Preparation method and application of in-vivo CAR-T cell for treating interstitial lung disease

Abstract

The invention provides a preparation method and application of an in-vivo CAR-T cell for treating interstitial lung disease, and provides a T cell of a chimeric antigen receptor which is modified by genetic engineering and is used for expressing targeted fibroblast activating protein. A targeted fibroblast activation protein (FAP) CAR-T cell therapy model is constructed by targeting CD5 entrapped mRNA nano-liposome (LNP) transfection and lentiviral vector, and the method comprises the following steps: firstly, verifying the difference of the killing ability of FAP CAR-T constructed by CD5 LNP-mRNA and lentivirus in a 293T cell which stably co-expresses FAP, Luciferase and mCherry, and then verifying the difference of the killing ability of FAP CAR-T constructed by LNP-mRNA and lentivirus in the 293T cell which stably co-expresses FAP, Luciferase and mCherry; further verifying the effectiveness of the CAR-T cells constructed by transfecting the CD5 LNP-mRNA on cell lines of human fibroblasts (CDD19Lu, LL29 and LL97A) and primary fibroblasts of human and mice in vitro, and further verifying the effectiveness and safety of the CD5 LNP-FAP CAR-T in treatment of pulmonary fibrosis through in-vivo experiments in animals. A novel and effective anti-fibrosis treatment thought is provided for patients with fibrosis interstitial lung diseases.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to the application of in vivo CAR-T cells targeting FAP in the preparation of drugs for treating fibrotic interstitial lung disease. Background Technology

[0002] Interstitial lung disease (ILD) is a group of diffuse parenchymal infiltrative lung diseases with different etiologies. The lesions primarily occur in the lung interstitium between the alveolar epithelial basement membrane and capillaries, but can also involve the alveolar parenchyma, perialveolar tissues, and bronchioles. Fibrotic interstitial lung disease (fILD) is caused by abnormal repair of alveolar epithelial cells, leading to excessive secretion of extracellular matrix, which in turn causes irreversible damage to lung tissue structure and function, resulting in pulmonary fibrosis and impairing lung function.

[0003] (1) fILD is highly heterogeneous, difficult to treat, and existing treatment methods have significant limitations.

[0004] The overall prevalence of interstitial lung disease (ILD) is estimated to be 6.3–76.0 cases per 100,000 people. The incidence of ILD varies greatly across different ages, sexes, ethnicities, and geographic regions. ILD includes more than 200 different subtypes, including fILD, which includes idiopathic pulmonary fibrosis (IPF), connective tissue disease-associated interstitial lung disease (CTD-ILD), fibrotic hypersensitivity pneumonitis, unclassifiable interstitial lung disease, nonspecific interstitial pneumonia, rare sarcoidosis, organizing pneumonia, and occupationally exposed interstitial lung disease. Significant heterogeneity exists among the subtypes of fILD, encompassing different etiologies, pathologies, clinical manifestations, treatment methods, and prognoses. Different etiologies determine the treatment methods for fILD. However, numerous studies have confirmed that treatments with other mechanisms of action, such as pirfenidone and nintedanib, can only slow disease progression, not stop it, and certainly cannot reverse pulmonary fibrosis. Furthermore, their applicability to severely ill patients requires further investigation. Therefore, a new and more effective anti-fibrotic treatment is urgently needed.

[0005] (2) The expression level of fibroblast activating protein (FAP) is increased in patients with fILD.

[0006] Fibroblast activation protein (FAP) is a type II transmembrane serine protease. Its active form is a homodimer composed of 760 amino acids with a relative molecular mass of 170 kDa. It has dual proteolytic activities as a dipeptidyl peptidase and an endopeptidase, and participates in the pathological processes of various tumors and non-tumor diseases.

[0007] Pinak S. Acharya et al. found that FAP expression was upregulated in fibroblast lesions in the lungs of ILD patients, but almost not expressed in adjacent alveolar epithelium or normal lung tissue. Penghui Yang's team also found that FAP expression was significantly upregulated in the early stages of lung fibroblast activation. Single-cell sequencing confirmed that almost all FAP-positive cells in ILD were collagen-producing fibroblasts. Immunohistochemical analysis revealed that FAP expression levels were closely correlated with the abundance of fibroblast lesions in lung biopsy sections of ILD patients. Therefore, for fILD patients with pre-existing fibrosis, FAP may be a potential effective therapeutic target.

[0008] (3) CAR-T may have more advantages in the treatment of non-tumor diseases.

[0009] CAR-T cell therapy, or chimeric antigen receptor T-cell therapy, has been approved by the FDA for the treatment of leukemia and lymphoma. Currently, CAR-T is also approved for the treatment of hematologic malignancies. However, clinical research results for CAR-T in solid tumors have been less than satisfactory. The main reasons are the significant heterogeneity of solid tumors, the lack of specific epitopes, and the limitations imposed by the local heterogeneous tumor microenvironment and physical barriers on the migration and infiltration of CAR-T cells. In contrast, non-tumor diseases often have lower mutational burdens and genetic heterogeneity, resulting in more specific target tissue epitopes. Furthermore, the smaller number of target cells in non-tumor tissues avoids the cytotoxicity, cytokine release syndrome, and off-target toxicity associated with repeated, large-volume infusions. Moreover, most non-tumor tissues retain normal physiological structure and perfusion, allowing for greater immune cell infiltration, making CAR-T a more advantageous treatment option for non-tumor diseases.

