS by vector cloning to construct the PKNTG-Vm-milPEP1-1 / 2-GUS activity identification vector. The overexpression vector encoding the peptide is a pDL2 vector; The amplified full-length peptide nucleotide fragment was ligated into the target vector pDL2 via vector cloning to construct the pDL2-Vm-milPEP1-1 / 2 overexpression vector.
[0011] Another object of the present invention is to provide an activity identification system for micro-like RNA-encoded peptides of apple tree rot pathogens, comprising: Transcription module for apple tree rot pathogens Cytospora mali (= Valsa mali , C. mali The two encoding peptides Vm-milPEP1-1 and Vm-milPEP1-2 produced by the primary transcript of Vm-milR1 in the ) have amino acid sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2; The regulatory module is used to overexpress the encoded peptides Vm-milPEP1-1 and Vm-milPEP1-2 in wild-type strains, thereby significantly reducing the pathogenicity of apple tree rot fungus by regulating the expression level of the key pathogenic factor Vm-milR1. At the same time, the exogenous synthesis and application of the encoded peptides Vm-milPEP1-1 and Vm-milPEP1-2 also significantly reduces the pathogenicity of rot fungus by regulating the expression level of the key pathogenic factor Vm-milR1. The transformation module is used to clarify the application potential of encoded peptides Vm-milPEP1-1 and Vm-milPEP1-2 in the control of apple tree canker through GFP reporter gene and genetic transformation technology, and to provide technical support for the development of new agents for the control of apple tree canker.
[0012] Based on the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solution to be protected by this invention are as follows: (1) This invention reveals for the first time the encoding peptides of two key pathogenic milRNAs, Vm-milR1, which have a preventive effect against apple tree canker, namely Vm-milPEP1-1 and Vm-milPEP1-2. By overexpressing Vm-milPEP1-1 and Vm-milPEP1-2, the expression level of the key pathogenic factor Vm-milR1 of the canker pathogen can be regulated, thereby reducing the pathogenicity of the canker pathogen to apples. In view of this, this invention clarifies the application potential of Vm-milPEP1-1 and Vm-milPEP1-2 in the prevention and control of apple tree canker through stable overexpression technology.
[0013] (2) This experiment is the first to synthesize peptides encoding two key pathogenic milRNAs, Vm-milR1, which have a preventive effect against apple tree canker, namely Vm-milPEP1-1 and Vm-milPEP1-2. By synthesizing and applying Vm-milPEP1-1 and Vm-milPEP1-2 exogenously, the expression level of the key pathogenic factor Vm-milR1 of the canker pathogen can be regulated, thereby reducing the pathogenicity of the canker pathogen to apples. This invention provides a new solution for the prevention and control of apple tree canker at the molecular level and can provide technical support for the creation of novel small peptide agents.
[0014] (3) This experiment provides a method for identifying the activity of peptides encoded by pathogenic fungi. The core of this method is to use the expression of the GUS reporter gene to identify the activity of the target nucleic acid sequence ATG, which provides new insights and ideas for the activity identification of peptides encoded by pathogenic fungi.
[0015] This invention provides a novel encoded peptide with a unique mechanism of action, possessing significant and diversified commercial value and expected benefits. This encoded peptide can be used in green agricultural biopesticides: in agricultural production, the small peptide of this invention can be developed into a highly efficient, low-toxicity, and residue-free biopesticide for controlling diseases caused by decay pathogens. This aligns with the global trend towards safe and sustainable agricultural products, and has enormous agricultural application market and environmental benefits.
[0016] At the same time, the encoded peptide can also be used as a lead compound for novel antibacterial drugs: the small peptide can serve as a core backbone to develop into a completely new class of antibacterial drugs.
[0017] For a long time, strategies for controlling putrefactive bacteria have largely focused on traditional antibiotic targets or known virulence factors. However, there is a significant gap in research on the coding peptides in the genomes of putrefactive bacteria that have regulatory or pathogenic functions. This invention is the first to discover and demonstrate that a peptide encoded by Vm-milR1 in this pathogen plays a crucial role in prevention and control, and that the putrefactive bacteria can be effectively controlled by exogenously applying its synthetic peptide. This discovery fills a gap in our understanding of the pathogenic mechanism of putrefactive bacteria and opens up a new technical pathway for controlling putrefactive bacteria by targeting known pathogenic milRNAs.
