Probiotic Escherichia coli CP57 (Escherichia coli CP57) and application thereof
By screening out porcine probiotic Escherichia coli CP57, the problem of intestinal pathogenic bacteria infection in livestock has been solved. It provides an acid- and bile-resistant probiotic strain that significantly inhibits Salmonella growth and alleviates Salmonella infection symptoms. It can be used to prepare microecological preparations for the prevention and treatment of intestinal infections in livestock.
Patent Information
- Application Number
- CN202610055666.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-15
- Publication Date
- 2026-04-14
AI Technical Summary
In the current technology, diarrhea caused by pathogenic bacteria in livestock is a serious problem, and traditional antibiotic treatment leads to bacterial resistance and drug residues. There is a lack of effective probiotic preparations to regulate the intestinal flora and reduce antibiotic use.
A porcine probiotic Escherichia coli strain CP57 was screened and provided. It has acid and bile salt resistance, does not carry virulence factors of diarrheal Escherichia coli, can significantly inhibit the growth of Salmonella, and alleviate clinical symptoms in a Salmonella infection model. It can be used to prepare probiotic preparations.
This probiotic strain can effectively inhibit the growth of Salmonella, reduce Salmonella colonization and infection in the intestines, alleviate intestinal pathogen infection in livestock, reduce fecal bacterial excretion and tissue bacterial load, and has the potential to prevent and control intestinal infections in livestock.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of probiotics technology, and in particular to probiotic Escherichia coli CP57 and its applications. Background Technology
[0002] Diarrhea caused by pathogenic bacterial infections in livestock is one of the most common diseases in modern animal husbandry, and the problems of bacterial resistance and drug residues resulting from traditional antibiotic treatment are becoming increasingly serious. Probiotics are a class of beneficial microorganisms for animals. Probiotics can resist pathogenic bacterial infections by regulating the flora structure, strengthening the intestinal epithelial barrier, regulating immunity, and producing beneficial metabolites, providing a new solution for alleviating intestinal pathogenic bacterial infections in livestock and reducing the use of antibiotics.
[0003] Escherichia coli (E. coli) is an important member of the gut microbiota, a typical Gram-negative commensal bacterium involved in maintaining the balance of the gut microbiota. E. coli plays a crucial role in promoting intestinal development, maintaining the integrity of the intestinal mucosal barrier, and competitively inhibiting pathogen colonization. Therefore, E. coli is also considered a potential probiotic resource. For example, the classic probiotic E. coli Nissle 1917 (EcN) is currently used for maintenance treatment of ulcerative colitis in humans and for infection prevention in newborns. Pre-administration of EcN can prevent attack by enterotoxigenic E. coli and alleviate diarrhea in piglets. Pre-inoculation with four commensal bacteria, including E. coli, can enhance the host's innate immune function and effectively inhibit Salmonella colonization in the intestine. The rapid growth, clear genetic background, ease of culture, and simple gene manipulation of E. coli make it widely used as a model strain, providing an ideal platform for probiotic mechanism research and the development of engineered probiotics.
[0004] Probiotics from different sources exhibit different biological characteristics and are strain-specific. Therefore, screening and optimizing strains is crucial for probiotic formulations. Summary of the Invention
[0005] Natural intestinal symbiotic Escherichia coli screened from piglet feces exhibits stronger adaptability to the gastrointestinal environment of livestock and can more effectively exert its probiotic effects. To reduce the use of antibiotics in large-scale farming and enrich the local probiotic library, this invention provides a porcine-derived probiotic Escherichia coli. This probiotic is a Gram-negative probiotic with excellent acid and bile salt resistance, does not carry common virulence factors of diarrheal Escherichia coli, and has low cytotoxicity and good safety. In in vitro experiments, this strain can significantly inhibit the growth of Salmonella. In a mouse model of Salmonella infection, this strain can alleviate clinical symptoms caused by Salmonella infection and reduce the amount of Salmonella excreted in feces and on tissues. It demonstrates the potential to control intestinal pathogenic bacteria infections in livestock and can be used to prepare microecological preparations for the prevention and treatment of intestinal infections in livestock.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0007] In a first aspect, the present invention provides Escherichia coli CP57, which has the accession number CGMCC No. 36403.