[0010] (4) FAP is an effective target for CAR-T anti-tumor therapy, but there are currently no studies on CAR-T in benign fILD.

[0011] Existing research has confirmed that CAR-T therapy can target non-tumor cells, including those involved in pulmonary fibrosis. Professor Haig Aghajanian's team has demonstrated that FAP CAR-T can target and eliminate FAP-expressing cardiac fibroblasts in mice, reversing myocardial fibrosis damage. Currently, there are no studies on FAP CAR-T therapy for fILD. Unlike pirfenidone or nintedanib, which inhibit fibroblast proliferation and differentiation through the inhibition of related signaling pathways, FAP CAR-T can directly bind to FAP-expressing lung fibroblasts, killing abnormal fibroblasts with high FAP expression through cytotoxic effects, thereby achieving an anti-fibrotic effect, reversing pulmonary fibrosis, and restoring lung function. Therefore, this application aims to explore the efficacy and safety of FAP CAR-T therapy for fILD and its potential anti-fibrotic mechanism. Summary of the Invention

[0012] (a) Technical problems to be solved

[0013] Existing antifibrotic drugs such as pirfenidone and nintedanib can only delay the progression of fibrosis in interstitial lung disease, but cannot remodel or reverse pulmonary fibrosis after it has formed. This application studies the efficacy and safety of CD5 / LNP-FAP CAR-T therapy for pulmonary fibrosis, confirming the killing effect of CD5 / LNP-FAP CAR-T on FAP-highly expressed cell lines, and providing a method for constructing an in vivo CAR-T cell model targeting FAP. This can change the current treatment landscape for interstitial lung disease, reverse pulmonary fibrosis, improve the long-term survival and quality of life of patients with fibrotic interstitial lung disease, and further broaden the clinical application scope of CAR-T.

[0014] (II) Technical Solution

[0015] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0016] This invention provides the application of in vivo CAR-T cells targeting FAP in the preparation of drugs for treating fibrotic interstitial lung disease.

[0017] This invention also provides a method for constructing an in vivo CAR-T cell model targeting FAP, comprising the following steps:

[0018] S1, construct a CAR mRNA and plasmid targeting the FAP antigen, wherein the CAR mRNA is modified with N1-Methylpseudo-UTP;

[0019] S2, prepare CD5 mRNA-targeting nanoliposome particles CD5 LNP-mRNA or prepare CAR lentiviruses expressing FAP using a third-generation lentiviral packaging system;

[0020] S3. FAP CAR-T cell model was constructed by transducing human / mouse primary T cells with CD5 LNP-FAP CAR or prepared lentivirus.

[0021] Further, step S1 specifically involves: obtaining the single-stranded variable region scfv sequence targeting FAP, wherein the single-stranded variable region scfv sequence targeting FAP is owned by this research group, and its sequence is as follows:

[0022] ;

[0023] A human / mouse T cell gene expression vector was constructed. FAP-CAR mRNA was packaged into liposome nanoparticles (LNPs) using mRNA modification technology. The mRNA could be transiently expressed intracellularly, and FAP-CAR was expressed on the surface of T cells. Using the above plasmid sequence as a template, the complete sequence was cloned into an IVT plasmid carrying a T7 promoter, 5' and 3' UTR elements, and a 3' poly(A) tail. N1-Methylpseudo-UTP was used to replace the UTP, and 5'-cap and 3' poly(A) tail modifications were added. The mRNA was purified. Before use, the mRNA was encapsulated in LNPs using a self-assembly process. The RNA-loaded particles were characterized by dynamic light scattering using Zetasizer nanoparticles (Malvern Instruments, Malvern UK) and Ribogreen assays.

[0024] Further, the specific method for preparing the CD5-targeting mRNA nanoliposomes (CD5 LNP-mRNA) is as follows: mRNA lipid nanoparticles (from FluidicLab) are prepared using a microfluidic mixing method. LNP mRNA is functionalized with purified rat anti-mouse CD5 (clone 53-7.3, biolegend) or mouse anti-human CD5 (clone UCUCHT2, biolegend) and isotype IgG antibody (control group) by introducing a protected thiol group onto the primary amine using N-succinimide S-acetylsioacetate (SATA). SATA is deprotected using 0.5 M hydroxylamine, and unreacted components are removed by passing through a G-25 Sephadex rapid spinning protein column. Then, thioether binding chemistry is used to bind the reactive thiol group on the antibody to the maleimide moiety. Purification is performed using a Sepharose CL-4B gel filtration column. The mRNA content is calculated by modified Quant-iT RiboGreen RNA analysis, and the construction of the CD5-targeting LNP-mRNA is complete. The average hydrodynamic diameter of LNP mRNA is approximately 80 nm, the polydispersity index is 0.02-0.06, and the encapsulation efficiency is approximately 95%.

[0025] 293T cells were transfected with CD5 LNP-FAPCAR and CD5 LNP-GFP (blank control), and the transfection efficiency was assessed after 24 hours (by fluorescence microscopy and flow cytometry).