[0018] Therefore, this invention fills a technological gap in the industry both domestically and internationally, both at the level of basic research and applied technology. Attached Figure Description
[0019] Figure 1 A flowchart of the method for identifying the activity of micro-like RNA-encoded peptides of apple tree rot pathogens provided in this embodiment of the invention.
[0020] Figure 2 A structural block diagram of the activity identification system for micro-like RNA-encoded peptides of apple tree rot pathogens provided in this embodiment of the invention.
[0021] Figure 3 The gel electrophoresis result of 5'RLM-RACE of apple tree rot pathogen Vm-milR1 provided in this embodiment of the invention.
[0022] Figure 4 This is a bioinformatics analysis diagram of the peptides Vm-milPEP1-1 and Vm-milPEP1-2 encoded by the micro-like RNA of the apple tree rot pathogen provided in this embodiment of the invention.
[0023] Figure 5 The activity identification diagram of the peptides Vm-milPEP1-1 and Vm-milPEP1-2 encoded by the micro-like RNA of the apple tree rot pathogen provided in this embodiment of the invention.
[0024] Figure 6 The diagram shows the results of identifying the pathogenicity of overexpressing strains of the apple tree rot pathogen, specifically the overexpressing peptides Vm-milPEP1-1 and Vm-milPEP1-2, and their effect on the expression level of Vm-milR1.
[0025] Figure 7 The figure shows the results of identifying the pathogenicity of exogenous application of the synthetic peptides Vm-milPEP1-1 and Vm-milPEP1-2 encoded by the micro-like RNA of the apple tree rot pathogen provided in this embodiment of the invention, as well as their effect on the expression level of Vm-milR1. Detailed Implementation
[0026] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0027] like Figure 1 As shown in the embodiments of the present invention, a method for identifying the activity of micro-like RNA-encoded peptides of apple tree rot pathogens includes the following steps: S101, Apple tree rot pathogen Cytospora mali (= Valsa mali , C. mali The two encoding peptides Vm-milPEP1-1 and Vm-milPEP1-2 generated from the primary transcript of Vm-milR1 in the ) are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. S102, using GUS reporter gene and genetic transformation technology, expressed the encoded peptides Vm-milPEP1-1 and Vm-milPEP1-2 in wild-type strains, and confirmed by GUS staining that the encoded peptides Vm-milPEP1-1 and Vm-milPEP1-2 have encoding expression activity.
[0028] S103, through GFP reporter gene and genetic transformation technology, overexpressed the encoded peptides Vm-milPEP1-1 and Vm-milPEP1-2 in wild-type strains. By regulating the expression level of Vm-milR1, a key pathogenic factor of apple tree canker, the pathogenicity of apple tree canker was significantly reduced, thus clarifying the application potential of the encoded peptides Vm-milPEP1-1 and Vm-milPEP1-2 in the control of apple tree canker. S104, through the exogenous synthesis and application of the encoded peptides Vm-milPEP1-1 and Vm-milPEP1-2, also significantly reduced the pathogenicity of the canker pathogen by regulating the expression level of Vm-milR1, a key pathogenic factor of the canker pathogen, thus providing technical support for the development of new agents for the prevention and control of apple tree canker.
[0029] The amino acid sequence of the peptide Vm-milPEP1-1 provided in this embodiment of the invention is shown in SEQ ID NO: 1; The amino acid sequence encoding peptide Vm-milPEP1-2 is shown in SEQ ID NO: 2.
[0030] The activity of the peptide Vm-milPEP1-1 encoded by the primary transcript of Vm-milR1 provided in this embodiment of the invention was identified, and the peptide Vm-milPEP1-1-GUS vector was constructed and transformed into apple tree rot pathogen; the nucleotide sequence encoding peptide Vm-milPEP1-1 is shown in SEQ ID NO: 3; Activity of the peptide Vm-milPEP1-2 encoded by the primary transcript of Vm-milR1 was identified. The vector encoding the peptide Vm-milPEP1-2-GUS was constructed and transformed into *Pseudomonas aeruginosa*. The nucleotide sequence encoding the peptide Vm-milPEP1-2 is shown in SEQ ID NO: 4.
