Streptomyces G18 and application thereof
By screening and identifying Streptomyces G18, its fermentation broth and extract were prepared and used to make biological agents, which solved the environmental pollution and drug resistance problems caused by chemical control of anthracnose in Camellia oleifera and achieved a highly efficient biological control effect.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-06
- Publication Date
- 2026-04-14
AI Technical Summary
Current technologies for the prevention and control of anthracnose in camellia oleifera mainly rely on chemical fungicides, which leads to environmental pollution, increased drug resistance in pathogens, and a decline in the quality of camellia oleifera. There is a lack of environmentally friendly biological control methods.
A strain of Streptomyces G18 was screened and identified, and its fermentation broth and extract were prepared for use in the production of a biological agent, which was sprayed on Camellia oleifera to control anthracnose.
The fermentation broth of Streptomyces G18 showed an inhibition rate of up to 80% against the pathogenic fungus Colletotrichum gloeosporioides YC12, which causes anthrax in Camellia oleifera. The n-butanol extract of the fermentation broth showed an inhibition rate of 97.65%, effectively preventing and controlling anthrax in Camellia oleifera without polluting the environment.
Smart Images

Figure CN121852264A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological control technology, specifically to a strain of Streptomyces G18 and its applications. Background Technology
[0002] Camellia oleifera is one of my country's most important economic tree species, ranking alongside oil palm, olive, and coconut as one of the world's four major woody oilseed tree species. Camellia oleifera not only provides high-quality edible oil but also plays a vital economic and ecological role. However, diseases and pests affecting camellia oleifera are a significant limiting factor hindering the sustainable development of the camellia oleifera industry.
[0003] Anthracnose is one of the most important diseases affecting camellia oleifera, distributed throughout camellia-growing regions of my country, especially in high-altitude areas, and can cause severe bud and fruit drop. In the early stages, dark brown spots appear on young fruits, later expanding into circular lesions with a grayish-black center and dark brown edges. In severe cases, the entire fruit turns black, with small black dots appearing on the lesions—the conidiophores of the pathogen. The main pathogen of anthracnose in camellia oleifera is *Colletotrichum gloeosporioides* (…). Colletotrichum gloeosporioides In addition, the pathogen that can cause anthrax in camellia oleifera is *Anthrax boningensis* (Bacillus boningensis). Colletotrichum boninense ), Kahava anthrax bacteria ( Colletotrichum kahawae Diseases can occur year-round. Fruit anthracnose typically occurs in early May, with peak incidence in August and September, causing severe fruit drop.
[0004] Currently, the control of anthracnose in camellia oleifera mainly relies on chemical fungicides, such as carbendazim, thiophanate-methyl, and tebuconazole. However, there are no registered fungicides for the control of anthracnose in camellia oleifera in my country. Furthermore, long-term and excessive use of chemical pesticides easily leads to environmental pollution, increased pathogen resistance, decreased camellia oleifera quality, and pesticide residues. Biological control utilizes beneficial microorganisms (such as bacteria, fungi, and viruses) and their metabolic products to control plant diseases. Compared to chemical control, biological control has advantages such as environmental safety, no residue, and less likelihood of developing resistance. Therefore, biological control is considered a green and ecologically feasible method, and it is necessary to screen and isolate a strain of microorganisms that can control anthracnose in camellia oleifera while being harmless to the environment and humans. Summary of the Invention
[0005] The purpose of this invention is to at least solve one of the technical problems existing in the prior art, and to provide a Streptomyces G18 strain and its applications.
[0006] The technical solution of the present invention is as follows: The first aspect of the present invention provides a Streptomyces strain G18, wherein the Streptomyces ( streptomyces albusG18 has been deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20251269, deposit date June 5, 2025, and deposit address Wuhan University, Wuchang District, Wuhan City, Hubei Province.
[0007] A second aspect of the present invention provides a Streptomyces G18 fermentation broth obtained by fermentation of the Streptomyces G18.
[0008] A third aspect of the present invention provides a method for preparing the Streptomyces G18 fermentation broth, the method comprising the following steps: Streptomyces G18 grown on Gao's No. 1 medium was inoculated into 5 mL of ISP2 liquid medium and cultured at 28°C for 1 day. Then it was transferred to 500 mL of Gao's No. 1 medium for expansion culture and cultured at 28°C for 4 days to obtain the fermentation broth of Streptomyces G18.
