Molecular marker for identifying Ziyan variety of Zingiber mairei and application of molecular marker

Abstract

The invention provides a molecular marker for identifying Ziyan Danhua ginger. The molecular marker comprises two specific DNA (deoxyribonucleic acid) sequences. The invention also provides a method for identifying zingiber zingiberensis by using the molecular marker, total DNA (deoxyribonucleic acid) of a sample is extracted, then high-throughput sequencing is performed, sequencing reads are compared to the molecular marker, and if the sequencing reads can completely cover the molecular marker and generate a consistent sequence which is completely the same as the sequence of the molecular marker, the zingiber zingiberensis is identified by using the molecular marker. And judging that the species of the to-be-detected sample is Ziyan Danhua ginger.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a molecular marker of Globba 'Zi Yan' and application thereof. BACKGROUND

[0002] Globba is a genus of Zingiberaceae perennial herb, the inflorescence of which is pendant and the small flowers are exquisite like dancing, and it has both leaf and flower ornamental value, and is an important horticultural material for landscape design, potted ornamental and fresh-cut flower application, and has broad application prospects in the flower industry. Globba 'Zi Yan' is a fine cultivar of Globba, which has bright bract color and unique flower type, and has outstanding ornamental value. It is also suitable for cultivation in many regions of southern China, and the market demand continues to rise, the planting scale is expanding year by year, and it has high economic value and horticultural application value. However, with the development of the industry, there is a phenomenon of mixed germplasm on the market, which seriously affects the interests of flower breeders and growers, and also restricts the development of Globba standardized industry, so it is urgent to develop accurate and stable Globba 'Zi Yan' identification technology to provide technical support for the development of the industry.

[0003] Globba germplasm identification has long been faced with multiple technical challenges. Globba is a cross-pollinated plant with a complex genetic background. Traditional morphological identification is a commonly used method for Globba species identification, which relies on plant type, leaf texture, bract color, flower morphology and other external indicators. It not only needs to wait for the plant to grow to the flowering stage (about 1-2 years) to complete effective identification, but also the above indicators are easily affected by environmental factors such as temperature, light, water and fertilizer, and the morphological characteristics of closely related species are subtle, with a high misjudgment rate, which cannot be used as a stable basis for species identification.

[0004] Existing molecular identification techniques also have obvious limitations in Globba 'Zi Yan' germplasm identification. PCR-based molecular markers (such as SSR, AFLP) are more accurate than traditional morphological methods, but it is extremely difficult to design primers for Globba. Globba has many repetitive sequences, and the genetic conservation regions of closely related species have little difference, which easily leads to non-specific amplification, high proportion of mixed bands, and unstable amplification efficiency of primers with too strong specificity, which is easily affected by DNA template degradation, plant polyphenols and other factors. At the same time, the PCR reaction system is highly sensitive to reaction conditions such as annealing temperature and Mg²⁺ concentration, and the detection results of different laboratories and operators have poor reproducibility, the verification pass rate between laboratories is low, and it is difficult to achieve standardized industrial application. Traditional DNA barcoding technology relies on universal chloroplast fragments such as rbcL and matK, and nuclear gene ITS for species identification. The sequences of these fragments are highly consistent among different species of Globba, and the nuclear gene ITS has heterogeneity in multiple copies, which cannot generate a unified consistent sequence, and may fail in Globba species identification.

[0005] In summary, the complex genetic background of the *Litsea* genus and the inherent limitations of existing identification technologies result in a lack of standardized and precise identification methods for *Litsea purpurea*. Developing an identification method for *Litsea purpurea* based on complete alignment of high-throughput sequencing reads with specific DNA barcodes, achieving accurate identification through consistent sequence matching, not only addresses the pain points of existing technologies in *Litsea purpurea* identification but also meets the urgent need of the floriculture industry for authenticating *Litsea purpurea*, possessing significant practical application value and technological innovation significance. Summary of the Invention