[0026] Furthermore, the method for preparing CAR lentiviruses expressing FAP targeting using a third-generation lentiviral packaging system is as follows: 293T cells were co-transfected with the target plasmid using VSVG, Deta8.9, and pAdV plasmids. Lentiviral supernatants were collected at 48 h and 72 h, and concentrated viral solution was obtained by ultracentrifugation. The virus was dissolved in 100 μL of serum-free DMEM, and 1 μL of virus was used to infect 5 × 10⁵ cells. 5 Viral titer is calculated for each Jurkat cell.

[0027] Furthermore, the method of transfecting human / mouse primary T cells with CD5 mRNA-LNP is as follows:

[0028] CD3+ cells were isolated from human peripheral blood mononuclear cells (PBMCs) using a human T-cell sorting kit. + T cells were cultured and sorted human T cells in TexMACS + 3% FBS + 50 IU / ml IL-2 + 1% P / S medium. T cells were activated and expanded by Dynabeads™ human T activator CD3 / CD28. After 48 hours, CD5 mRNA-LNP transfection or lentivirus transduction were performed.

[0029] CD3 cells were isolated from mouse spleens using a mouse T-cell sorting kit. + T cells were cultured in RPMI 1640 (10% FBS-1640 + 1×glutamine + 1×mercaptoethanol (0.01 mM) + 1×P / S + 50 IU / ml mouse IL-2). Dynabeads™ mouse T activator CD3 / CD28 was used to activate and expand mouse T cells. After 48 hours, CD5 mRNA-LNP transfection or lentivirus transduction was performed. The transduction efficiency of CD5 mRNA-LNP transfected T cells was measured at 60 hours, and the transduction efficiency was detected at 72 hours (Biotinylated protein L was used as the primary antibody to bind to the single-chain antibody fragment (scFv) of CAR expressed on the surface of T cells, and APC-streptavidin was used as the secondary antibody to detect the positive rate and intensity of CAR expression in transduced T cells).

[0030] This invention also provides the application of CAR-T cells targeting FAP in the preparation of drugs for the prevention and treatment of FAP-related diseases; wherein the FAP-related disease is fibrotic interstitial lung disease.

[0031] The present invention also provides a drug for preventing and treating diseases related to FAP high expression, wherein the active ingredient of the drug is CAR-T cells that target FAP; and the FAP high expression related disease is fibrotic interstitial lung disease.

[0032] (III) Beneficial Effects

[0033] The beneficial effects of this invention are:

[0034] I. Technical Effects: Pioneering a New Paradigm for Precise Targeting and Reversing Fibrosis

[0035] 1. Breakthrough in therapeutic efficacy, from "delaying" to "reversing" and "repairing":

[0036] Current technology: Nintedanib and pirfenidone can only slow the annual decline in lung function (such as FVC) by about 50%, that is, from a decrease of about 200 ml per year to about 100 ml, but cannot stop the eventual progression of the disease.

[0037] Effects of this invention: In preclinical animal models (such as bleomycin-induced mouse pulmonary fibrosis models), this technique has shown a significant reduction in lung tissue collagen volume (e.g., a decrease of more than 40%), improved lung tissue structural remodeling, and a statistically significant increase in lung function parameters (such as dynamic lung compliance). This indicates that this therapy not only blocks the fibrosis process but may also reverse existing fibrotic scars and promote lung tissue repair, which is impossible with existing drugs.

[0038] 2. A fundamental innovation in the mechanism of action: from "inhibiting signals" to "eliminating the source":

[0039] Existing technology: Existing drugs act on a wide range of pro-fibrotic signaling pathways (such as TGF-β), affecting a variety of cells, and are prone to off-target effects and side effects.

[0040] Effects of this invention: This approach utilizes the specific cytotoxicity of CAR-T cells to directly and efficiently eliminate the culprit behind excessive extracellular matrix deposition—FAP-positive activated fibroblasts / myofibroblasts. This mechanism reduces abnormal collagen production at its source, theoretically possessing greater efficacy and fundamental therapeutic potential.

[0041] 3. Achieve a lasting therapeutic effect of "one infusion, long-term benefit":

[0042] Current technology requires patients to take medication daily and undergo lifelong treatment; any interruption may lead to accelerated disease progression.

[0043] The benefits of this invention: CAR-T cells possess immune memory and in vivo expansion capabilities. After a single infusion, CAR-T cells may survive long-term in vivo and form an immune surveillance system. Once new FAP-positive cells appear, memory CAR-T cells can be rapidly activated and eliminated, thus providing potentially long-term or even permanent protection against disease relapse. This efficacy, maintained for weeks to months after a single treatment, has been observed in animal models.

[0044] II. Socioeconomic Effects: Reducing Burden and Creating Value

[0045] 1. Significantly reduces the economic burden of long-term treatment for patients:

[0046] Existing technology: Taking nintedanib as an example, its annual treatment cost in China is as high as hundreds of thousands of RMB, and it requires long-term payment, which places a heavy burden on patients' families and the medical insurance system.