[0031] The application of the peptide Vm-milPEP1-1, which encodes the primary transcript of Vm-milR1, in the prevention and control of apple tree canker is described in this embodiment of the invention. Overexpression of the peptide Vm-milPEP1-1 reduces the pathogenicity of the canker pathogen on apple branches by regulating the expression level of Vm-milR1, a key pathogenic factor of the canker pathogen. The nucleotide sequence encoding the peptide Vm-milPEP1-1 is shown in SEQ ID NO: 3.
[0032] The application of the peptide Vm-milPEP1-2, which encodes the primary transcript of Vm-milR1, in the prevention and control of apple tree canker is described in this embodiment. Overexpression of the peptide Vm-milPEP1-2 reduces the pathogenicity of the canker pathogen on apple branches by regulating the expression level of Vm-milR1, a key pathogenic factor of the canker pathogen. The nucleotide sequence encoding the peptide Vm-milPEP1-2 is shown in SEQ ID NO: 4. The application of the peptide Vm-milPEP1-1, encoded by the primary transcript of Vm-milR1, in the control of apple tree canker: the exogenous synthesis and application of the peptide Vm-milPEP1-1 reduces the pathogenicity of canker to apple branches by regulating the expression level of Vm-milR1, a key pathogenic factor of canker. The amino acid sequence of the peptide Vm-milPEP1-1 is shown in SEQ ID NO: 1. The application of the peptide Vm-milPEP1-2, encoded by the primary transcript of Vm-milR1, in the control of apple tree canker: the exogenous synthesis and application of the peptide Vm-milPEP1-2 reduces the pathogenicity of canker to apple branches by regulating the expression level of Vm-milR1, a key pathogenic factor of canker. The amino acid sequence of the peptide Vm-milPEP1-2 is shown in SEQ ID NO: 2.
[0033] The peptide activity identification vector provided in this embodiment of the invention is a PKNTG-GUS vector; The amplified full-length peptide nucleotide fragment was ligated into the target vector PKNTG-GUS by vector cloning to construct the PKNTG-Vm-milPEP1-1 / 2-GUS activity identification vector. The overexpression vector encoding the peptide is a pDL2 vector; The amplified full-length peptide nucleotide fragment was ligated into the target vector pDL2 via vector cloning to construct the pDL2-Vm-milPEP1-1 / 2 overexpression vector.
[0034] like Figure 2 As shown in the embodiment of the present invention, an activity identification system for micro-like RNA-encoded peptides of apple tree rot pathogens includes: Expression module for apple tree rot pathogens Cytospora mali (= Valsa mali , C. mali The two encoding peptides Vm-milPEP1-1 and Vm-milPEP1-2 produced by the primary transcript of Vm-milR1 in the ) have amino acid sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2; The transformation module is used to determine the application potential of the encoded peptides Vm-milPEP1-1 and Vm-milPEP1-2 in the control of apple tree canker through GFP reporter gene and genetic transformation technology.
[0035] The regulatory module is used to overexpress the encoded peptides Vm-milPEP1-1 and Vm-milPEP1-2 in wild-type strains, thereby significantly reducing the pathogenicity of apple tree rot fungus by regulating the expression level of Vm-milR1, a key pathogenic factor of rot fungus.
[0036] The application module, used for the exogenous synthesis and application of the encoded peptides Vm-milPEP1-1 and Vm-milPEP1-2, also significantly reduces the pathogenicity of the canker pathogen by regulating the expression level of the key pathogenic factor Vm-milR1, providing technical support for the development of new agents for the prevention and control of apple tree canker.
[0037] Example 1:
[0038] This embodiment provides the screening, nucleotide sequence and bioinformatics analysis of the encoded peptides Vm-milPEP1-1 and Vm-milPEP1-2 of the apple tree rot pathogen Vm-milR1.
[0039] 1. Screening of the peptides Vm-milPEP1-1 and Vm-milPEP1-2 encoded by the micro-like RNA of apple tree rot pathogen. Using apple tree canker pathogens in the vegetative growth stage and inoculated branches in the infection stage as test materials, quantitative experiments were conducted to screen out the significant differences in the expression levels of pri-Vm-milR1 and pre-Vm-milR1, proving that the Vm-milR1 encoded peptide may exist in apple tree canker pathogens.