[0008] In some specific embodiments of the present invention, the Escherichia coli CP57 includes one or more of its live bacteria, inactivated bacterial cells, fermentation broth, exosomes, or metabolites.
[0009] In some specific embodiments of the present invention, the Escherichia coli CP57 has acid and / or bile salt resistance and does not carry virulence factors of diarrheal Escherichia coli.
[0010] Secondly, the present invention also provides the application of the Escherichia coli CP57 in the preparation of microecological products, probiotic products, synbiotics and / or postbiotic products.
[0011] In some specific embodiments of the present invention, the microecological products, probiotic products, synbiotic products and / or postbiotic products include, but are not limited to, one or more of the following: pharmaceuticals, food, cosmetics, feed, feed additives or pet food; and / or
[0012] The dosage forms of the microecological products, probiotic products, synbiotic products and / or postbiotic products include, but are not limited to, one or more of the following: powder, granules, capsules, tablets, pills, extracts, liquid preparations, sugar or jelly.
[0013] Thirdly, the present invention also provides articles comprising the said Escherichia coli CP57.
[0014] The products include microecological products, probiotic products, synbiotics and / or postbiotics products.
[0015] In some specific embodiments of the present invention, the microecological products, probiotic products, synbiotic products and / or postbiotic products include, but are not limited to, one or more of the following: pharmaceuticals, food, cosmetics, feed, feed additives or pet food; and / or
[0016] The dosage forms of the microecological products, probiotic products, synbiotic products and / or postbiotic products include, but are not limited to, one or more of the following: powder, granules, capsules, tablets, pills, extracts, liquid preparations, sugar or jelly.
[0017] Fourthly, the present invention also provides the use of the Escherichia coli CP57 or the product thereof in any of the following:
[0018] (I) Preparing products that inhibit the growth of harmful bacteria; and / or
[0019] (II) Preparation of products that regulate the balance of gut microbiota; and / or
[0020] (III) To prepare drugs or preparations for the prevention and / or treatment of diseases.
[0021] In some specific embodiments of the present invention, the harmful bacteria include enteropathogenic bacteria;
[0022] Preferably, the enteropathogenic bacteria include Salmonella;
[0023] The aforementioned flora balance includes, but is not limited to, one or more of the following: gut flora, vaginal flora, skin flora, oral flora, gastric flora, or urinary tract flora; and / or
[0024] The diseases mentioned include those caused by Salmonella infection;
[0025] Preferably, the disease includes one or more of digestive system diseases and / or reproductive system diseases; and / or
[0026] Preferably, the digestive system diseases include, but are not limited to, one or more of the following: diarrhea, irritable bowel syndrome, ulcerative colitis, Crohn's disease, pseudomembranous colitis, diarrhea secondary to pediatric pneumonia, abdominal distension and indigestion, constipation, foul-smelling stool, viral diarrhea, feeding intolerance, and necrotizing enterocolitis.
[0027] Preferably, the reproductive system diseases include, but are not limited to, reproductive system inflammation;
[0028] Preferably, the prevention and / or treatment of the disease includes:
[0029] (i) Relieves weight loss, diarrhea, and / or shortening of the colon caused by Salmonella Typhimurium infection; and / or
[0030] (ii) Reduce the growth of Enterobacteriaceae after Salmonella Typhimurium infection; and / or
[0031] (iii) Reduce Salmonella colonization and / or infection in the body.
[0032] Fifthly, the present invention also provides a medicament or combination of medicaments, comprising any of the following or other active ingredients:
[0033] (a) the Escherichia coli CP57; and / or
[0034] (b) The article.