[0047] The benefits of this invention: Although the cost of a single CAR-T treatment is expected to be high (referring to existing tumor CAR-T therapies, initially it may be in the hundreds of thousands to millions of yuan range), considering its potential for a "one-time cure" or long-term remission, the total cost of treatment over the entire lifespan may be far lower than existing regimens that require lifelong medication. This will greatly alleviate the long-term economic burden on patients.

[0048] 2. Improve patients' quality of life and social productivity:

[0049] Current technology: Patients have to endure drug side effects (such as nausea, diarrhea, photosensitivity, etc.), and their lung function continues to decline slowly, limiting their mobility and preventing most patients from working normally.

[0050] The benefits of this invention: If this therapy can significantly improve or even reverse lung function, patients will be freed from the burden of daily medication and side effects, and will regain basic physical activity and self-care abilities. Some patients may be able to return to work, thereby directly creating social value and reducing indirect economic losses caused by disability and premature death.

[0051] 3. Promote technological upgrading and market growth in related industries:

[0052] The successful development of this technology will greatly expand the application boundaries of CAR-T technology and open up a new market worth hundreds of billions for the treatment of fibrotic diseases.

[0053] It will drive the development of the entire industrial chain from target discovery, CAR design, viral vector production to cell preparation, promote the establishment of relevant standards and norms, and provide strong support for my country to occupy a leading position in the field of innovative cell therapy.

[0054] III. Safety and Personalization Advantages

[0055] 1. Potentially high safety profile (compared to tumor CAR-T):

[0056] Existing technologies (tumor CAR-T) face serious side effects such as cytokine release syndrome (CRS) and immune effector cell-associated neurotoxicity syndrome (ICANS).

[0057] Advantages of this invention: FAP-positive cells in fibrotic lesions are relatively quiescent stromal cells, unlike rapidly proliferating tumor cells. Therefore, this therapy is not expected to induce severe CRS as seen in hematologic malignancies. Furthermore, controllable CAR design (e.g., the introduction of a safety switch) can further enhance safety.

[0058] 2. Provides a completely new treatment option:

[0059] For patients who are intolerant to or do not respond well to existing antifibrotic drugs (approximately 30%-40%), this therapy offers a completely new "lifesaving" option with a completely different mechanism of action, filling a gap in existing treatment pathways. Attached Figure Description

[0060] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly described below.

[0061] Figure 1 This is a schematic diagram of the CAR gene vector structure;

[0062] Figure 2 This is a schematic diagram of the mRNA structure;

[0063] Figure 3 CD5 LNP-mRNA was transfected into 293T cells. In the diagram, A shows a schematic of the CD5 LNP-mRNA structure; B shows the expression of green fluorescent protein observed under a fluorescence microscope 12 hours after transfection with CD5 LNP-FAPCAR; and C shows the expression of FAPCAR in 293T cells after transfection with CD5 LNP-FAPCAR by flow cytometry.

[0064] Figure 4 To detect CAR expression in CD5 LNP-FAPCAR-transfected Jurkat cells, FITC-positive cells were defined as CAR-positive cells.

[0065] Figure 5 This is a schematic diagram of the CAR-T preparation process;

[0066] Figure 6 To demonstrate the purity and transduction efficiency of primary T cells. A shows the purity of T cells isolated from human peripheral blood mononuclear cells (PBMCs) verified by flow cytometry, i.e., CD3-positive cell population. B shows CAR-T cells expressing CAR on primary T cells; FITC and APC double-positive cells indicate successfully constructed CAR-T cells.

[0067] Figure 7 A schematic diagram of FAP CAR-T cell therapy for fibrotic interstitial lung disease;

[0068] Figure 8Schematic diagram of the CD5 mRNA LNP delivery mechanism;

[0069] Figure 9 A shows a schematic diagram of the establishment of a mouse pulmonary fibrosis model and CAR-T therapy; B, C, and D show the effects of CD5 LNP-FAP CAR-T therapy on lung function, where EF50 refers to the instantaneous flow rate during forced expiration, MV is the minute ventilation, and VT is the tidal volume; E shows Sirius red staining of lung tissue from fibrotic mice, and F shows Masson staining of lung tissue from fibrotic mice. Detailed Implementation

[0070] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0071] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0072] Example 1: Construction of CAR mRNA and plasmids expressing human / mouse FAP antigen

[0073] ① Obtain the single-stranded variable region (scfv) sequence targeting FAP, specifically:

[0074] CAGGTGCAGCTGAAAGAGAGCGGTGGACTCGTACAACCAGGGGGCAGTCTGAAACTTAGCTGTGCTGCATCTGGCTTCACATTTTCCTCATATGGCATGTCTTGGGTGCGACAAACCGCAGATAAGAGGCTTGAACTCGTCGCAACAACCAACAACAACGGAGGAGTGACATATTACCCTGACAGCGTGAAGGGAAGATTCACGATATCTCGCGATAACGCTAAGAACACCCTTTACCTTCAGATGTCCAGTCTGCAGTCAGAAGATACAGCCATGTATTACTGCGCTAGATATGGCTATTACGCCATGGATTACTGGGGACAGGGGATCAGCGTAACAGTGTCTTCAGGTGTAGGCGGTTCAGGCGGCGGTGGCTCTGGCGGTGGCGGATCGGACGTACTGATGACTCAAACACCACTCTGGCTGCCTGTATCCTTGGGTGACCAGGCTTCAATTTCCTGCCGGAGCTCTCAGAGCATCGTCCACTCTAATGGAAACACCTACCTGGAGTGGTACTTGCAGAAGCCCGGCCAGAGTCCAAAGTTGCTGATCTACAAGGTCTCCAACCGCTTTAGTGGCGTTCCCGATAGATTTTCTGGCTCTGGGTCCGGCACCGATTTTACAGTGAAGATTTCCCGAGTCGAGGCAGAAGATCTGGGAGTGTACTACTGCTTTGGGGGTTCTCACGTGCCTTACACCTTCGGCGGCGGAACAAAGCTGGAGATCAAA;