[0009] A fourth aspect of the present invention provides an extract of Streptomyces G18 fermentation broth, obtained by organic extraction from the Streptomyces G18 fermentation broth.
[0010] Preferably, the organic compound is at least one of petroleum ether, ethyl acetate, and n-butanol.
[0011] A fifth aspect of the present invention provides a method for preparing the extract, the method comprising the following steps: Petroleum ether was added to the fermentation broth of Streptomyces G18 for extraction. After standing, the petroleum ether phase and the aqueous phase were separated to obtain petroleum ether extract and aqueous phase 1. Then, ethyl acetate was added to the aqueous phase 1 for extraction. After standing, the ethyl acetate phase and the aqueous phase were separated to obtain the ethyl acetate extract and the aqueous phase 2. Finally, n-butanol was added to the aqueous phase 2 for extraction. After standing, the n-butanol phase and the aqueous phase were separated to obtain the n-butanol extract and the aqueous phase 3.
[0012] Preferably, in the preparation method, the volume ratio of the Streptomyces G18 fermentation broth, petroleum ether, ethyl acetate, and n-butanol is 1:1:1:1. More preferably, the specific amount added is 500 mL for each component.
[0013] A sixth aspect of the present invention provides a biological agent comprising the Streptomyces G18 or the fermentation broth of the Streptomyces G18 or the extract.
[0014] The seventh aspect of the present invention provides the use of the Streptomyces G18 or the fermentation broth of the Streptomyces G18 or the extract or the biological agent in the prevention and control of anthrax in Camellia oleifera.
[0015] Preferably, the method of application includes: S1. The Streptomyces G18 was placed in 5 mL of ISP2 liquid medium and cultured at 28°C and 180 rpm for 1 day. Then it was placed in 500 mL of Gao's No. 1 medium for expansion culture and cultured at 28°C and 180 rpm for 4 days to obtain the fermentation broth of Streptomyces G18. S2. Prepare a biological agent from the Streptomyces G18 fermentation broth; or, add the Streptomyces G18 fermentation broth to organic matter, extract the organic matter extract, and prepare a biological agent from the organic matter extract. S3. The diluted biological agent is sprayed onto the camellia oil.
[0016] This invention has at least one of the following beneficial effects: This invention obtained a Streptomyces strain G18 through screening. Upon identification, Streptomyces G18 was determined to be a white Streptomyces species within the genus Streptomyces. streptomyces albus Further research revealed that Streptomyces G18 can be used to control anthracnose in Camellia oleifera. The fermentation broth of Streptomyces G18 is effective against the anthracnose causative agent of Camellia oleifera anthracnose (Gollum globulus). Colletotrichum gloeosporioides The inhibition rate of Streptomyces G18 on strain YC12 was as high as 80%, and the inhibition rate of the n-butanol extract of the fermentation broth of Streptomyces G18 on strain YC12 was as high as 97.65%, almost completely inhibiting the growth of strain YC12. This indicates that Streptomyces G18 of the present invention has a good control effect on anthracnose of Camellia oleifera and can be made into a biological agent for the biological control of anthracnose of Camellia oleifera.
[0017] The method for controlling anthrax proposed in this invention is a biological control method. The product itself comes from the soil and will not pollute the environment or harm human health. Attached Figure Description
[0018] Figure 1 This invention relates to the morphological observation and molecular biological identification of Streptomyces G18 in this embodiment; wherein, A in the figure shows the morphology of Streptomyces G18 on NA medium; B in the figure shows the morphology of Streptomyces G18 on Gao's No. 1 medium; C in the figure shows the hyphae and spore morphology of Streptomyces G18 under scanning electron microscopy; D in the figure shows the Gram staining morphology of Streptomyces G18; and E in the figure shows the phylogenetic tree.
[0019] Figure 2 This invention relates to the control effect of Streptomyces G18 on tea leaves and the morphological changes of strain YC12. Figure A shows the growth state of strain YC12 under Streptomyces G18 treatment; Figure B shows the mycelial state of strain YC12 under Streptomyces G18 treatment; Figure C shows the control effect of Streptomyces G18 on tea leaves; and Figure D shows the statistical data on the control effect.