[0035] This invention provides a porcine-derived probiotic Escherichia coli CP57 strain, its preparation method, and its applications. This strain, isolated from the feces of healthy piglets, exhibits good acid and bile salt tolerance, does not carry virulence factors common in diarrheal Escherichia coli, shows no significant cytotoxicity, and demonstrates good safety. This strain significantly inhibits the growth of Salmonella, alleviates clinical symptoms caused by Salmonella infection in mouse models, and reduces Salmonella levels in mouse feces and bodies. The Escherichia coli CP57 proposed in this invention has the potential to control intestinal pathogenic bacteria infections in livestock and can be used to prepare microecological preparations for the prevention and treatment of intestinal infections in livestock, possessing significant application value.
[0036] Biological Preservation Instructions
[0037] Biological material: CP57; Classification and nomenclature: Escherichia coli, deposited on October 30, 2025, at the China General Microbiological Culture Collection Center, Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 36403. Attached Figure Description
[0038] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.
[0039] Figure 1 The results of PCR identification of Escherichia coli CP57 16S DNA are shown; a positive band is observed at 585 bp.
[0040] Figure 2This shows the acid resistance test results for Escherichia coli CP57;
[0041] Figure 3 This shows the results of the bile salt resistance test for Escherichia coli CP57;
[0042] Figure 4 The results show that the supernatant of Escherichia coli CP57 culture inhibits the growth of Salmonella; * indicates a significant difference between the supernatant treatment group and the LB control group;
[0043] Figure 5 Results of co-culture of Escherichia coli CP57 and Salmonella;
[0044] Figure 6 The results of the CCK8 cytotoxicity assay for Escherichia coli CP57 are shown.
[0045] Figure 7 Show changes in mouse body weight;
[0046] Figure 8 Indicates the dryness or wetness of the stool;
[0047] Figure 9 Indicates the length of the mouse colon;
[0048] Figure 10 This indicates the amount of Salmonella Typhimurium excreted in feces;
[0049] Figure 11 This indicates the bacterial load of Salmonella Typhimurium in spleen tissue;
[0050] Figure 12 This indicates the content of Salmonella Typhimurium in the ileal contents;
[0051] Figure 13 This shows the results of plate counts of Enterobacteriaceae bacteria in feces;
[0052] Figure 14 The results of enterococcal plate counts in feces are shown. Detailed Implementation
[0053] This invention discloses the probiotic Escherichia coli CP57 and its applications. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
[0054] To achieve the above objectives, the present invention adopts the following technical solution:
[0055] The Escherichia coli CP57 of this invention was prepared by the following method: Glycerol-containing bacteria were stored at –80℃ and purified by streaking on LB agar plates. Single colonies were picked and placed in LB liquid medium, and after three generations of activation by shaking culture at 37℃, the culture was used after 6 hours of culture to the logarithmic growth phase.
[0056] This invention uses MacConkey plates to isolate and purify suspected Escherichia coli colonies from the feces of healthy piglets, and identifies them by PCR using the 16S DNA fragment of Escherichia coli.
[0057] This invention demonstrates the probiotic properties of probiotic Escherichia coli CP57 through testing, showing that it has good acid and bile salt resistance, can adapt to the gastrointestinal environment of livestock, and has a good antibacterial effect against Salmonella.
[0058] The present invention demonstrates through safety testing of probiotic Escherichia coli CP57 that this strain does not contain common virulence factors LT, STb, STx, cnf2, and F4, and has low cytotoxicity, thus exhibiting high safety.
[0059] This invention demonstrates in a mouse model experiment using probiotic Escherichia coli CP57 infected with Salmonella that this strain can alleviate clinical symptoms caused by Salmonella infection, as well as the amount of Salmonella excreted in feces, ileal contents, and spleen.