[0006] To overcome the aforementioned difficulties in existing identification techniques for *Globba 'Zi Yan'*, this invention employs next-generation sequencing to obtain two specific nucleotide fragments of *Globba 'Zi Yan'*. Comparative analysis with whole-genome databases verified that these two fragments do not exhibit high homology with the genomes of other species or varieties in the *Globba* genus, making them suitable as reference sequences (DNA barcodes) for the identification of *Globba 'Zi Yan'*. Furthermore, this invention utilizes these specific fragments to design a reliable and efficient identification method for *Globba 'Zi Yan'*, achieving accurate and standardized identification. The technical solution adopted in this invention is as follows:

[0007] On the one hand, the present invention provides a molecular marker for identifying or assisting in the identification of Ginger lilyturf, wherein the molecular marker is a DNA barcode and its nucleic acid sequence is shown as SEQ ID NO:1 and / or SEQ ID NO:2.

[0008] Preferably, the DNA barcode can be used alone or in combination with SEQ ID NO.1 or SEQ ID NO.2; when used in combination, the alignment criteria of the two sequences must be met simultaneously, which can significantly reduce the probability of false positives and improve the accuracy of the identification results.

[0009] On the other hand, the present invention provides the application of the above-mentioned DNA barcode in the identification or auxiliary identification of Ginger lily, specifically including but not limited to:

[0010] 1. Authenticity identification of *Ligustrum lucidum* seedlings: Used for early identification of *Ligustrum lucidum* seedlings, solving the problem of traditional morphological identification requiring waiting for the flowering period of the plant, enabling early screening and identification, and reducing the risk of sample contamination in the seedling industry;

[0011] 2. Purity testing of raw materials for the cultivation of *Ginger indicus*: Used for screening for contamination during the transplanting of *Ginger indicus* seedlings and the harvesting of cut flowers, ensuring the uniformity of raw materials for horticultural cultivation and flower processing;

[0012] 3. Traceability and identification of horticultural products of *Ligustrum lucidum*: Traceability can be performed on horticultural products such as potted plants and cut flowers of *Ligustrum lucidum* (even if the sample DNA is partially degraded), effectively eliminating the possibility of closely related species of the *Ligustrum* genus being impersonated as *Ligustrum lucidum*.

[0013] 4. Species distribution survey in the planting area of ​​*Hedysarum purpureum*: Rapidly detect the mixing ratio of *Hedysarum purpureum* in large-scale planting areas, providing accurate data support for the purification of *Hedysarum purpureum* and the construction of standardized plantations.

[0014] On the other hand, the present invention provides a first method for identifying or assisting in the identification of Ginger lilyturf, characterized by comprising the following steps:

[0015] 1) Collect tissue samples from the ginger vine (Zingiber officinale) to be tested;

[0016] 2) Extract total DNA from the sample to be tested;

[0017] 3) Perform high-throughput sequencing on the total DNA to obtain sequencing reads;

[0018] 4) Assemble the sequencing data and perform BLAST alignment of the assembled contigs with the aforementioned DNA barcodes;

[0019] 5) Align the contig that completely covers the aforementioned DNA barcode and has the highest sequence consistency with the DNA barcode. Based on the alignment results, determine whether the sample contains *Gynostemma pentaphyllum*. If the sequence consistency between the contigs and the target DNA barcode is 100% (no base mismatches, insertions, or deletions), the sample is determined to contain *Gynostemma pentaphyllum*. If there is only partial coverage or the sequence consistency is <100%, it is determined to be non-*Gynostemma pentaphyllum*.

[0020] Preferably, in step 4), software such as SPAdes, Velvet, and SOAPdenovo2 can be used to assemble the sequencing data, and in step 5), software such as MAFFT, MUSCLE, MEGA, and DNAMAN can be used to perform multiple sequence alignment.