[0075] ② Construct a human / mouse T cell gene expression vector, the structural schematic diagram is as Figure 1 shown.

[0076] ③ Considering that retroviral CAR-T cells can survive long-term in vivo, and that long-term suppression of fibroblast function may affect the body's normal tissue repair process, thus posing a risk, mRNA modification technology was used to package FAP-CAR mRNA into LNPs. The mRNA can be transiently expressed intracellularly, and FAP-CAR is expressed on the surface of T cells. Using the above plasmid sequence as a template, the complete sequence was cloned into an IVT plasmid carrying a T7 promoter, 5' and 3' UTR elements, and a 3' poly(A) tail. N1-Methylpseudo-UTP (mΨ) methylpseudouridine was used to replace the UTP, and modifications such as 5'-cap and 3' poly(A) tails were added to purify the mRNA. Before use, the mRNA was encapsulated in LNPs using a self-assembly process. The RNA-loaded particles were characterized by dynamic light scattering using a Zetasizer nano-ZS (Malvern Instruments, Malvern UK) and Ribogreen assays. See Figure 2 .

[0077] ④ mRNA lipid nanoparticles were prepared using a microfluidic mixing method (from FluidicLab). LNP mRNA was functionalized with purified rat anti-mouse CD5 (clone 53-7.3, biolegend) or mouse anti-human CD5 (clone UCUCHT2, biolegend) and isotype IgG antibody (control group) by introducing a protected thiol group onto the primary amine using N-succinimide S-acetylsioacetate (SATA). SATA was deprotected using 0.5 M hydroxylamine, and unreacted components were removed by passing through a G-25 Sephadex rapid spinning protein column. The reactive thiol groups on the antibody were then bound to the maleimide moiety using thioether binding chemistry. Purification was performed using a Sepharose CL-4B gel filtration column. The mRNA content was calculated using a modified Quant-iTRiboGreen RNA analysis, confirming the successful construction of the CD5-targeting LNP-mRNA. The average hydrodynamic diameter of the LNP mRNA was approximately 80 nm, the polydispersity index was 0.02–0.06, and the encapsulation efficiency was approximately 95%.

[0078] ⑤ 293T cells were transfected with CD5 LNP-FAPCAR and CD5 LNP-GFP (blank control), respectively. Transfection efficiency was assessed after 24 hours (using fluorescence microscopy and flow cytometry). See Figure 3 .

[0079] Example 2: Preparation of CAR lentiviruses expressing FAP targeting using a third-generation lentiviral packaging system

[0080] 293T cells were co-transfected with VSVG, Deta8.9, and pAdV plasmids along with the target plasmid. Lentiviral supernatants were collected at 48 h and 72 h, and concentrated viral fluid was obtained by ultracentrifugation. 100 μL of serum-free DMEM was then used.

[0081] Dissolve the virus, infect 5 × 10⁵ Jurkat cells with 1 μl of virus, and calculate the viral titer. See [link to relevant documentation]. Figure 4 .

[0082] Example 3: Transfection of human / mouse primary T cells with CD5 mRNA-LNP

[0083] ① CD3 cells were isolated from human peripheral blood mononuclear cells (PBMCs) using a human T cell sorting kit. + T cells were cultured in TexMACS + 3% FBS + 50 IU / ml IL-2 + 1% P / S medium to select human T cells. The T cells were then activated and expanded using Dynabeads™ human T activator CD3 / CD28. After 48 hours, [further action was taken].

[0084] CD5 mRNA-LNP transfection or lentiviral transduction. See Figure 5

[0085] ② CD3 cells were isolated from mouse spleens using a mouse T-cell sorting kit. + T cells were cultured in RPMI 1640 (10% FBS-1640 + 1×glutamine + 1×mercaptoethanol (0.01 mM) + 1×P / S + 50 IU / ml mouse IL-2). Mouse T cells were activated and expanded using Dynabeads™ mouse T activator CD3 / CD28. After 48 hours, CD5 mRNA-LNP transfection or lentiviral transduction was performed. The transduction efficiency of CD5 mRNA-LNP transfected T cells was measured at 60 hours, and the transduction efficiency was assessed at 72 hours (using biotinylated protein L as the primary antibody to bind to the single-chain antibody fragment (scFv) of CAR expressed on the T cell surface, and then using APC-streptavidin as the secondary antibody to detect the positive rate and intensity of CAR expression in transduced T cells). See [link to relevant documentation]. Figure 6 .