[0060] CP57 represents Escherichia coli CP57 as described in this invention, EcN represents Escherichia coli Nissle 1917, ETEC represents enterotoxin-producing Escherichia coli K88, and S.T represents Salmonella Typhimurium.
[0061] A p-value < 0.05 is considered statistically significant. * P < 0.05, ** P < 0.01, *** P < 0.001. Different letter notations indicate significant differences.
[0062] The probiotic Escherichia coli CP57 provided by this invention and the raw materials and reagents used in its application are all commercially available.
[0063] The present invention will be further illustrated below with reference to the embodiments:
[0064] Example 1: Isolation, purification and identification of Escherichia coli CP57
[0065] The CP57 strain was isolated from the feces of healthy piglets and purified using MacConkey agar plates. The purified strain was stored at -80°C. The purified strain was picked and cultured in LB broth on a shaker (37°C, 180 rpm) to obtain bacterial culture. PCR identification was performed using the *E. coli* 16S DNA gene, with primer sequences F (5'→3' GACCTCGGTTTAGTTCACAG) and R (5'→3' CACACGCTGACGCTGACCA), resulting in a fragment size of 585 bp. The 16S DNA fragment was amplified by PCR, and the PCR product was subjected to 2% agarose gel electrophoresis. A clear band was observed at 585 bp, confirming the isolated strain as *E. coli*, and the strain was designated CP57. Figure 1 ).
[0066] Example 2
[0067] (1) Evaluation of acid resistance of Escherichia coli CP57
[0068] Prepare LB broth medium at pH 2 and sterilize by filtration through a 0.22 μm filter membrane. Adjust the concentration of E. coli CP57 to 1 × 10⁻⁶. 8 CFU / mL. Take a 1.5 mL centrifuge tube, add 100 μL of bacterial suspension and 900 μL of LB broth medium at pH = 2, mix well, and use Escherichia coli Nissle 1917 as the control strain. Take 100 μL of bacterial suspension at 0 min, 30 min, 60 min, and 120 min, and perform serial dilutions. Take 10 μL of bacterial suspension for each dilution and spot it on LB plates for counting. Each dilution is repeated in triplicate, and the survival rate is calculated. Figure 2 ).
[0069] .
[0070] Escherichia coli CP57 still had a survival rate of 18.72% in LB medium at pH = 2 after 120 min (Table 1), while the survival rate of Escherichia coli Nissle 1917 was only 0.11%.
[0071] Table 1
[0072]
[0073] The values in the table represent the mean ± SEM (n = 3), and values in the same row with different lowercase superscripts (a-d) are significantly different (P < 0.05).
[0074] (2) Evaluation of bile salt tolerance of Escherichia coli CP57
[0075] LB broth medium containing 0.6% porcine bile salts was prepared and sterilized by filtration through a 0.22 μm filter membrane. The bacterial culture and experimental procedures were consistent with those described in Example 2. Bacterial samples were collected at 0 h, 2 h, and 4 h. Figure 3 ).
[0076] The results showed that Escherichia coli CP57 had a strong tolerance to bile salts, and its survival rate was still 177.48% after 4 hours of incubation in a medium with a bile salt concentration of 0.6%, indicating that it could adapt well to the digestive tract environment (Table 2).
[0077] Table 2
[0078]
[0079] The values in the table represent the mean ± SEM (n = 3), and values in the same row with different lowercase superscripts (a-d) are significantly different (P < 0.05).
[0080] Example 3
[0081] (1) Evaluation of the ability of Escherichia coli CP57 culture supernatant to inhibit Salmonella
[0082] Preparation of bacterial supernatant: The activated bacterial solution was inoculated 1:100 into LB medium and placed in a shaker at 37°C. It was cultured at 180 rpm for 12 h until the stationary phase. After centrifugation at 8000 rpm for 10 min, the supernatant was collected and filtered through a 0.22 μm filter membrane to obtain the bacterial culture supernatant (CFS). It was stored in a refrigerator at –20°C.