[0021] On the other hand, the present invention provides a second method for identifying or assisting in the identification of Ginger lilyturf, characterized by comprising the following steps:

[0022] 1) Collect tissue samples from the ginger vine (Zingiber officinale) to be tested;

[0023] 2) Extract total DNA from the sample to be tested;

[0024] 3) Perform high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads;

[0025] 4) Use bioinformatics software to align the above sequencing reads to the DNA barcode described in this invention;

[0026] 5) Determine whether the sample contains *Gynostemma pentaphyllum* based on the coverage of sequencing reads on the DNA barcode; calculate the coverage of sequencing reads on the target DNA barcode and generate a consistency sequence using software; if the coverage is 100% and the consistency sequence is completely identical to SEQ ID NO:1 and / or SEQ ID NO:2 (without any base differences), then the sample is determined to contain *Gynostemma pentaphyllum*; if the coverage is <100% or the consistency sequence has base differences from SEQ ID NO:1 and / or SEQ ID NO:2, then the sample is determined not to contain *Gynostemma pentaphyllum*.

[0027] Furthermore, for a large number of samples (such as tissue or seedling samples of multiple Gynostemma pentaphyllum plants), a group screening strategy can be adopted to improve identification efficiency and reduce testing costs. Specifically: a) Divide the n samples to be tested into two groups, mix them separately to extract total DNA and sequence them; b) Detect whether each group contains Gynostemma pentaphyllum according to steps 4)-5) above, and locate the positive group; c) Repeat the dichotomy method for the positive group samples, mix and sequence and test until a single sample containing Gynostemma pentaphyllum is identified. This strategy is suitable for large-scale sample screening in nurseries and planting bases and can significantly reduce sequencing costs.

[0028] In one embodiment of the present invention, in step 3) of the above two identification methods, the high-throughput sequencing is second-generation sequencing or third-generation sequencing, preferably with a sequencing data depth of 10~15×.

[0029] In one embodiment of the present invention, step 4) can use any of the software Minimap2, Geneious, Bowtie, Tophat, or HISAT to compare the sequencing reads with the DNA barcode.

[0030] In one embodiment of the present invention, SEQ ID NO.1 or SEQ ID NO.2 can be used alone to identify Ginger spp., or SEQ ID NO.1 and SEQ ID NO.2 can be used together to identify it.

[0031] Preferably, in any of the foregoing schemes, the identification or auxiliary identification of Globba atrosanguinea means that Globba atrosanguinea can be identified from at least one or more of the following Globba species: Globba atrosanguinea, Globbaracemosa, Globba schomburgkii var. angustata, Globba marantina, Globbaschomburgkii, Globba 'Mermaid Princess', and Globba multiflora.

[0032] The beneficial effects of this invention are:

[0033] This invention is the first to obtain a specific DNA barcode molecular marker for *Ligustrum lucidum*, and designs a high-throughput sequencing identification method based on this molecular marker, effectively solving many problems in the identification of *Ligustrum lucidum* in existing technologies. Compared with existing technologies, it has the following core beneficial effects:

[0034] High specificity: The SEQ ID NO.1 and SEQ ID NO.2 discovered in this invention are specific nucleotide fragments exclusive to Ginger purpurea. After comparison and verification with whole genome database, it was found that the fragments have no high homology with the genomes of other species in the Ginger genus and closely related plants in the Zingiberaceae family, thus solving the technical problem that traditional markers cannot effectively distinguish Ginger purpurea from closely related species.

[0035] Wide applicability: Based on high-throughput sequencing, this invention can directly detect mixed samples (such as mixed seedlings, tissues, and processed products) without the need for individual plant isolation, making it suitable for industrial applications such as batch screening of seedlings and germplasm resource surveys.

[0036] Simple to operate: This invention does not require the design of specific PCR primers, avoiding the problems of strong primer dependence, sensitivity to reaction conditions and poor repeatability in traditional PCR technology. The detection process is highly standardized and facilitates stable reproducibility between different laboratories.

[0037] High accuracy: The molecular markers of this invention support two modes: single marker detection and dual marker joint verification. When dual markers are used together, the comparison and judgment conditions of two specific sequences must be met simultaneously, which can further reduce the false positive error of identification. The accuracy and reliability of the identification results are greatly improved, meeting the needs of precise identification and traceability of germplasm. Attached Figure Description

[0038] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0039] Fig. 1This is the alignment result of the molecular marker SEQ ID NO.1 of Gingeria purpurea in the NCBI nr / nt library.