[0040] 2. The 5' pri-Vm-milR1 nucleotide sequence of the apple tree rot pathogen Vm-milR1 The fungus causing apple tree rot was extracted using an RNA kit (Beijing Huayueyang Biotechnology Co., Ltd., catalog number 0416-50). Valsa mali RNA; cNDA was obtained using the RLM-RACE kit (Invitrogen, FirstChoice® RLM-RACE Kit, catalog number AM1700). C. mali The mature Vm-milR1 genome sequence was obtained, and R1 outter / inner primers and R1-specific RT primers were designed using PrimerPremier 5 software. The designed primers are as follows: R1 outter: GTAATGCTTATCTGTTGATGCTGGCTG R1 inner: GCAAGCCGCAATATCACTGACCATG R1-specific RT primers: GAGTGGATTGGGCGATAATAGAGGTAA Using cDNA treated with the kit as a template, nested PCR amplification was performed using P505 high-fidelity enzyme purchased from Novizan Biosciences. The nested PCR reaction system for the first step is as follows: reagents volume 2xPhanta Max Buffer 25 μl dNTP Mix (10 mM) 1 μl P505 High-Fidelity Enzyme 1 μl 5' RACE Outter Primer (10 μM) 2 μl R1 outter (10 μM) 2 μl cDNA template 2 μl <![CDATA[ddH2O]]> Up to 50 μl The reaction procedure is as follows:
[0041] The nested PCR reaction system for the second step is as follows: reagents volume 2xPhanta Max Buffer 25 μl dNTP Mix (10 mM) 1 μl P505 High-Fidelity Enzyme 1 μl 5' RACE inner Primer (10 μM) 2 μl R1 inner (10 μM) 2 μl The product from the first step is diluted 10 times. 2 μl <![CDATA[ddH2O]]> Up to 50 μl The reaction procedure is as follows:
[0042] The agarose gel electrophoresis results of the amplification products are shown in the figure. Figure 3 .like Figure 3 As shown, the nucleotide sequence of the upstream 5'pri-Vm-milR1 of the apple tree rot pathogen Vm-milR1 after sequencing is approximately 2000 bp.
[0043] 3. Analysis of upstream potential encoded peptides of Vm-milR1 The full-length cDNA sequence of Vm-milR1 (5'pri-Vm-milR1) was obtained by PCR gel electrophoresis, and was 2241 bp. Further bioinformatics analysis of the upstream 1000 bp of the mature Vm-milR1 revealed five potential sORFs upstream of Vm-milR1, as illustrated in the diagram below. Figure 4 .
[0044] Example 2:
[0045] This embodiment provides the activity identification of potential sORFs 1 and 2 present upstream of the apple tree rot pathogen Vm-milR1.
[0046] Construction of activity identification vectors for potential sORFs 1.1 and 2 Based on the function of the PKNTG-GUS vector, the target fragment is inserted after the RP27 promoter. The vector carries a built-in GUS tag, which satisfies the function of identifying the ATG activity of sORFs. Based on the selectable restriction enzyme sites (EcoRI and Hind III) of the PKNTG-GUS vector, two homologous arm primers for sORFs were designed using Snap Gene software.
[0047] PKNTG-GUS-1-F: AACCCAATCTTCAAAGAATTCATGTCCTTTTCTTCTTCTTCTTCTCC PKNTG-GUS-1-R: TTCTACAGGACGTAAAAGCTTAGAAACGGGAATTGACATATTAAGAC PKNTG-GUS-2-F: AACCCAATCTTCAAAGAATTCATGAGCATAATCTTAAAATTTTGTCACA PKNTG-GUS-2-R: TTCTACAGGACGTAAAAGCTTCACATATGAGCCTTCACTGCCG The target gene fragment was amplified, purified, and its concentration was determined. Simultaneously, the empty vector of *E. coli* in the PKNTG-GUS vector was activated, cultured, and the plasmid was extracted and its concentration determined. Double enzyme digestion was then performed (digestion at 37℃ for 1 h, followed by enzyme inactivation at 85℃ for 10 min). The reaction system is as follows: reagents volume PKNTG-GUS carrier 4 μg EcoR I 1 μl Hind III 1 μl 10×Green Buffer 5 μl <![CDATA[ddH2O]]> Up to 50 μl The amplified fragment was cloned into a PKNTG-GUS restriction vector digested with EcoRI and HindIII to construct the PKNTG-Vm-milPEP1-1 / 2-GUS expression vector. After transformation in E. coli, PCR detection and sequencing verification, the correct clone was used for subsequent experiments.