[0086] Example 4: Construction of a bleomycin-induced mouse pulmonary fibrosis model

[0087] Healthy male SPF-grade C57BL / 6 mice, weighing 20-25g and aged 6-7 weeks, were randomly divided into a control group and an experimental group. The experimental group used a single intratracheal instillation of bleomycin to establish a mouse pulmonary fibrosis model, while the control group received intratracheal instillation of physiological saline. Mice were anesthetized with 1% sodium pentobarbital (60mg / kg) via intraperitoneal injection. Tracheal intubation was performed through the glottis under cold light irradiation of the pharynx. Bleomycin at 5mg / kg was instilled through the tracheal tube, while the control group received physiological saline. After instillation, the mice were suspended and rotated to ensure even drug distribution in the lungs. The day of model establishment was recorded as day 0 (D0). After normal feeding until day 28 (D28), mice from the experimental group were randomly selected for tissue sampling to verify the success of the model. The observed or detected indicators are as follows:

[0088] ① General situation

[0089] During the experiment, the mental state, weight changes, food and water intake, fur color, respiration, and response to external stimuli of mice in each group were monitored.

[0090] ② Weight growth rate

[0091] Weight gain rate (%) = (Weight on day n - Weight on day 0) / Weight on day 0

[0092] ③ Lung function test

[0093] Tidal volume (TV) and minute ventilation (MINV) of mice were measured using a small animal whole-body volume plethysmography system before modeling (D0), on day 10 (D10), and on day 28 (D28).

[0094] Indicators such as ventilation (MV) and 50% tidal volume expiratory flow (EF50) are used.

[0095] ④ Pathological observation of lung tissue

[0096] The left lung was fixed in 4% formaldehyde solution, embedded in paraffin, sectioned, and stained with hematoxylin and eosin (HE) and Masson's stain. Pathological changes in the lung tissue were observed under a microscope. The severity of alveolitis and fibrosis in the lung tissue was evaluated using the scoring systems of Szapiel et al. 24 and Ashcroft et al. 25, respectively.

[0097] ⑤ Determination of hydroxyproline content in lung tissue

[0098] Take 20 mg of lung tissue into a 1.5 mL centrifuge tube and cut it into a paste. Add 200 μL of extraction solution and mix well with the lung tissue. Heat in a 98℃ water bath for 5 h. Subsequent operations are performed according to the instructions of the HYP content detection kit.

[0099] ⑥ TGF-β1 detection in lung tissue

[0100] Rinse lung tissue thoroughly with pre-cooled physiological saline to remove blood, wipe dry with filter paper, add an appropriate amount of physiological saline and homogenize. Disrupt cells using a homogenizer or ultrasonic instrument, centrifuge at 3000 rpm for 10 minutes, and collect the supernatant. Detect TGF-β1 in the supernatant according to the instructions for the double-antibody sandwich enzyme-linked immunosorbent assay (ELISA).

[0101] Example 5: Constructing a stable HEK293T cell line co-expressing FAP, luciferase, and mCherry, and conducting in vitro killing ability assays.

[0102] ① HEK293T cell lines co-expressing FAP, luciferase, and red fluorescent protein (mCherry) were constructed using lentiviruses, and 293T cell lines stably expressing mCherry were sorted using flow cytometry.

[0103] ② The FAP CAR-T cells or untransduced T cells prepared above were co-cultured with luciferase-expressing 293T cells at different effector-to-target ratios (E / T) (0.5:1, 1:1, 2:1) for 12 h. The luciferase activity of the target cells was detected by enzyme-linked immunosorbent assay (ELISA) to compare the in vitro killing ability of FAP CAR-T cells with different effector-to-target ratios against FAP-overexpressing HEK293T cells.

[0104]

[0105] The table above compares the in vitro killing ability of CD5 LNP-FAP CAR-T cells with different effector-target ratios against FAP-overexpressing HEK293T cells.

[0106] Example 6: In vitro verification of the killing ability of FAP CAR-T cells against cell lines with different FAP expression levels using cell lines (CCD19Lu, LL29, and LL97A).

[0107] ① CCD19Lu, LL29 and LL97A cell lines co-expressing luciferase and puromycin were constructed using lentiviruses, and stable expression cell lines were screened using puromycin;

[0108] ② Flow cytometry was used to detect the expression levels of FAP in the normal lung fibrosis cell line CCD19Lu and the IPF cell lines LL29 and LL97A;

[0109] ③ The CD5 LNP-FAPCAR, CD5 LNP-GFP, and lentivirus-transduced T cells or untransduced T cells prepared above were co-cultured with CCD19Lu, LL29, and LL97A cells at different effector-to-target ratios (E / T) (0.5:1, 1:1, 2:1) for 12 h. The luciferase activity of the target cells was detected by enzyme-linked immunosorbent assay (ELISA) to compare the in vitro killing ability of FAP CAR-T cells with different effector-to-target ratios against CCD19Lu, LL29, and LL97A cells.

[0110]

[0111] The table above compares the in vitro killing ability of CD5 LNP-FAP CAR-T cells with different effector-to-target ratios against fibroblast cell lines CCD19Lu, LL29, and LL97A.

[0112] Example 7: Primary mouse lung fibroblasts were extracted, and FAP expression in primary fibroblasts before and after modeling was detected by flow cytometry. The differences in the in vitro killing effects of CD5 mRNA-LNP and lentivirus-transduced FAP CAR-T cells were compared.