[0020] Figure 3This figure illustrates the inhibitory effect of Streptomyces G18 on strain YC12 in this embodiment of the invention. In the figure, A represents the inhibitory effect of the fermentation broth of Streptomyces G18 on strain YC12; B represents the inhibitory effect of the volatile organic compounds of Streptomyces G18 on strain YC12; C represents the inhibition rate of the components of the fermentation broth of Streptomyces G18 on strain YC12; and D represents the inhibition rate of the volatile organic compounds of Streptomyces G18 on strain YC12.
[0021] Figure 4 This invention illustrates the inhibitory effect of different fermentation times and fermentation broth concentrations of Streptomyces G18 on strain YC12 in this embodiment; where A in the figure represents different fermentation times; and B in the figure represents different fermentation broth concentrations.
[0022] Figure 5 This invention demonstrates the inhibitory effects of different extracts from the fermentation broth of Streptomyces G18 on strain YC12.
[0023] Figure 6 This invention relates to the field application of Streptomyces G18 fermentation broth and chlorothalonil for the control of anthracnose in Camellia oleifera. In the figure, A represents the disease index of experimental area 1; B represents the disease index of experimental area 2; and C represents the control effect of experimental areas 1 and 2. Detailed Implementation
[0024] To make the technical problems solved, the technical solutions, and the beneficial effects of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
[0025] The “YC12 strain” in the following examples is *Colletotrichum gloeosporioides*, the pathogen causing anthrax in *Camellia oleifera*. Colletotrichum gloeosporioides The YC12 strain was screened by Jiangxi Agricultural University. The specific screening method is as follows: a tissue block of about 3mm-5mm on each side was cut from the junction of diseased and healthy leaves of Camellia oleifera. The tissue block was soaked in 70% alcohol for 30 seconds, and then soaked in 0.1% acidic mercuric chloride aqueous solution for 3-5 minutes. After washing with sterile water 3 times, the tissue block was transferred to PDA medium and cultured for 7 days to obtain the pathogenic strain YC12.
[0026] The ITS sequence (SEQ ID NO. 2) of strain YC12 is as follows: .
[0027] Determination of the pathogenicity of strain YC12 to Camellia oleifera: Healthy Camellia oleifera leaves were disinfected with 75% alcohol, and artificial wounds were created in the middle of the leaves. A 6 mm diameter YC12 bacterial block was inoculated onto the wound on the leaf. Direct inoculation with 6 mm blank PDA medium served as a control. The inoculated leaf pieces were placed in a PE box lined with damp paper towels, sealed with plastic wrap, and incubated at 28℃ for 7 days. Each treatment was repeated three times to observe the strong pathogenicity of YC12 to Camellia oleifera. The present invention will be further described in detail below with reference to specific embodiments, but the present invention is not limited to the following specific embodiments.
[0028] Example 1: Screening, identification and preservation of Streptomyces G18 1. Screening of Streptomyces G18 Forty-five pure bacterial strains were isolated from soil. Based on colony morphology and 16S rDNA sequence, the strains were classified macroscopically and stereoscopically. Antibacterial performance tests were conducted on the 45 pure strains, revealing that three strains exhibited strong antibacterial activity. These three strains were then used for in vitro antibacterial tests against *Camellia oleifera* anthracnose. The results showed that one strain exhibited an inhibition diameter of approximately 14 mm against *Camellia oleifera* in vitro, superior to the other strains. Therefore, this strain was designated G18, and further research will be conducted on strain G18.
[0029] 2. Identification of Streptomyces G18 The isolated strain G18 was identified morphologically and molecularly, and the experimental results are recorded below: (1) Morphological characteristics: On NA medium, Streptomyces G18 colonies are round, milky white, smooth, and dense. Figure 1 (A) On Gao's No. 1 medium, G18 colonies are irregularly round, with a light yellow halo, white, rough surface, and loose texture. Figure 1 (B in the text). Under scanning electron microscopy, the hyphae of G18 are smooth, the spores are densely packed, the spores are spherical, and the surface is covered with slender protrusions, resembling spines. The spores grow singly or in clusters. Figure 1 C); G18 is a Gram-positive bacterium (in the text C); Figure 1 (D in the middle).
