Tobacco NtC4H1 gene and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a tobacco NtC4H1 gene and application. In the invention, the NtC4H1 gene is knocked out, so that the contents of phenolic acid substances such as chlorogenic acid and cryptochlorogenic acid and flavonoid substances such as violaxanthin and beta carotene in the tobacco are obviously increased, and the disease resistance is improved. And a new mechanism, a target gene and a research basis are provided for analyzing the NtC4H1 gene in regulation and control of synthesis of substances such as chlorogenic acid and flavonoids in plants.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biotechnology, in particular to a tobacco NtC4H1 gene and application thereof. BACKGROUND

[0002] Tobacco is an ideal "molecular factory" and model plant due to its short growth cycle, high biological yield and outstanding genetic transformation efficiency, and is widely used in the production of medicinal proteins, vaccines and industrial enzyme preparations. More importantly, the tobacco genome contains rich genetic resources for disease resistance (such as tobacco mosaic virus resistance, such as phenolic acid content), insect resistance (such as nicotine synthesis related) and cold and drought resistance. Systematic mining and functional analysis of these genes can not only promote the analysis of tobacco genome information, but also promote the improvement of tobacco itself to high resistance, high quality and special-purpose varieties. In addition, polyphenolic products are closely related to the quality of tobacco grades, flavor and safety. Therefore, it is particularly necessary to mine genes related to disease resistance, stress resistance, insect resistance and tobacco quality in tobacco. SUMMARY

[0003] Therefore, the present application aims to provide a tobacco NtC4H1 gene and application thereof.

[0004] The present application provides application of a tobacco NtC4H1 protein in regulating the content of phenolic acid, the content of flavonoids, the resistance of pathogenic bacteria and the content of chlorophyll in plants, wherein the amino acid sequence of the tobacco NtC4H1 protein is shown as SEQ ID NO: 2.

[0005] Further, in the application, the plants include Solanaceae plants, Poaceae plants, Leguminosae plants, Rosaceae plants and Cucurbitaceae plants.

[0006] The Poaceae plants include rice, wheat, corn and / or the like.

[0007] The Leguminosae plants include soybeans, peanuts and / or the like.

[0008] The Rosaceae plants include apples, peaches and / or pears.

[0009] The Cucurbitaceae plants include watermelons and / or cucumbers.

[0010] Further, the Solanaceae plants include tobacco, potatoes, tomatoes, eggplants, peppers, petunias, datura and / or blue winter nightshade.

[0011] In the application, the phenolic acid includes neochlorogenic acid, chlorogenic acid and / or cryptochlorogenic acid.

[0012] The pathogenic bacteria include tobacco cucumber mosaic virus, tobacco common mosaic virus, tobacco potato Y virus and / or Ralstonia solanacearum.

[0013] In the application, the regulation includes increasing and / or decreasing.

[0014] The application uses gene knockout means to study the function of the tobacco NtC4H1 gene, and the test results show that, compared with the wild type, the mutant strain CN11 with the NtC4H1 gene knocked out has a significantly increased content of flavonoids such as violaxanthin and beta carotene, a significantly increased content of phenolic acids such as neochlorogenic acid, chlorogenic acid and cryptochlorogenic acid, a significantly increased resistance to CMV, PVY and Ralstonia solanacearum, and an improved photosynthetic pigment and light conversion efficiency.

[0015] The application provides a product for regulating the content of phenolic acids, the content of flavonoids, the resistance to pathogenic bacteria and the content of chlorophyll in plants, which includes at least one of the following A) to D):

[0016] A), a gRNA targeting the coding gene of the tobacco NtC4H1 protein;

[0017] B), a recombinant vector containing the gRNA as shown in A);

[0018] C), a host cell transformed or transfected with the recombinant vector as shown in B);

[0019] D), a mixture obtained by culturing the host cell as shown in C).

[0020] Further, the nucleotide sequence of the gRNA is shown in SEQ ID NO: 3.

[0021] The backbone of the recombinant vector includes pORE-CRISPR / Cas9.

[0022] The application provides a kit including at least one of a DNA extraction reagent, dNTP, a DNA reverse transcription reagent, a culture medium, an antibiotic and / or a buffer and the product.

[0023] In the application, the knockout of the NtC4H1 gene leads to a significantly increased content of phenolic acids such as chlorogenic acid and cryptochlorogenic acid, and flavonoids such as violaxanthin and beta carotene in tobacco, and an increased disease resistance, which provides a new mechanism, target gene and research basis for analyzing the regulation of the NtC4H1 gene in the synthesis of phenolic acids and flavonoids in plants. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 Fig. 2 shows the mutation of the NtC4H1 gene in the positive transformation plant;

[0025] Figure 2 Field display of mutant CN11 (left) and wild type K326 (right);

[0026] Figure 3 Determination of carotenoid content in leaves of mutant and wild type seedlings;

[0027] Figure 4 Determination of carotenoid content in leaves of mutant and wild type after topping;