[0040] Fig. 2 It is the sequence with the highest alignment consistency between the molecular marker SEQ ID NO.1 of Ginger purpurea and the nr / nt library in NCBI.

[0041] Fig. 3 This is the alignment result of the molecular marker SEQ ID NO.2 of Gingeria zebrina in the NCBI nr / nt library.

[0042] Fig. 4 This is the first group of samples containing *Ginger purpurea* covering the SEQ ID NO.1 sequence.

[0043] Fig. 5 This is the first group of samples containing *Ginger sibirica* covering the sequence of SEQ ID NO.2.

[0044] Fig. 6 This is the coverage result of the second group of samples containing *Ginger purpurea* on the SEQ ID NO.1 sequence.

[0045] Fig. 7 This is the coverage result of the second group of samples containing *Ginger purpurea* on the SEQ ID NO.2 sequence.

[0046] Fig. 8 This is the first group of samples that do not contain Ginger lily bulbs, and the result of the coverage of the SEQ ID NO.1 sequence.

[0047] Fig. 9 This is the first group of samples that do not contain Ginger lily bulbs, and the result of the coverage of the SEQ ID NO.2 sequence.

[0048] Fig. 10 This is the coverage result of the second group of samples that do not contain Ginger lily on the SEQ ID NO.1 sequence.

[0049] Fig. 11 This is the coverage result of the second group of samples that do not contain Ginger lily on the SEQ ID NO.2 sequence.

[0050] Fig. 12 This is the comparison result of the contig assembled from two groups of samples containing Ginger lily and SEQ ID NO.1.

[0051] Fig. 13 This is the comparison result of the contig assembled from two groups of samples containing Ginger spp. with SEQ ID NO.2. Detailed Implementation

[0052] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, specific experimental methods can be used in the following examples.

[0053] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0054] Example 1: Molecular markers of Ginger purpurea

[0055] This invention, through high-throughput sequencing assembly and comparative analysis, determined the standard detection sequence for molecular markers in *Ligustrum lucidum* var. *purpureus*. The specific sequence is as follows:

[0056] SEQ ID NO.1:

[0057] CCTGTACCGCGTTCGGTCTAGTCGATTTGTCTAGTCGGATTTTGATATCCCTCCTCCTAACGCCTCCGGTGCTATTGAACTTCTGCGCAGCTATTTCCTCCTCTGCGTAGCCTCCCGACGCGTACACTTCAGTATCAGGACGCTATTTCAGCAATAGTGTGTCAACTGGGGCGTTACGCCATTTACTCTTACTACTACCTCGGCATTGCGC CATTGACTCTTACCTCTGCTACTCCTCGGTCTCGCTATTTTCTATTAGCTCCCTATCGGTCGCTGCTTCTTTGGCCCTCTCCCTCAACGGTCGATCCCAGTCGTTCATTCTAATAAGGTCACTCTCTAAATTCTTTTCTTTCGTGAATTCACTCGTTGAGTCTTTTGAACTGGCATTAAAACTTCCCCGTCCAGTTCTCTGTCTTTCACG

[0058] SEQ ID NO.2:

[0059] TTCTTTCGTGAATTCACTCGTTGAGTCTTTTGAACTGGCATTAAAACTTCCCCGTCCAGTTCTCTGTCTTTCACGCATGAACTCCTTCGCACACTAAAAAGACTACCTGACGGTCGAGCCCAGCAAGAGTAGTGATTGAAAATCAGGGAAAAAACACAAAGC GAGCAAATAAAAAAAAAAAAATGACGATTCGAATTTAGTATATATTAGTGTATTTTTGAGCCAAATTTCGATAAAAAAGAAAAAAAAAACTAGGTTTCGAGTTTAGCGGGTAAGGTGTTAAGTCCAGGTCGAAAAAGAAAAAAACTAGGTTTCGAGTTTTTAAA

[0060] Example 2: Molecular markers and sequence alignment of *Ligustrum lucidum* with closely related species