[0083] Microscopic counting adjusted the initial concentration of Salmonella Typhimurium (S.T.) to 1×10⁻⁶. 6 CFU / mL. Add 100 μL of CFS, 20 μL of *Salmonella typhimurium* bacterial suspension, and 80 μL of LB medium to a 96-well plate to a final volume of 200 μL. Incubate the 96-well plate at 37°C for 18 h using a microplate reader. Measure the absorbance at 600 nm every 2 hours, repeating the measurement three times. Use *Escherichia coli* Nissle 1917 as a control strain. Calculate the growth inhibition rate of the culture supernatant against *Salmonella typhimurium* at each time point.
[0084] .
[0085] Two-way ANOVA was performed using GraphPad Prism 10.0 software, and Tukey's multiple comparison test was also performed.
[0086] CP57 culture supernatant significantly inhibited Salmonella growth from 4 to 18 hours. The inhibition rate gradually increased from 0 to 6 hours, reaching a maximum of 31.16% at 6 hours. Tukey's multiple comparison test showed that the antibacterial effect of CP57 was not significantly different from that of Escherichia coli Nissle 1917 at all time points, indicating that CP57 can produce antibacterial substances similar to those of probiotic Escherichia coli Nissle 1917, thus inhibiting Salmonella growth. Figure 4 )
[0087] (2) Co-culture of Escherichia coli CP57 and Salmonella inhibits the growth of Salmonella.
[0088] Inoculate the activated bacterial solution at a 1:100 ratio onto LB medium and incubate for 4 hours until the logarithmic growth phase. Adjust the bacterial concentration to 1×10⁻⁶. 6 CFU / mL, inoculated into the culture medium at a 1:1000 ratio, with a final concentration of 1×10⁻⁶. 3 CFU / mL. The culture ratio was E. coli: Salmonella = 1:1. After co-culturing the two strains for 12 h, the counts were performed using MacConkey plates. Each dilution was repeated three times.
[0089] CP57 significantly inhibited the growth of Salmonella in co-culture, suggesting a possible competitive relationship between CP57 and Salmonella, thus suppressing Salmonella growth. Figure 5 )
[0090] Example 4: PCR detection of Escherichia coli CP57 virulence gene
[0091] The PCR amplification reaction system consisted of: 20 μL of 2 × Taq Master Mix, 1 μL each of forward and reverse primers, 5 μL of ddH2O, and 3 μL of template. The reaction was pre-denatured at 95℃ for 5 min, then denatured at 95℃ for 15 s, followed by annealing at the required temperature for different primers for 15 s, and then extending at 72℃ for 15 s. This was repeated for 30 cycles, with a final extension at 72℃ for 5 min, followed by storage at 4℃. After the reaction, 8 μL of product was collected and separated using 1% agarose gel electrophoresis. The results were observed and analyzed using a gel imaging system.
[0092] The following are the upstream and downstream primers, the specific fragment size amplified, and the annealing temperature used for PCR detection of various virulence factors:
[0093] Table 3
[0094]
[0095] The results showed that Escherichia coli CP57 did not contain the virulence factors: LT, STb, ST2x, eae, cnf2, and F4.
[0096] E. coli CP57 cytotoxicity assay:
[0097] The probiotic *Escherichia coli* Nissle 1917 and enterotoxigenic *Escherichia coli* K88 (ETEC) were used as controls. The test strains were cultured to the logarithmic growth phase, and the bacterial concentration was adjusted to 1 × 10⁻⁶. 8 CFU / mL.
[0098] Porcine small intestinal epithelial cells were seeded at 5000 cells / well in 96-well plates and cultured in a 37°C incubator containing 5% CO2 until the cells reached 80% confluence. The 96-well plates were then removed, the culture medium was discarded, and the cells were washed twice with PBS. 100 μL of bacterial suspension was added according to the multiplicity of infection (Multiple of Infection) (1, 10, 100). The cells were incubated for 6 h, the bacterial suspension was discarded, and the cells were washed twice with PBS. Culture medium containing 10% CCK8 reagent was added, and the cells were incubated for 3 h. The absorbance was measured at 450 nm to calculate cell viability.