[0113] ① Before dissecting mice (D0) and after modeling (D28), remove the lungs of the mice, cut the whole lungs open according to the lobes, remove the bronchi and blood vessels at the hilum, then cut the lung tissue into small pieces, wash with PBS containing double antibiotics, and use a pipette tip to aspirate the tissue pieces into culture flasks, add culture medium (Hyclone low-glucose DMEM), 10% newborn calf serum containing Hyclone, 100 U / ml penicillin and streptomycin, 1% gelatin PBS, and 0.25% trypsin (containing EDTA and GIBCO), and incubate at 37℃. After the primary fibroblasts crawl out, remove the tissue pieces and continue to culture for 2-3 days. When the cells are confluent, passage them at a 1:2 ratio. After passage, purify them once using the differential adhesion method, that is, after the cells have adhered for 1.0-1.5 h (that is, the vast majority of fibroblasts have adhered), discard the unadhered cells and culture medium, and replace with new culture medium to obtain primary fibroblasts in relatively good condition.

[0114] ② Flow cytometry was used to detect the expression level of FAP in mouse primary fibroblasts before modeling (D0) and after modeling (D28), and to compare whether the FAP expression level was upregulated before and after modeling. Primary fibroblasts before modeling (D0) were set as the control group, and primary fibroblasts after modeling (D28) were set as the experimental group. The prepared FAP CAR-T cells or untransduced T cells were co-cultured with mouse primary fibroblasts at different effector-to-target ratios (E / T) (0.5:1, 1:1, 2:1) for 12 hours. The luciferase activity of the target cells was detected by enzyme-linked immunosorbent assay (ELISA). The in vitro killing ability of anti-FAP CAR-T cells with different effector-to-target ratios on primary fibroblasts in the experimental group and the control group was compared. The expression of CD107a was detected by flow cytometry, and the concentrations of granzyme B and perforin were detected by ELISA.

[0115] Example 8: Evaluation of the efficacy of FAP CAR-T therapy in treating pulmonary fibrosis in mice

[0116] ① On day 28 after modeling (D28), the experimental group mice were intravenously injected with 3×10 7 Mouse FAP CART cells;

[0117] ② After FAP CAR-T cells were injected into the tail vein of the mice treated above, blood was collected from the tail vein and the expansion of FAP CAR-T cells in the mice was monitored by flow cytometry every 3 days (tail vein blood was collected 2 hours after FAP CAR-T cell infusion as the baseline).

[0118] ③ On day 35, the mice were again assessed for general condition, weight gain, lung function, lung tissue pathology, lung tissue hydroxyproline content, and TGF-β1 levels. Changes in these indicators before and after FAP CAR-T treatment were compared. (See...) Figure 7 and 9 .

[0119] ④ Take tissues (lung tissue, spleen, lymph nodes, etc.) from different parts of the experimental group of pulmonary fibrosis mice and perform FAP antibody and GFP or FAP and CD3 immunofluorescence co-localization detection to understand the infiltration of CAR-T in mouse tissues, whether there is cell occlusion, etc., and preliminarily explore possible immune escape mechanisms.

[0120] The experimental results from the above embodiments demonstrate that, by establishing preclinical animal models, such as a bleomycin-induced mouse pulmonary fibrosis model, CD5 LNP-FAP CAR-T therapy significantly reduced lung tissue collagen volume, improved lung tissue structural remodeling, and statistically significant increases in lung function parameters such as dynamic lung compliance. This indicates that the therapy not only blocks the fibrosis process but may also reverse existing fibrotic scars and promote lung tissue repair, which is impossible with existing drugs.

[0121] Finally, it should be noted that the above embodiments are only for illustrating the present invention and not for limiting the scope of protection of the present invention. Furthermore, after reading the technical content of this invention, those skilled in the art can make various modifications, alterations, or variations to the present invention, and all such equivalent forms also fall within the scope of protection claimed in this application.

Claims

1. Application of in vivo CAR-T cells targeting FAP in the preparation of drugs for the treatment of fibrotic interstitial lung disease.

2. The method for constructing an in vivo CAR-T cell model targeting FAP as described in claim 1, characterized in that, Includes the following steps: S1, construct a CAR mRNA and plasmid targeting the FAP antigen, wherein the CAR mRNA is modified with N1-Methylpseudo-UTP; S2, prepare CD5 mRNA-targeting nanoliposome particles CD5 LNP-mRNA or prepare CAR lentiviruses expressing FAP using a third-generation lentiviral packaging system; S3. FAP CAR-T cell model was constructed by transducing human / mouse primary T cells with CD5 LNP-FAP CAR or prepared lentivirus.

3. The method according to claim 2, characterized in that, Step S1 specifically involves: obtaining the single-stranded variable region (scfv) sequence targeting FAP, constructing a human / mouse T cell gene expression vector, packaging the FAP-CAR mRNA into nanoliposome particles (LNP) using mRNA modification technology, allowing the mRNA to be transiently expressed in cells and expressing FAP-CAR on the surface of T cells; using the above plasmid sequence as a template, cloning the complete sequence into an IVT plasmid carrying a T7 promoter, 5' and 3' UTR elements, and a 3' poly A tail, replacing UTP with N1-Methylpseudo-UTP, adding 5'-cap and 3' poly A tail modifications, and purifying the mRNA.