[0048] 2. Detection of the activity of sORFs 1 and 2 using the GUS reporter gene. Transfer the successfully constructed expression vector into C. mali In the protoplasts, successfully transformed mutants were screened using neomycin (NEO) resistant medium and activated and propagated for 2-3 generations in NEO resistant medium. A suitable amount of mycelial cake was taken from the cultured strain using a 5 mm punch, and GUS staining was performed using a GUS staining kit (Coollabo, catalog number SL7160). The staining results were observed and photographed after 24-48 hours.
[0049] Staining results as follows Figure 5 As shown, after GUS staining, the hyphae turned blue, proving that sORFs No. 1 and No. 2 have translational activity.
[0050] Example 3:
[0051] This embodiment provides the creation, pathogenicity, and regulation of Vm-milR1 expression levels of Vm-milPEP overexpression mutants 1 and 2 upstream of the apple tree rot pathogen Vm-milR1.
[0052] Construction of Vm-milPEP overexpression vectors 1.1 and 2 Based on the function of the pDL2 vector, the target fragment is inserted after the T7 promoter. The vector carries a built-in GFP tag, satisfying the function of overexpressing the target Vm-milPEP. Based on the selectable restriction enzyme site (Xol I) of the pDL2 vector, two homologous arm primers for Vm-milPEP were designed using SnapGene software.
[0053] pDL2-1-F: TCTCATCACCATCACCATCACATGTCCTTTTCTTCTTCTTCTTCTCC pDL2-1-R: TCGCCCTTGCTCACCCTCGAAGAAACGGGAATTGACATATTAAAGAC pDL2-2-F: TCTCATCACCATCACCATCACATGAGCATAATTCTAAAATTTTGTCACA pDL2-2-R: TCGCCCTTGCTCACCCTCGACACATATGAGCCTTCACTGCCG The target gene fragment was amplified, purified, and its concentration was determined. Simultaneously, the empty vector of *E. coli* was activated, and plasmids were extracted by shaking. The plasmid concentration was then determined, and single-enzyme digestion was performed (digestion at 37℃ for 1 h, followed by enzyme inactivation at 85℃ for 10 min). The reaction system is as follows: reagents volume pDL2 vector 4 μg Xol I 1 μl 10×Green Buffer 5 μl <![CDATA[ddH2O]]> Up to 50 μl The amplified fragment was cloned into a PKNTG-GUS digested vector with EcoRI and HindIII, and the pDL2-Vm-milPEP1-1 / 2 expression vector was constructed. After transformation in E. coli, PCR detection and sequencing verification, the correct clone was used for subsequent experiments.
[0054] 2. Protoplast transformation was used to overexpress Vm-milPEP strains 1 and 2 and to analyze their pathogenicity. Transfer the successfully constructed expression vector into C. mali In the protoplasts, mutants that were successfully transformed were screened using hygromycin (HYG) resistant medium and then activated and propagated for 2-3 generations in HYG resistant medium.
[0055] Take healthy one-year-old branches of Fuji apple trees, soak them in a 0.1% sodium hypochlorite solution for 15 minutes, then make holes using a sterilized hole punch (5 mm diameter), and inoculate with twice-activated [product / treatment]. C.mali The bacterial cakes containing the overexpression mutant were inoculated, and the disease symptoms were observed and photographed 3 days later. The length of the lesions was measured using ImageJ.
[0056] Pathogenicity results such as Figure 6 As shown, after inoculating apple branches with overexpression mutants of Vm-milPEP1-1 and Vm-milPEP1-2, the length of lesions was significantly reduced, indicating that Vm-milPEP1-1 and Vm-milPEP1-2 have a negative regulatory effect on the pathogenicity of rot pathogens.