[0061] To determine the species specificity of the molecular markers described in this invention, they were submitted to NCBI for online BLAST alignment. The nr / nt library was selected, with no species limitation, and the "More dissimilar sequences" parameter was chosen. Figs. 1-3 As shown, the molecular marker described in this invention was found to be closely related to Zingiber officinale in the NCBI nr / nt library. Fig. 1 The sequence SEQ ID NO.1 shows only one homologous sequence from Zingiberofficinale; however, the identity is only 93.62%, and the coverage of SEQ ID NO.1 is only 22%. Figs. 1-2 ). Fig. 3 The data shows that SEQ ID NO.2 has no highly homologous sequence in the NCBI database. This indicates that the molecular marker described in this invention has extremely high specificity.

[0062] Example 3: Further Validation of Molecular Marker Specificity

[0063] 1) Collect tissue samples from the ginger vine (Zingiber officinale) to be tested;

[0064] 2) Extract total DNA from the sample to be tested;

[0065] 3) Perform second-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads (sequencing depth greater than 10×).

[0066] 4) Use minimap2 to align the sequencing reads to SEQ ID NO.1 and SEQ ID NO.2, and count the number of aligned reads.

[0067] The alignment results of high-throughput sequencing reads from different species of the genus *Hedychium* with SEQ ID NO.1 and SEQ ID NO.2 are shown in the table below:

[0068]

[0069] It can be seen that the total number of sequencing reads in SEQ ID NO.1 and SEQ ID NO.2 of other samples is much lower than that in Ginger purpurea (by 1 to 2 orders of magnitude), indicating that SEQ ID NO.1 and SEQ ID NO.2 have extremely high specificity in the genome of Ginger purpurea.

[0070] Example 4: Identification Method of Ginger of the Purple-flowered Ginger (Part 1)

[0071] 1) Collect the tissue of *Gynostemma pentaphyllum* to be tested as the sample;

[0072] 2) Extract total DNA from the sample to be tested;

[0073] 3) Perform next-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads;

[0074] 4) Using the default parameters of Geneious software, align the above sequencing reads to the molecular markers described in Example 1;

[0075] 5) Determine whether the sample contains *Ligustrum lucidum* based on the coverage of sequencing reads on the molecular marker; if the molecular marker is completely covered and a consistent sequence completely identical to the molecular marker can be generated, it is determined that the species of the sample to be tested contains *Ligustrum lucidum*.

[0076] 6) If multiple sample sequencing reads are grouped and mixed in step 4), then step 6) is further included to further divide the samples containing Ginger lily of the valley into two groups, mix the sequencing reads separately, and repeat step 5) until Ginger lily of the valley ...

[0077] Test results as follows Figs. 4-11 As shown (red background bases represent A, green background bases represent T, yellow background bases represent G, and blue background bases represent C), where... Figs. 4-7 The sample contains Ginger purpurea. The figure shows that the sequencing reads completely cover the reference sequence (i.e., the molecular marker SEQ ID NO.1~2 described in this invention) and generate a consistent sequence that is exactly the same as the molecular marker sequence. Figs. 8-11The sample does not contain the purple-flowered ginger ( Figs. 8-11 (For illustrative purposes only, base symbols are not specifically shown.) The figure shows that the reads on the reference sequence are not fully covered, and a consistent sequence that is completely identical to the molecular marker sequence cannot be generated (the black horizontal line in the red box in the consistent sequence indicates that the site is a gap, the absence of lines in the red box indicates that no reads were aligned at the end of the sequence, and the colored sites in the red box are polymorphic base sites. The sequencing data includes a random mixture of second-generation sequencing reads from Globbaatrosanguinea, Globba racemosa, Globba schomburgkii var. angustata, Globbamarantina, Globba schomburgkii, Globba 'Mermaid Princess', Globba 'Zi Yan', and Globba multiflora). The above results indicate that the method of the present invention can accurately identify Ginger lily.