[0099] .
[0100] A (dosed): Absorbance of wells containing cells, CCK-8 solution, and E. coli; A (blank): Absorbance of wells containing culture medium and CCK-8 solution but without cells; A (0 dosed): Absorbance of wells containing cells and CCK-8 solution but without E. coli.
[0101] At MOI = 100, ETEC significantly reduced cell viability, while the CP57 group still maintained 98.43% cell viability, showing no significant difference from EcN, indicating lower cytotoxicity. Figure 5 ).
[0102] Example 5: Escherichia coli CP57 alleviates Salmonella infection in mice.
[0103] Resuscitation and culture of Salmonella Typhimurium: The clinical isolate pFPV-mCherry-Salmonella Typhimurium expressing red fluorescent protein, frozen at -80°C, was inoculated onto LB ampicillin-resistant plates (containing 100 μg / mL ampicillin sodium) and incubated overnight at 37°C. The next day, positive colonies (red in color) were picked and inoculated into LB ampicillin-resistant broth (containing 100 μg / mL ampicillin sodium) and incubated overnight in a constant temperature shaking incubator (37°C, 200 rpm). Subsequently, Salmonella Typhimurium was subcultured twice at a 1:100 inoculation ratio, and Salmonella Typhimurium in the logarithmic growth phase (6 h) was used for subsequent experiments.
[0104] Animal grouping and treatment: Eighteen 6-7 week old SPF-grade female C57BL / 6J mice (purchased from Spiford (Beijing) Biotechnology Co., Ltd.) were used. Mice were housed in the animal facility of the Animal Experiment Center of China Agricultural University, with free access to water and a 12-hour light-dark circadian rhythm. The experiment was approved by the Animal Welfare and Animal Experimentation Ethics Review Committee of China Agricultural University (AW22705202-1-01), and all procedures were performed in accordance with relevant animal welfare and ethics regulations. After 3 days of acclimatization, the mice were randomly divided into three groups: the CON group (administered PBS for 11 days), the ST group (administered 20 mg streptomycin for 1 day, followed by PBS for 10 days and then infected with 1 × 10⁻⁶ ppm), and the ST group (administered 20 mg streptomycin for 1 day, followed by PBS for 10 days and then infected with 1 × 10⁻⁶ ppm). 8 CFU (Salmonella Typhimurium), CP57 group (20 mg streptomycin orally for 1 day, E. coli CP57 infection 1 × 10 pcs after 10 days) 8 (CFU Salmonella Typhimurium). The weight of all mice was recorded daily. Fecal samples were collected at 0 h, 8 h, 24 h, 48 h, and 72 h after Salmonella infection to measure fecal dry and wet weight and fecal bacterial load. Mice were anesthetized and euthanized after blood collection. Liver, spleen, colon, and ileum contents were collected for Salmonella selective agar plate counting to determine fecal and tissue bacterial loads.
[0105] Fecal wet-dry weight determination: After recording the weight of a 1.5 mL EP tube, weigh approximately 0.02 g of feces and record the wet weight. Then, place the feces in a constant temperature drying oven for continuous dehydration until the weight change is <1%, at which point drying is stopped, and the weight at this point is recorded as the dry weight. Calculate the fecal wet-dry weight ratio. Mice were fasted during fecal collection and returned to their original cages after collection.
[0106] .