[0030] (2) Molecular biological identification: The 16S rDNA sequence of the strain was determined, and its nucleotide sequence is shown in SEQ ID NO. 1.
[0031] SEQ ID NO. 1: ATGAACAGCAACACCCGCCACGTACCCGTCATGCTCCAGCGCTGCCTGGACGTGCTCGCCCCCGCGCTCGCCGAGCCCGGCGCGGTCGTCGTCGACTGCACCCTCGGCCTCGGCGGGCACAGCGAGGCGCTGCTCGCCACGTTCCCCGAGGCCCGGCTGGTCGCCCTGGACCGCGACCCGGCCGCGCTCCGCCTCGCGGGGGAGCGGCTGGCCCCCTACGGCGACCGCGCCACCCTGGTGCACGCGGTCTACGACGAGCTCCCCGAGGTCCTCGACCGGCTCGGGCTGCCGCACGTCCAGGGCGTCCTGTTCGACCTCGGCGTCTCCTCCATGCAGCTCGACGAGGCCGACCGCGGCTTCGCCTACGCCCAGGACGCCCCGCTCGACATGCGGATGGACCAGACGACCGGCATCAGCGCCGCCGAGGTCCTCAACACCTACCCGCCCGGGGAACTGGTCCGGATCCTGCGCGCCTACGGCGAGGAGAAGCAGGCCAAGCGGATCGTCGCCGCGGTGGTGCGGGAGCGGGAGAAGGAGCCGTTCAGCACCAGCGCCCGGTTGGTCGAGCTGATCCGCGACGCGCTGCCGCAGGCCGCCAAGCGCACCGGCGGCAATCCCGCCAAGCGGACCTTCCAGGCGCTGCGCATCGAGGTCAACGGCGAGCTGGCCTGCGTCGAGCGCGCCATCCCGGCCGCGGTGAAGTCGCTAGCGGTGGGCGGCCGGATCGCCGTGCTCGCCTACCACTCGCTAGAGGACCGGCTGGTCAAGCAGGTCTTCGCGGCCGGCGCCAGCAGCACCGCGCCGCCCGGCCTCCCGGTGGTCCCCGAGCGCTACCAACCCCGGCTCAAGCTGCTGACCCGCGGGGCCGAGCTGCCCACGGAGGAGGAGGTCGCGCAGAACCGGCGCGCGGCCCCGGCCCGGCTGCGCGGCGCCGAGCGCATCCGCGAGGACATCGCGTGA。
[0032] Phylogenetic trees were constructed using the maximum likelihood method after tandemly collecting the 16S rRNA, atpD, gyrB, recA, rpoB, and trpB gene sequences of Streptomyces G18 and other Streptomyces strains. The results showed that G18 and... streptomyces albus When alone on a branch, the spin-out value is 93%, indicating the branch is reliable. Figure 1 The E in the text. Therefore, G18 was identified as a white Streptomyces of the genus Streptomyces (E). streptomyces albus ).
[0033] 3. Preservation of Streptomyces G18 Based on the above identification results, the screened strain was confirmed to be *Streptomyces albopictus*. streptomyces albus The specimen, designated G18, has been deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M20251269, date of deposit on June 5, 2025, and address at Wuhan University, Wuchang District, Wuhan City, Hubei Province.
[0034] Example 2: Determination of the biocontrol effect of Streptomyces G18 and its fermentation broth I. Biological control effect of Streptomyces G18 on anthracnose in Camellia oleifera 1. First, it was confirmed on PDA plates that Streptomyces G18 effectively inhibited the growth of strain YC12. The specific experimental protocol is as follows: G18 treatment group: YC12 mycelial blocks with a diameter of 6 mm were inoculated in the center of a PDA plate. Then, 50 μL of Streptomyces G18 fermentation broth was added about 2.5 cm away from the mycelial block, and the plate was incubated at 28°C for 7 days. The growth of the YC12 strain was then observed.
[0035] Control group: YC12 mycelial blocks with a diameter of 6 mm were inoculated in the center of a PDA plate, inoculated with sterile Gao's No. 1 liquid medium, and cultured at 28℃ for 7 days. The growth of YC12 strain was then observed.