[0057] 3.1 and 2 Vm-milPEP overexpression transformation strains' regulation of Vm-milR1 expression level One-year-old healthy branches of Fuji apples were soaked in 0.1% sodium hypochlorite solution for 15 min, and then holes were punched with a sterilized puncher (5 mm diameter). Transformed mycelium was inoculated and inoculated. Branch samples were scraped from the diseased and healthy tissue boundary 1 cm above and below the boundary 24 h after inoculation. miRNA was extracted using a miRNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd., catalog number DP504), and cDNA was obtained using a miRNA reverse transcription kit (Nanjing Novizan Biotechnology Co., Ltd., catalog number MR101-01). qRT-PCR quantitative analysis was performed to detect the expression level of Vm-milR1 after inoculation.
[0058] The results are as follows Figure 6 As shown, after inoculating apple branches with overexpression mutants of Vm-milPEP1-1 and Vm-milPEP1-2, the expression level of Vm-milR1 was significantly reduced, indicating that Vm-milPEP1-1 and Vm-milPEP1-2 can affect the pathogenicity of rot pathogens by regulating the expression level of Vm-milR1.
[0059] Example 4:
[0060] This embodiment provides an analysis of the pathogenicity of the apple tree rot pathogens Vm-milPEP1-1 and Vm-milPEP1-2 after synthesis and exogenous application, as well as the regulation of Vm-milR1 expression.
[0061] 1. Pathogenicity analysis of Vm-milPEP1-1 and Vm-milPEP1-2 after synthesis and exogenous application The company (Sangon Biotech (Shanghai) Co., Ltd.) synthesized peptides of Vm-milPEP1-1 and Vm-milPEP1-2 (purity ≥95%). A 5 μM solution of Vm-milPEP1-1 and a 1 μM solution of Vm-milPEP1-2 were prepared using sterile ddH2O. Healthy one-year-old branches of Fuji apple trees were soaked in a 0.1% sodium hypochlorite solution for 15 min, then holes were punched using a sterile puncher (5 mm diameter). The prepared peptide solution was dripped into the wounds, and the branches were inoculated with a second-stage activated peptide solution. C. mali Three days after inoculation, the symptoms were observed, photographs were taken, and the length of the lesions was measured using ImageJ.
[0062] Pathogenicity results such as Figure 7 As shown, apple branches were treated with peptide solutions of Vm-milPEP1-1 and Vm-milPEP1-2 before inoculation. C. mali The lesion length was significantly reduced, indicating that Vm-milPEP1-1 and Vm-milPEP1-2 have the effect of preventing and controlling apple tree rot disease and have strong application potential.
[0063] 2. Analysis of the regulatory effect of Vm-milR1 expression on Vm-milR1 by the synthesis and exogenous application of Vm-milPEP1-1 and Vm-milPEP1-2. One-year-old healthy branches of the Fuji apple variety were soaked in 0.1% sodium hypochlorite solution for 15 min, then holes were punched using a sterilized puncher (5 mm diameter), and a prepared polypeptide solution was dripped into the wound. The branches were then inoculated with *C. mali* that had undergone secondary activation. Three days after inoculation, branch samples were taken from the area 1 cm above and below the diseased / healthy junction. miRNA was extracted using a miRNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd., catalog number DP504), and cDNA was obtained using a miRNA reverse transcription kit (Nanjing Novizan Biotechnology Co., Ltd., catalog number MR101-01). qRT-PCR was used for quantitative analysis to detect the expression level of Vm-milR1 after inoculation.
[0064] The results are as follows Figure 7 As shown, apple branches were treated with peptide solutions of Vm-milPEP1-1 and Vm-milPEP1-2 before inoculation. C. mali The expression level of Vm-milR1 was significantly reduced, indicating that Vm-milPEP1-1 and Vm-milPEP1-2 can affect the pathogenicity of putrefactive bacteria by regulating the expression level of Vm-milR1.