[0028] Figure 5 Determination of flavonoid content in leaves of mutant and wild type seedlings;

[0029] Figure 6 Determination of flavonoid content in leaves of mutant and wild type after topping;

[0030] Figure 7 Comparison of resistance to bacterial wilt between wild type tobacco and mutant plants. DETAILED DESCRIPTION

[0031] The present application provides tobacco NtC4H1 gene and application, those skilled in the art can learn from the content of this paper, and appropriate process parameters are realized. It is particularly pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are regarded as included in the present application. The method and application of the present application have been described by the preferred embodiment, and the relevant personnel can obviously change or appropriately change and combine the method and application of this paper without departing from the content, spirit and scope of the present application, to realize and apply the present application technology.

[0032] Chlorogenic acid (CA) is a phenolic acid generated by caffeic acid and quinic acid, which is a phenylpropanoid compound produced by the shikimic acid pathway in the process of aerobic respiration of plant body. As an important polyphenol compound in plant body, chlorogenic acid not only plays an important role in growth and development, disease and insect resistance, cold resistance and adversity tolerance, but also has various pharmacological functions, and is one of the main components of Chinese medicine with antibacterial, anti-inflammatory and detoxification effects.

[0033]

[0034] Amino acid sequence of NtC4H1: MDDLLEKTLIGLFFAIIVAIVVSKLRSKKFKLPPGPIPVPIFGNWLQVGDDLNHRNLTEYAKKFGDMFLLRMGQRNLVVVSSPELAKEVLHTQGVEFGSRTRNVVFDIFTGKGQDMVFTVYGEHWRKMRRIMTVPFFTNKVVQQYRRGWEDEVAHVVEDVKKNPESATNGIVLRKRLQLMMYNNMYRIMFDRRFESEDDPLFNKLKALNGERSRLAQSFEYNYGDFIPILRPFLRGYLKICKEVKQRRLQLFKDYFVDERKKLANTTKSMDNNALKCAIDHILEAEQKGEINEDNVLYIVENINVAAIETTLWSIEWGIAELVNHPEIQKKLRDEIDSVLGVGVQITEPELNKLPYLQAVIKETLRLRMAIPLLVPHMNLHDAKLAGYDIPAESKILVNAWWLANNPATWKKPEEFRPERFFEEEKHVEANGNDFRYLPFGVGRRSCPGIILALPILGITLGRLVQNFELLPPPGQSKLDTTEKGGQFSLHILKHSTIVMKPRSF (SEQ ID NO: 2);

[0035] The test materials used in the present application are all ordinary commercially available products, which can be purchased in the market. The present application is further described below in combination with examples:

[0036] Example 1 Construction of NtC4H1 gene knockout mutant-mutant CN11

[0037] The full-length sequence of tobacco NtC4H1 gene was obtained from the tobacco genome database of China, and specific target sites (gRNA sequence is tcttgctaagaatgggacagagg, SEQ ID NO: 3) were found according to the target sequence using the website http: / / www.multicrispr.net / index.html. The upstream and downstream primers synthesized by designing appropriate guide sequences were obtained by annealing reaction to obtain target site DNA double strands, which were further linked to the upper part of the enzyme-digested CRISPR / Cas9 vector, and the positive clones were identified by sequencing.

[0038] The constructed CRISPR / Cas9-NtC4H1 editing vector is transformed into Agrobacterium, and then the tobacco plant is transformed. The positive transformation plant is selected according to the selection marker, and the specific primers are designed on both sides of the target site for PCR amplification, and the mutation of NtC4H1 gene in the positive transformation plant is identified by sequencing. The sequencing shows that a base "C" is inserted into the target site segment of ntc4h1 Figure 1 ), and the single base insertion causes the change of the protein reading frame after the insertion site, the protein translation disorder and the loss of function.

[0039] The T1 generation is obtained by selfing the edited T0 material, and the plant without transgenic tag is screened in the T1 generation. The same primers are used for amplification and sequencing of the target site fragment to obtain the homozygous edited transgenic-free T1 generation plant, which is named CN11.

[0040] At the same time, the wild type K326 and the mutant CN11 (ntc4) are planted in Xichang field, and the plant phenotypes of the tobacco mutant are observed and recorded during the whole growth period, such as Figure 2 .

[0041] Example 2

[0042] The leaves of the mutant CN11 and the control are collected, and the content of the targeted pigment secondary metabolite is analyzed by high performance liquid chromatograph. The related experiments are briefly introduced as follows:

[0043] The mutant CN11 strain (ntc4h1 and ntc4h2) and the wild type control (K326) with consistent growth vigor in the greenhouse are selected, three single plants of each strain are selected to take the middle leaves, and a mixed sample with a total weight of 1.0 mg is formed. After the sample is freeze-dried, it is ground into powder, and the content of carotenoids and flavonoids is determined by high performance liquid chromatograph.