[0036] The results are as follows Figure 2 A and Figure 2 As shown in B in the figure, it can be seen from the figure that, compared with the control group, the inhibition diameter of the G18 treatment group was about 14 mm. Figure 2 (A) Furthermore, scanning electron microscopy analyzed the changes in hyphae of strain YC12 under G18 treatment. In the control group (without G18 treatment), the hyphae of strain YC12 were round, plump, with intact morphology and structure, uniform thickness, and smooth surface; while in the G18-treated group, the hyphae of strain YC12 were severely damaged, with surface shrinkage, breakage and adhesion, and filamentous and reticulate structures appearing between the hyphae. Figure 2 (B in the text). Therefore, it was determined that Streptomyces G18 can effectively inhibit the growth of strain YC12.
[0037] 2. To further investigate the control effect of Streptomyces G18 on anthrax in Camellia oleifera in vivo, the following experiment was conducted: First, healthy tea leaves with uniform growth were collected. The leaves were washed with sterile distilled water, dried on paper towels, and then placed face down in a petri dish containing two sheets of filter paper soaked in sterile distilled water. Four artificial wounds were created in the middle of each leaf using a sterile needle before further processing.
[0038] Next, the tea leaves were divided into four groups, and each group was processed separately. The processing methods for the four groups are as follows: Control group: 10 µL of sterile water was inoculated into the wound site of the tea leaf.
[0039] G18 treatment group: 5 µL of a 1×10⁻⁶ concentration was inoculated into the wounds of tea leaf cuttings. 7 Streptomyces G18 sterile fermentation broth, cells / mL.
[0040] YC12 treatment group: 6 mm mycelial discs of YC12 strain grown on PDA plates were inoculated at the wound site of tea leaves.
[0041] G18+YC12 treatment group: 5µL of 1×10⁻⁶ solution was simultaneously inoculated at the wound site of the tea leaf extract. 7 Streptomyces G18 sterile fermentation broth (cells / mL) and YC12 strain grown on 6 mm mycelial discs on PDA plates.
[0042] The preparation method of Streptomyces G18 aseptic fermentation broth is as follows: the G18 strain grown on Gao's No. 1 medium is inoculated into 5 mL of ISP2 liquid medium and cultured at 28℃ for 1 day. Then it is transferred to 500 mL of Gao's No. 1 medium for expansion culture and cultured at 28℃ for 4 days to obtain Streptomyces G18 aseptic fermentation broth.
[0043] Finally, three leaves were used for each treatment group, and the experiment was repeated twice. The diameter of the lesions on the leaves was measured on day 7. The inhibitory effect of G18 on YC12 was determined by comparing the lesion diameter.
[0044] Experimental results showed that strain G18 significantly inhibited the occurrence of anthrax on tea leaves. Figure 2 (C) The leaf lesion area of YC12 strain alone was 23 mm. 2 ~28 mm 2 The leaf lesion area in the G18 and YC12 strain inoculated group (G18+YC12 treatment group) was 10 mm. 2 The lesion area was consistent with that of the control group and the G18 treatment group. Figure 2 (D in the middle).
[0045] II. The biocontrol effects of G18 fermentation broth, supernatant, sterile supernatant, and the corresponding volatile organic compounds on Camellia anthracnose.
[0046] 1. The biocontrol effects of G18 fermentation broth, supernatant, and sterile supernatant on *Camellia oleifera* anthracnose. The G18 strain, grown on Gao's No. 1 medium, was inoculated into 5 mL of ISP2 liquid medium and cultured at 28°C for 1 day. Then, it was transferred to 500 mL of Gao's No. 1 medium for scale-up culture and cultured at 28°C for 4 days to obtain the fermentation broth of the G18 strain (i.e.,...). Figure 3 The fermentation broth of strain G18 was centrifuged at 6000 rpm for 6 min to obtain the supernatant (i.e., the fermentation broth). Figure 3 The supernatant was filtered through a 0.22 μm filter membrane to obtain a sterile supernatant (i.e., the supernatant). Figure 3 (sterile supernatant).