[0107] Determination of Salmonella Typhimurium shedding or loading in feces and tissues: Approximately 0.02 g of feces was weighed into a 1.5 mL EP tube, and the weight was recorded. 1 mL of sterile PBS and 3 3 mm tissue homogenizing beads were added, and the mixture was vortexed repeatedly to obtain a fecal suspension. After euthanizing mice, the contents of the liver, spleen, and ileum were weighed into 1.5 mL EP tubes, and the weight was recorded. 1 mL of sterile PBS and 3 3 mm tissue homogenizing beads were added, and the mixture was homogenized in a tissue homogenizer for 3 min. The fecal suspension and tissue homogenate were serially diluted 10-fold using sterile PBS. 10 μL of each dilution was spotted onto ampicillin-resistant plates (containing 100 μg / mL ampicillin sodium). Each dilution was repeated three times. The plates were incubated overnight at 37°C. After 18 h, the pink colonies on the plates were identified as Salmonella Typhimurium, and they were counted.
[0108] .
[0109] Fecal microbiota plate counting: Enterococci, lactobacilli, Enterobacteriaceae, Bacillus, and Bifidobacteria in feces were counted using Pfizer enterococcus selective medium, MRS agar, MacConkey agar, Bacillus spore agar, and TPY agar. 10 μL of fecal suspension was spotted onto different selective plates, with each dilution repeated three times. TPY and MRS plates were incubated anaerobically at 37°C for 48 h, while MacConkey, Bacillus spore agar, and Pfizer enterococcus plates were incubated aerobically for 24 h. After incubation, colonies on the plates were counted.
[0110] Statistical analyses were performed in GraphPad Prism 10.0. One-way ANOVA was used for univariate experimental data, followed by Tukey post-hoc multiple comparisons; if the parametric test criteria were not met, the Kruskal-Wallis test was used, followed by Dunn post-hoc comparisons. Two-way ANOVA was used for two-way experimental data; based on the interaction test results, if the interaction was significant, a simple effects analysis was performed; otherwise, the main effects of each factor were reported. A p-value < 0.05 was used as the criterion for statistical significance. LOD stands for limit of detection.
[0111] Experimental results:
[0112] (1) CP57 relieves clinical symptoms after Salmonella Typhimurium infection
[0113] Mice maintained a stable body weight with a slight upward trend during CP57 administration. Ten days after CP57 administration, mice were orally infected with Salmonella Typhimurium. The ST group mice experienced a decrease in body weight, and on day three post-infection, their body weight was significantly lower than that of the CON and CP57 groups. Figure 7 P < 0.05. Fecal dry and wet weight can reflect the severity of diarrhea. After Salmonella infection, the fecal dry and wet weight of ST group mice decreased compared with CON group, and remained lower than CON group and CP57 group. At 72 h after infection, it was significantly lower than CP57 protection group. Figure 8 (P < 0.05), the CP57 protection group showed no significant decrease compared to the CON group. Subsequent measurement of colon length in mice revealed that CP57 significantly alleviated the colon length shortening induced by Salmonella Typhimurium infection (P < 0.05). Figure 9 (P < 0.01). These results indicate that CP57 can alleviate symptoms such as weight loss, diarrhea, and shortened colon caused by Salmonella Typhimurium infection.
[0114] (2) CP57 reduces fecal bacterial shedding and in vivo bacterial load in mice infected with Salmonella Typhimurium.
[0115] The fecal bacterial shedding and in vivo bacterial load of Salmonella Typhimurium after infection were detected using LB ampicillin plates. In the ST group, the fecal Salmonella Typhimurium content significantly increased 8 h after challenge and continued to shed bacteria for 72 h post-infection. However, pre-feeding with CP57 significantly reduced the fecal Salmonella Typhimurium bacterial load from 24 to 72 h post-infection. Figure 10 (P < 0.05). Similarly, CP57 significantly reduced the Salmonella Typhimurium load in the spleen and ileum contents (P < 0.05). Figure 11 , Figure 12 P < 0.05. Fecal samples were plate-counted 72 h post-infection using different culture media. Compared to the CP57 protection group, the ST group showed a significant increase in Enterobacteriaceae counts. Figure 13 P < 0.05. Compared with the CON group, the number of Enterococci in the ST group was significantly decreased, while there was no significant change in the CP57 protection group. Figure 14 (P < 0.05). These results indicate that CP57 can reduce the growth of Enterobacteriaceae after Salmonella Typhimurium infection and reduce Salmonella colonization and infection in mice.