[0044] The carotenoid content determination is shown in Figure 3 and Figure 4 . Compared with the control K326, the content of violaxanthin and beta carotene in the mutant CN11 strain is significantly increased Figure 2 , and the results after flowering and topping show that the content of carotenoids in the mutant strain is slightly lower than that in the control strain Figure 3 . The flavonoid content determination results are shown in Figure 5 and Figure 6 . Compared with the control, the content of neochlorogenic acid, chlorogenic acid and cryptochlorogenic acid in the mutant material at the seedling stage is significantly increased Figure 5 . The flavonoid content determination results after topping show that the mutant material has little difference with the control Figure 6 .

[0045] Example 3

[0046] The tobacco common virus and bacteria were inoculated to test the disease resistance of the tobacco high chlorogenic acid mutant CN11.

[0047] The mutant CN11 (ntc4h1) and the wild type control (K326) were selected and planted. When the plants grew to four leaves and one heart, tobacco cucumber mosaic virus (CMV), tobacco common mosaic virus (TMV), and tobacco potato Y virus (PVY) were inoculated, respectively, the incidence was observed and counted. The results showed that compared with the control K326, the TMV resistance of the mutant had no obvious difference, but the resistance to CMV and PVY was significantly increased (Table 1).

[0048] Table 1. TMV, CMV, PVY resistance analysis

[0049]

[0050] In addition, the mutant CN11 single plant (ntc4h2) and the control wild type single plant (K326) with consistent growth were selected, and Y45 strain of bacterial wilt was inoculated. The plant disease was observed at 7D, 14D, and 21D after inoculation, and the disease index of each strain was counted. The plant state before and after inoculation of bacterial wilt is shown in Figure 7 , and the disease index is shown in Table 2. The inoculation results showed that the mutant CN11 had stronger resistance to bacterial wilt than the control.

[0051] Table 2. Bacterial wilt resistance analysis

[0052]

[0053] Example 4

[0054] To further understand the efficiency of the mutant CN11 in photosynthesis, the content of chlorophyll in the mutant and the wild type control was detected by fluorescence. By detecting the fluorescence emitted by chlorophyll molecules in the leaf under light, the photosynthetic efficiency of the mutant and the wild type was compared.

[0055] In the fluorescence determination, the ratio of variable fluorescence (Fv) to fixed fluorescence (Fo) (Fv / Fo) can represent the activity of photosystem II (PSII), and the ratio of Fv to maximum fluorescence (Fm) (Fv / Fm) can represent the maximum efficiency of PSII photochemistry. By comparing the chlorophyll content of the mutant CN11 and the control wild type (K326), it was found that the chlorophyll content of the mutant was higher than that of the wild type. Further analysis of the PSII activity (Fv / Fo) and the maximum light energy conversion efficiency of PSII (Fv / Fm) showed that the mutant material was slightly higher than the control, but the difference was not large (Table 3).

[0056] Table 3. Comparison of photosynthesis efficiency of mutant CN11 and wild type K326

[0057]

[0058] The above merely is the preferred embodiment of the present application, it should be pointed out that, for the ordinary skilled in the art, without departing from the principles of the present application, can also make several improvements and refinements, these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. Use of the tobacco NtC4H1 protein for regulating the content of phenolic acids, the content of flavonoids, the resistance to pathogenic bacteria and the content of chlorophyll in plants, characterized in that, The amino acid sequence of the tobacco NtC4H1 protein is shown as SEQ ID NO:

2.

2. Use according to claim 1, characterized in that, The plant includes a Solanaceae plant.

3. Use according to claim 2, characterized in that, The Solanaceae plant includes tobacco.

4. Use according to claim 1, characterized in that, The phenolic acid includes neochlorogenic acid, chlorogenic acid and / or cryptochlorogenic acid.

5. The use according to claim 1, characterized in that, The pathogenic bacteria include tobacco cucumber mosaic virus, tobacco common mosaic virus, tobacco potato Y virus and / or Ralstonia solanacearum.

6. Use according to claim 1, characterized in that, The regulation includes increasing and / or decreasing.

7. Products for regulating the content of phenolic acids, the content of flavonoids, the resistance to pathogenic bacteria and the content of chlorophyll in plants, characterized in that, At least one of the following A) to D) is included: A) a gRNA targeting a coding gene of the tobacco NtC4H1 protein; B) a recombinant vector containing the gRNA as shown in A); C) a host cell transformed or transfected with the recombinant vector as shown in B); D) a mixture obtained by culturing the host cell as shown in C).

8. The product of claim 6, wherein, The nucleotide sequence of the gRNA is shown as SEQ ID NO:

3.

9. The product of claim 7, wherein, The backbone of the recombinant vector includes pORE-CRISPR / Cas9.

10. A kit characterized in that, At least one of the following is included: a DNA extraction reagent, a dNTP, a DNA reverse transcription reagent, a culture medium, an antibiotic and / or a buffer, and the product of claim 7 or 8.

Images