[0047] The experiment was conducted according to the following four groups: Fermentation broth treatment group: YC12 mycelial blocks with a diameter of 6 mm were inoculated in the center of a PDA plate. Then, 50 μL of G18 strain fermentation broth was added approximately 2.5 cm away from the mycelial block. Supernatant treatment group: YC12 mycelial blocks with a diameter of 6 mm were inoculated in the center of a PDA plate. Then, 50 μL of supernatant was added approximately 2.5 cm away from the mycelial block. Aseptic supernatant treatment group: YC12 mycelial blocks with a diameter of 6 mm were inoculated in the center of a PDA plate. Then, 50 μL of sterile supernatant was added at a distance of about 2.5 cm from the mycelial block.
[0048] Control group: YC12 mycelial blocks with a diameter of 6 mm were inoculated in the center of a PDA plate. Then, the PDA plate was inoculated with sterile Gao's No. 1 liquid medium.
[0049] The four groups were cultured at 28℃ for 7 days, and the growth of strain YC12 was observed. The results are as follows: Figure 3 A and Figure 3 As shown in C.
[0050] 2. The control effect of volatile organic compounds (VOCs) from Streptomyces G18 fermentation broth, supernatant, and sterile supernatant on Camellia anthracnose YC12: 100 μL of fermentation broth, supernatant, and sterile supernatant of strain G18 were extracted and evenly spread onto solid Gao's I agar plates. Then, 6 mm diameter bacterial blocks were taken from the YC12 culture plate. The YC12 bacterial blocks were then placed in the center of a fresh PDA plate. The PDA plate containing the YC12 bacterial blocks was then inverted onto the Gao's I agar plates spread with different components of G18. The control group was spread with sterile Gao's I liquid medium. The plates were sealed with sealing film to prevent a decrease in volatile organic compound (VOC) levels, thus obtaining the VOC treatment groups corresponding to the fermentation broth, supernatant, and sterile supernatant. A blank control group was also set up. The sealed plates were then incubated at 28°C for 7 days, and the growth of strain YC12 was observed. Results are as follows: Figure 3 B and Figure 3 As shown in D in the diagram.
[0051] Figure 3 A and Figure 3 In the figure, C represents the inhibition results of G18 fermentation broth, supernatant, and sterile supernatant. Figure 3 The left side of B in the image shows the growth results of G18 fermentation broth, supernatant, and sterile supernatant on Gao's I plate, while the right side shows the growth results of strain YC12 on the corresponding volatiles of G18 fermentation broth, supernatant, and sterile supernatant. Figure 3 In this context, D represents the inhibition result of volatile organic compounds in the G18 fermentation broth, supernatant, and sterile supernatant.
[0052] Figure 3 The results showed that the G18 fermentation broth, supernatant, and sterile supernatant after passing through a 0.22 μm filter membrane all had inhibitory effects on strain YC12. Among them, the G18 fermentation broth had the highest inhibition rate, reaching about 80%, followed by the supernatant, and the filtered supernatant had the lowest inhibition rate, only 50%. Figure 3 A and Figure 3 The volatiles in G18 fermentation broth, supernatant, and sterile supernatant showed no inhibitory effect on YC12. Figure 3 B and Figure 3 (D in the text). Therefore, the antibacterial substance produced by G18 is determined to be a non-volatile substance in the fermentation broth.
[0053] Example 3: Determination of the optimal culture conditions (4 days) and minimum inhibitory concentration (9%) for Streptomyces G18 Streptomyces G18 was cultured on Gao's No. 1 medium at 28°C and 180 rpm. The supernatant of Streptomyces G18 fermentation culture for 1, 2, 3, 4, 5 and 6 days was filtered through a 0.22 μm filter and then PDA was added to prepare 3% plates. A blank control group was set up. YC12 mycelial cake was placed on the plates and grown for 7 days. The growth of strain YC12 was observed.
[0054] The results are as follows Figure 4 As shown in Figure A, the results indicate that the fermentation broth cultured for 4 days exhibited the best inhibitory effect on strain YC12, while the inhibitory effects of fermentation broths cultured for 5 days and 6 days were not significantly different from those cultured for 4 days. Figure 4 A in the middle.