[0116] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. Escherichia coli CP57, characterized in that, Its accession number is CGMCC No.36403.
2. The *Escherichia coli* CP57 as described in claim 1, characterized in that, This includes one or more of its live bacteria, inactivated bacterial cells, fermentation broth, exosomes, or metabolites.
3. The *Escherichia coli* CP57 as described in claim 1 or 2, characterized in that, It is resistant to acid and / or bile salts and does not carry virulence factors of diarrheal Escherichia coli.
4. The use of Escherichia coli CP57 as described in any one of claims 1 to 3 in the preparation of microecological products, probiotic products, synbiotics and / or postbiotic products.
5. The application as described in claim 4, characterized in that, The microecological products, probiotic products, synbiotic products, and / or postbiotic products include, but are not limited to, one or more of the following: pharmaceuticals, food, cosmetics, feed, feed additives, or pet food; and / or The dosage forms of the microecological products, probiotic products, synbiotic products and / or postbiotic products include, but are not limited to, one or more of the following: powder, granules, capsules, tablets, pills, extracts, liquid preparations, sugar or jelly.
6. The product, characterized in that, Including Escherichia coli CP57 as described in any one of claims 1 to 3; The products include microecological products, probiotic products, synbiotics and / or postbiotics products.
7. The article of claim 6, characterized in that, The microecological products, probiotic products, synbiotic products, and / or postbiotic products include, but are not limited to, one or more of the following: pharmaceuticals, food, cosmetics, feed, feed additives, or pet food; and / or The dosage forms of the microecological products, probiotic products, synbiotic products and / or postbiotic products include, but are not limited to, one or more of the following: powder, granules, capsules, tablets, pills, extracts, liquid preparations, sugar or jelly.
8. The use of Escherichia coli CP57 as described in any one of claims 1 to 3 or the article as described in claim 6 or 7 in any of the following: (I) Preparing products that inhibit the growth of harmful bacteria; and / or (II) Preparation of products that regulate the balance of gut microbiota; and / or (III) To prepare drugs or preparations for the prevention and / or treatment of diseases.
9. The application as described in claim 8, characterized in that, The harmful bacteria include enteropathogenic bacteria; Preferably, the enteropathogenic bacteria include Salmonella; The aforementioned flora balance includes, but is not limited to, one or more of the following: gut flora, vaginal flora, skin flora, oral flora, gastric flora, or urinary tract flora; and / or The diseases mentioned include those caused by Salmonella infection; Preferably, the disease includes one or more of digestive system diseases and / or reproductive system diseases; and / or Preferably, the digestive system diseases include, but are not limited to, one or more of the following: diarrhea, irritable bowel syndrome, ulcerative colitis, Crohn's disease, pseudomembranous colitis, diarrhea secondary to pediatric pneumonia, abdominal distension and indigestion, constipation, foul-smelling stool, viral diarrhea, feeding intolerance, and necrotizing enterocolitis. Preferably, the reproductive system diseases include, but are not limited to, reproductive system inflammation; Preferably, the prevention and / or treatment of the disease includes: (i) Relieves weight loss, diarrhea, and / or shortening of the colon caused by Salmonella Typhimurium infection; and / or (ii) Reduce the growth of Enterobacteriaceae after Salmonella Typhimurium infection; and / or (iii) Reduce Salmonella colonization and / or infection in the body.
10. A drug or combination of drugs, characterized in that, Includes any of the following or any other active ingredients: (a) Escherichia coli CP57 as described in any one of claims 1 to 3; and / or (b) The article of claim 6 or 7.