[0065] sequence list College of Plant Protection, Northwest A&F University Identification and application of micro-like RNA-encoded peptides from apple tree rot pathogens SEQ ID NO: 1 Full-length amino acid sequence of Vm-milPEP1-1 Met Ser Phe Ser Ser Ser Ser Ser Ser Pro Arg His Val Leu Lys Arg Leu SerAsp Gln Gln Cys Thr Asp Phe Ser Leu Asn Met Ser Ile Pro Val Ser * SEQ ID NO: 2 Full-length amino acid sequence of Vm-milPEP1-2 Met Ser Ile Ile Leu Lys Phe Cys His Asn Ile Glu Ser Lys Cys Leu GlnVal Asp Trp Ser His His Arg Ile Val Met His Arg Gly Ser Glu Gly Ser Tyr Val * SEQ ID NO: 3 Full-length Vm-milPEP1-1 nucleotide sequence 1 ATGTCCTTTT CTTCTTCTTC TTCTCCTCGA CACGTGTTAA AGAGGCTGTC TGATCAACAG 61 TGCACAGACT TTAGTCTTAA TATGTCAATT CCCGTTTCTT GA SEQ ID NO: 4 Full-length Vm-milPEP1-2 nucleotide sequence 1 ATGAGCATAA TCTTAAAATT TTGTCACAAC ATTGAATCTA AATGTCTTCA GGTAGATTGG 61 AGTCATCATC GAATCGTCAT GCATCGCGGC AGTGAAGGCT CATATGTGTA G
[0066] Example 5:
[0067] This embodiment provides a procedure for identifying the activity of Vm-milPEP1-1. Firstly, it involves identifying the activity of apple tree rot pathogens... Cytospora maliTotal RNA was extracted, and the full-length nucleotide fragment encoding Vm-milPEP1-1 was amplified using reverse transcription PCR. The amplified fragment was then ligated into the GUS reporter gene expression framework to construct a recombinant identification vector. Subsequently, the vector was introduced into wild-type strains using protoplast transformation. Stable transformants were obtained on selection medium, and GUS staining was performed on the transformed bacteria to determine the expression status of the encoded peptide.
[0068] The results showed that the hyphae of the transformant expressing Vm-milPEP1-1 turned blue after GUS staining, confirming that Vm-milPEP1-1 has coding activity, thus supporting the identification method in the claims. Example 2 This embodiment focuses on the activity identification of Vm-milPEP1-2. The encoding nucleotide sequence of Vm-milPEP1-2 was obtained, amplified by PCR, and ligated into a recombinant vector containing a GUS reporter gene to construct the Vm-milPEP1-2-GUS identification vector. This vector was then introduced into the target cell using the same protoplast transformation system. Cytospora mali Wild-type strains were used to verify whether the encoded peptide was successfully expressed using the GUS colorimetric reaction.
[0069] The results showed that the hyphae expressing Vm-milPEP1-2 turned blue after GUS staining, confirming that Vm-milPEP1-2 has coding activity, thus supporting the identification method in the claims.
[0070] Example 6:
[0071] This example demonstrates the application support of SEQ ID NO:3. Following the Vm-milPEP1-1 encoding nucleotide sequence provided in SEQ ID NO:3, the complete fragment was amplified using synthetic primers and accurately inserted upstream of the fluorescent reporter gene using a double enzyme digestion and ligation strategy, forming a complete expression framework.
[0072] Similarly, the Vm-milPEP1-2-GFP vector was amplified and constructed according to SEQ ID NO:4. The results showed that both vectors could be stably overexpressed in the strain. The pathogenicity of the transformed strains after inoculation with apple branches was analyzed. The results showed that the pathogenicity of the transformed strains encoding both peptides was significantly lower than that of the wild type, indicating that the nucleotide sequences mentioned in the claims are operable, expressible, and have application potential.