[0078] Example 5: Identification Method Two for Ginger of the Purple Dancing Flower

[0079] 1) Collect tissue samples from the ginger vine (Zingiber officinale) to be tested;

[0080] 2) Extract total DNA from the sample to be tested;

[0081] 3) Perform high-throughput sequencing on the total DNA to obtain sequencing reads;

[0082] 4) Assemble the sequencing data and perform BLAST alignment of the assembled contigs with the molecular markers described in Example 1;

[0083] 5) Perform multiple sequence alignment (using software such as MAFFT, MUSCLE, MEGA, DNAMAN, etc.) on the contigs that can completely cover the molecular marker described in SEQ ID NO.1 or SEQ ID NO.2 and have the highest sequence identity with the corresponding molecular marker. Determine whether the sample is Ginger lily or Ligusticum sinense based on the alignment results. If the contigs are identical to the molecular marker sequence, the sample to be tested is determined to be a Ginger lily or Ligusticum sinense sample.

[0084] Test results as follows Figs. 12-13 As shown (red text indicates A, green text indicates T, yellow text indicates G, and blue text indicates C), both groups of *Ginger sibirica* samples (S1 and S2) can generate contigs that are completely consistent with the molecular marker (DNA barcode) sequence. Other samples cannot assemble a consistent sequence (or are too short and dispersed across different contigs, making it impossible to define a homologous sequence), so they are not shown.

[0085] Based on the disclosure and teachings of the foregoing specification, those skilled in the art can make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and changes to the present invention should also fall within the protection scope of the claims of the present invention. Furthermore, although some specific terms are used in this specification, these terms are only for convenience of explanation and do not constitute any limitation on the present invention.

Claims

1. A molecular marker for identifying or assisting in the identification of Ginger lilyturf, characterized in that, The molecular marker is a DNA barcode, and the nucleotide sequence of the DNA barcode is shown in SEQ ID NO.1 and / or SEQ ID NO.

2.

2. A method for identifying or assisting in the identification of Ginger lilyturf, characterized in that... Includes the following steps: 1) Collect the plant tissue to be tested as the sample; 2) Extract total DNA from the sample to be tested; 3) Perform high-throughput sequencing on the total DNA to obtain sequencing reads; 4) Assemble the sequencing data and perform BLAST alignment of the assembled contigs with the molecular markers described in claim 1; 5) Perform sequence alignment between the contig that can completely cover the molecular marker of claim 1 and has the highest sequence consistency with the molecular marker and the molecular marker of claim 1, and determine whether the sample contains Ginger purpurea based on the alignment result; if it can completely match the sequence of the molecular marker of claim 1, it is determined that the sample to be tested contains Ginger purpurea sample.

3. A method for identifying or assisting in the identification of Ginger lilyturf, characterized in that... Includes the following steps: 1) Collect the plant tissue to be tested as the sample; 2) Extract total DNA from the sample to be tested; 3) Perform high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads; 4) Align the above sequencing reads to the molecular marker described in claim 1; 5) Determine whether the sample contains *Ligustrum lucidum* based on the coverage of sequencing reads on the molecular marker; if the molecular marker is completely covered and a consistent sequence identical to the molecular marker can be generated, it is determined that the species of the sample to be tested contains *Ligustrum lucidum*.

4. The method for identifying or assisting in the identification of Ginger lily as described in claim 3, characterized in that, In step 4), multiple sample sequencing reads are grouped and mixed. This further includes step 6), where samples containing Ginger lily are further divided into two groups, and sequencing reads are mixed separately. This process is repeated in step 5) until a single sample containing Ginger lily is identified.

5. The method for identifying or assisting in the identification of Ginger lily as described in any one of claims 2 to 4, characterized in that, The high-throughput sequencing mentioned in step 3) is either second-generation sequencing or third-generation sequencing.

6. The method for identifying or assisting in the identification of Ginger lily as described in any one of claims 3 to 4, characterized in that, Step 4) Use any one of the following software, Geneious, Minimap2, Bowtie, Tophat, or HISAT, to compare the reads.

7. The application of the molecular marker as a reference sequence in the identification or auxiliary identification of Ginger lilyturf.

Images