[0055] Then, PDA plates with concentrations of 1%, 3%, 5%, 7%, 9% and 11% were prepared using the 4-day fermentation broth of Streptomyces G18, and a blank control group was set up. The YC12 strain was placed on the plates and grown for 7 days, and the growth of the YC12 strain was observed.
[0056] The results are as follows Figure 4 As shown in B, the results indicate that PDA plates with concentrations of 9% and 11% showed a 100% inhibition rate against strain YC12.
[0057] In summary, the optimal culture time for Streptomyces G18 fermentation broth is 4 days, and the minimum inhibitory concentration of Streptomyces G18 fermentation broth is 9%.
[0058] Example 4: Preparation method of extract from G18 fermentation broth and its biocontrol effect on anthracnose in Camellia oleifera. I. Preparation method of extract from G18 fermentation broth 500 mL of the G18 fermentation broth prepared in Example 2 was added to 500 mL of petroleum ether for extraction. After standing, the petroleum ether phase and the aqueous phase were separated to obtain the petroleum ether extract and aqueous phase 1. Then, 500 mL of ethyl acetate was added to the aqueous phase 1 for extraction. After standing, the ethyl acetate phase and aqueous phase 2 were separated. Finally, 500 mL of n-butanol was added to the aqueous phase 2 for extraction. After standing, the n-butanol phase and the aqueous phase were separated to obtain the n-butanol extract and the aqueous phase 3.
[0059] Extracts of G18 fermentation broth in different organic solvents were prepared using the above method.
[0060] II. Biological control effect on anthracnose in Camellia oleifera The petroleum ether extract, ethyl acetate extract, n-butanol extract, and aqueous phase 3 were freeze-dried separately, dissolved in 10 mL of methanol, and filtered through a 0.22 μm filter membrane for later use. A 6 mm diameter YC12 mycelial block was inoculated in the center of a PDA plate. Then, 50 μL of each of the petroleum ether extract, ethyl acetate extract, n-butanol extract, and aqueous phase 3 extract (aqueous phase 3) was added approximately 2.5 cm away from the mycelial block. As a control, 50 μL of methanol and sterile water were added approximately 2.5 cm away from the mycelial block. The plates were then incubated at 28 °C for 7 days, and the growth of the YC12 strain was observed.
[0061] The measurement results are as follows Figure 5 As shown, the petroleum ether extract, ethyl acetate extract, n-butanol extract, and aqueous extract of the G18 fermentation broth all inhibited the growth of strain YC12. The n-butanol extract showed the highest inhibition rate (97.65%), almost completely inhibiting the growth of strain YC12; followed by ethyl acetate (26.47%), petroleum ether (18.43%), and aqueous extract (16.27%). Therefore, the above results indicate that different extracts have different biocontrol effects on anthracnose in Camellia oleifera, with the n-butanol extract of the G18 fermentation broth showing the best control effect, inhibiting strain YC12 by 97.65%.
[0062] Example 5 Field Experiment The Streptomyces G18 fermentation broth prepared in Example 2 was used to spray Camellia oleifera plants infected with anthracnose in the field, and the growth of the Camellia oleifera was observed. The specific method is as follows: Two experimental plots were selected, designated as Experimental Area 1 and Experimental Area 2. A preliminary disease survey was conducted on the camellia oleifera before spraying the control pesticide. The camellia oleifera was then sprayed with the control pesticide (divided into three groups: G18 treatment group, pesticide control group, and blank control group). The pesticide was applied twice, with a 10-day interval between applications, until the trunk was thoroughly wetted. A second disease survey was conducted 10 days after the second spraying to calculate the disease index and control effect. The calculation methods for the disease index and control effect are as follows: The grading criteria for anthracnose in Camellia oleifera are shown in Table 1 below (by leaf): Table 1. Classification criteria for the incidence of anthrax in Camellia oleifera The grouping is as follows: G18 treatment group: The Streptomyces G18 fermentation broth prepared in Example 2 was diluted 100 times and sprayed on Camellia oleifera plants suffering from anthrax.
[0063] Control group: 95% chlorothalonil was diluted 500 times with water and sprayed on camellia trees suffering from anthrax.
[0064] Blank control group: Water was sprayed on camellia trees suffering from anthrax.