[0073] Example 7:
[0074] This embodiment verifies the control effect of overexpression of the encoded peptides. The nucleotide sequences encoding Vm-milPEP1-1 and Vm-milPEP1-2 were cloned into the overexpression vector and introduced into the wild type via protoplast transformation. Cytospora mali The obtained overexpression strain was cultured on resistance medium. Two overexpressing strains were inoculated onto apple branches. Three days after inoculation, branch samples were taken from 1 cm above and below the boundary between diseased and healthy tissue. miRNA was extracted using a miRNA extraction kit, and cDNA was obtained using a miRNA reverse transcription kit. qRT-PCR quantification was performed to detect the expression level of Vm-milR1 during the infection stage. The results showed that, compared with the wild-type strain, inoculation with the overexpressing peptide-encoding transformant significantly reduced the expression level of Vm-milR1. This result demonstrates that overexpression of Vm-milPEP1-1 and Vm-milPEP1-2 can significantly reduce the expression level of Vm-milR1, supporting the application method of the claims.
[0075] Example 8:
[0076] This embodiment uses exogenous application of synthesized encoded peptides to verify the control effect. Purified forms of Vm-milPEP1-1 and Vm-milPEP1-2 peptides were synthesized according to SEQ ID NO:1 and SEQ ID NO:2, dissolved in buffer at a certain concentration, and applied to the surface of apple branches by foliar spraying. After drying, the branches were inoculated. Cytospora mali Wild-type strains, and maintain constant humidity and temperature conditions.
[0077] The results showed that, compared with branches without peptide application, the lesion expansion rate of branches treated with Vm-milPEP1-1 or Vm-milPEP1-2 was significantly reduced. Quantitative analysis of samples taken at the disease-health boundary revealed a decrease in Vm-milR1 expression, demonstrating that exogenous application of the encoded peptide can produce a regulatory effect, supporting the technical solution claimed.
[0078] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions, and improvements made by those skilled in the art within the scope of the technology disclosed in the present invention, and within the spirit and principles of the present invention, should be covered within the scope of protection of the present invention.
Claims
1. A method for identifying the activity of micro-like RNA-encoded peptides, characterized in that, include: Two encoding peptides, Vm-milPEP1-1 and Vm-milPEP1-2, generated from the primary transcript of Vm-milR1 in the apple tree rot pathogen were obtained. The amino acid sequence of Vm-milPEP1-1 is SEQ ID NO:1, and the amino acid sequence of Vm-milPEP1-2 is SEQ ID NO:
2. Activity identification vectors containing nucleotide sequences encoded by Vm-milPEP1-1 or Vm-milPEP1-2 were constructed and transformed into wild-type strains. The activity of encoded peptides was identified by GUS reporter gene and the activity of encoded peptides was determined by GUS staining of mycelia.
2. The activity identification method as described in claim 1, characterized in that, The nucleotide sequence encoding Vm-milPEP1-1 is SEQ ID NO:3, and the nucleotide sequence encoding Vm-milPEP1-2 is SEQ ID NO:
4.
3. The activity identification method as described in claim 1, characterized in that, The activity identification vector is a recombinant vector containing the GUS reporter gene, and the coding nucleotide sequence of Vm-milPEP1-1 or Vm-milPEP1-2 is linked as a complete fragment into the expression frame of the vector.
4. The application of two micro-like RNA-encoded peptides in the prevention and control of apple tree canker, characterized in that, include: Overexpression of Vm-milPEP1-1 or Vm-milPEP1-2 in apple tree rot pathogen, or application of exogenously synthesized Vm-milPEP1-1 or Vm-milPEP1-2 to apple trees, can significantly reduce the pathogenicity to apple branches. The expression level of Vm-milR1 was regulated by the above-mentioned overexpression or exogenous application methods, thereby reducing the expression level of Vm-milR1. The inhibition of Vm-milR1 expression is used as the basis for the fact that the encoded peptides Vm-milPEP1-1 and Vm-milPEP1-2 can reduce the pathogenicity of pathogens, thereby achieving the effect of preventing and controlling apple tree rot disease.
5. The application method as described in claim 4, characterized in that, When overexpressing the encoded peptide, a recombinant expression vector containing the nucleotide sequence encoded by Vm-milPEP1-1 or Vm-milPEP1-2 is used to increase the expression level of the encoded peptide in the putrefactive bacteria.
6. The application method as described in claim 4, characterized in that, When the encoded peptide is applied exogenously, Vm-milPEP1-1 or Vm-milPEP1-2 is applied to the surface of apple tree branches by drip application, so that the encoded peptide enters the pathogen and exerts a regulatory effect on the expression of Vm-milR1.