4. The method according to claim 3, characterized in that, The specific single-stranded variable region scfv sequence targeting FAP is as follows: CAGGTGCAGCTGAAAGAGAGCGGTGGACTCGTACAACCAGGGGGCAGTCTGAAACTTAGCTGTGCTGCATCTGGCTTCACATTTTCCTCATATGGCATGTCTTGGGTGCGACAAACCGCAGATAAGAGGCTTGAACTCGTCGCAACAACCAACAACAACGGAGGAGTGACATATTACCCTGACAGCGTGAAGGGAAGATTCACGATATCTCGCGATAACGCTAAGAACACCCTTTACCTTCAGATGTCCAGTCTGCAGTCAGAAGATACAGCCATGTATTACTGCGCTAGATATGGCTATTACGCCATGGATTACTGGGGACAGGGGATCAGCGTAACAGTGTCTTCAGGTGTAGGCGGTTCAGGCGGCGGTGGCTCTGGCGGTGGCGGATCGGACGTACTGATGACTCAAACACCACTCTGGCTGCCTGTATCCTTGGGTGACCAGGCTTCAATTTCCTGCCGGAGCTCTCAGAGCATCGTCCACTCTAATGGAAACACCTACCTGGAGTGGTACTTGCAGAAGCCCGGCCAGAGTCCAAAGTTGCTGATCTACAAGGTCTCCAACCGCTTTAGTGGCGTTCCCGATAGATTTTCTGGCTCTGGGTCCGGCACCGATTTTACAGTGAAGATTTCCCGAGTCGAGGCAGAAGATCTGGGAGTGTACTACTGCTTTGGGGGTTCTCACGTGCCTTACACCTTCGGCGGCGGAACAAAGCTGGAGATCAAA。 5. The method according to claim 2, characterized in that, The specific method for preparing the CD5-targeting CD5 mRNA nanoliposome particles CD5LNP-mRNA is as follows: LNP mRNA is functionalized with purified rat anti-mouse CD5 or mouse anti-human CD5 and isotype IgG antibodies by introducing protected thiol groups onto the primary amine using N-succinimide S-acetylsioacetate SATA; SATA is deprotected using 0.5 M hydroxylamine, and then unreacted components are removed by passing through a G-25 Sephadex rapid spinning protein column; then, the reactive thiol groups on the antibody are bound to the maleimide moiety using thioether binding chemistry; purification is performed using a Sepharose CL-4B gel filtration column, and the mRNA content is calculated by modified Quant-iT RiboGreen RNA analysis, thus completing the construction of the CD5-targeting LNP-mRNA.

6. The method according to claim 2, characterized in that, The method for preparing CAR lentiviruses expressing FAP targeting using a third-generation lentiviral packaging system is as follows: 293T cells were co-transfected with the target plasmid using VSVG, Deta8.9, and pAdV plasmids. Lentiviral supernatants were collected at 48 h and 72 h, and concentrated viral solution was obtained by ultracentrifugation. The virus was dissolved in 100 μL of serum-free DMEM, and 1 μL of virus was used to infect 5 × 10⁵ cells. 5 Viral titer is calculated for each Jurkat cell.

7. The method according to claim 2, characterized in that, The specific method for transfecting human / mouse primary T cells using CD5 mRNA-LNP is as follows: CD3+ cells were isolated from human peripheral blood mononuclear cells (PBMCs) using a human T-cell sorting kit. + T cells were cultured and sorted human T cells in TexMACS + 3% FBS + 50 IU / ml IL-2 + 1% P / S medium. T cells were activated and expanded by Dynabeads™ human T activator CD3 / CD28. After 48 hours, CD5 mRNA-LNP transfection or lentivirus transduction were performed. CD3 cells were isolated from mouse spleens using a mouse T-cell sorting kit. + T cells were cultured using RPMI 1640, which consisted of 10% FBS-1640 + 1×glutamine + 1×0.01 mM mercaptoethanol + 1×P / S + 50 IU / ml mouse IL-2. Dynabeads™ mouse T activator CD3 / CD28 was used to activate and expand mouse T cells. After 48 hours, CD5 mRNA-LNP transfection or lentiviral transduction was performed. The transduction efficiency of CD5 mRNA-LNP transfected T cells was measured at 60 hours, and the transduction efficiency was detected at 72 hours. Biotinylated protein L was used as the primary antibody to bind to the single-chain variable region scFv of CAR expressed on the surface of T cells. APC-streptavidin was then used as the secondary antibody to detect the positive rate and intensity of CAR expression in transduced T cells.

8. The use of the CAR-T cells according to claim 1 or 2 in the preparation of drugs for the prevention and treatment of diseases related to FAP high expression, characterized in that, The disease associated with high FAP expression is fibrotic interstitial lung disease.

9. A drug for preventing and treating diseases related to FAP high expression, characterized in that, The active ingredient of the drug is the CAR-T cells as described in any one of claims 1-2; the disease associated with high FAP expression is fibrotic interstitial lung disease.

Images