[0065] The results are as follows Figure 6 As shown in the figure, compared to the blank control group (i.e. Figure 6 CK in the middle), G18 treatment group (i.e. Figure 6 G18) and chlorothalonil treatment group (i.e. Figure 6The incidence of anthracnose in Camellia oleifera was significantly reduced by the presence of chlorothalonil (in the presence of chlorothalonil). The control efficacy of G18 fermentation broth against anthracnose in experimental area 1 was basically the same as that of chlorothalonil, while the control efficacy of G18 fermentation broth in experimental area 2 was higher than that of chlorothalonil. Therefore, this indicates that Streptomyces G18 of the present invention has a good control effect on anthracnose in Camellia oleifera.
[0066] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.
Claims
1. A strain of Streptomyces G18, characterized in that, The Streptomyces ( streptomyces albus G18 has been deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20251269, deposited on June 5, 2025, at Wuhan University, Wuchang District, Wuhan City, Hubei Province.
2. A Streptomyces G18 fermentation broth, characterized in that, It is obtained by fermentation of Streptomyces G18 as described in claim 1.
3. The method for preparing the Streptomyces G18 fermentation broth according to claim 2, characterized in that, The preparation method includes the following steps: Streptomyces G18 grown on Gao's No. 1 medium was inoculated into 5 mL of ISP2 liquid medium and cultured at 28°C for 1 day. Then it was transferred to 500 mL of Gao's No. 1 medium for expansion culture and cultured at 28°C for 4 days to obtain the fermentation broth of Streptomyces G18.
4. An extract of Streptomyces G18 fermentation broth, characterized in that, It is obtained by organic extraction from the fermentation broth of Streptomyces G18 as described in claim 2.
5. The extract according to claim 4, characterized in that, The organic compound is at least one of petroleum ether, ethyl acetate, and n-butanol.
6. A method for preparing the extract according to any one of claims 4 to 5, characterized in that, The preparation method includes the following steps: Petroleum ether was added to the fermentation broth of Streptomyces G18 for extraction. After standing, the petroleum ether phase and the aqueous phase were separated to obtain petroleum ether extract and aqueous phase 1. Then, ethyl acetate was added to the aqueous phase 1 for extraction. After standing, the ethyl acetate phase and the aqueous phase were separated to obtain the ethyl acetate extract and the aqueous phase 2. Finally, n-butanol was added to the aqueous phase 2 for extraction. After standing, the n-butanol phase and the aqueous phase were separated to obtain the n-butanol extract and the aqueous phase 3.
7. The preparation method according to claim 6, characterized in that, In the preparation method, the volume ratio of the Streptomyces G18 fermentation broth, petroleum ether, ethyl acetate and n-butanol is 1:1:1:
1.
8. A biological agent, characterized in that, It includes the Streptomyces G18 of claim 1, the Streptomyces G18 fermentation broth of claim 2, or the extract of any one of claims 4 to 5.
9. The application of the Streptomyces G18 of claim 1, the Streptomyces G18 fermentation broth of claim 2, the extract of any one of claims 4-5, or the biological agent of claim 8 in the prevention and control of anthracnose in Camellia oleifera.
10. The application according to claim 9, characterized in that, The application method includes: S1. The Streptomyces G18 was placed in 5 mL of ISP2 liquid medium and cultured at 28°C and 180 rpm for 1 day; then it was placed in 500 mL of Gao's No. 1 medium for expansion culture and cultured at 28°C and 180 rpm for 4 days to obtain the fermentation broth of Streptomyces G18. S2. Prepare a biological agent from the Streptomyces G18 fermentation broth; or, add the Streptomyces G18 fermentation broth to organic matter, extract the organic matter extract, and prepare a biological agent from the organic matter extract. S3. The diluted biological agent is sprayed onto the camellia oil.
Citation Information
Patent Citations
Bacterial wilt resistance biocontrol strain and an application thereof
CN109207412A
Streptomyces A2 strain with strong bacteriostatic effect and application thereof
CN112574902A
Termite-derived biocontrol streptomyces W7 and application thereof
CN113930355A
Streptomyces paaluis strain 13-3 and application thereof
CN115820454A
Insect-derived biocontrol streptomyces ITBB12006 and application thereof
CN117286075A