Klebsiella capable of degrading thifensulfuron methyl and simultaneously promoting plant growth

Abstract

The invention belongs to the technical field of environmental microorganisms, and provides Klebsiella capable of degrading thifensulfuron methyl and simultaneously promoting plant growth, the Latin of the Klebsiella is Klebsiella sp., the preservation name is Klebsiella sp. HDJY-1, the preservation place is China Center for Type Culture Collection, the preservation date is November 17, 2025, and the preservation number is CCTCC NO: M 20252578. The strain has excellent low temperature resistance and alkali resistance, not only can grow and propagate by taking thifensulfuron methyl as a unique carbon source and energy, but also can secrete plant growth-promoting substances such as indoleacetic acid and the like, and has a nitrogen fixation function. Therefore, the strain provided by the invention not only can remarkably promote plant growth and improve nutrient absorption efficiency so as to improve plant biomass and agricultural product quality, but also can provide an excellent strain resource for thifensulfuron methyl pollution remediation of farmland soil.

Description

Technical Field

[0001] This invention relates to the field of environmental microbiology, and in particular to a Klebsiella pneumoniae bacterium that can degrade thifensulfuron while promoting plant growth. Background Technology

[0002] Sulfonylurea herbicides are a class of highly effective, low-toxicity, and selective chemical herbicides widely used in modern agricultural production. Thifensulfuron-methyl (TSM), in particular, is widely used for controlling broadleaf weeds in wheat, corn, and soybean fields due to its excellent herbicidal activity and low application rate. However, thifensulfuron-methyl easily leaves residues in the soil after application. Its high water solubility and strong leaching properties give it high migration capacity and a long environmental retention time. Especially under continuous cropping or crop rotation systems, the residues of this type of compound can easily cause phytotoxicity to subsequent crops. Sugar beets are extremely sensitive to sulfonylurea herbicides; even low concentrations of residue can lead to reduced emergence rates, inhibited growth, chlorosis of leaves, and even severe yield reduction.

[0003] Furthermore, the long-term accumulation of sulfonylurea compounds such as thifensulfuron can disrupt the soil microecological balance, inhibit the activity of indigenous microorganisms, affect nitrogen cycling and carbon metabolism, and consequently impair soil fertility and ecological functions. Their persistent presence in the ecosystem can also lead to bioaccumulation through the food chain, posing a potential threat to environmental safety and human health. Therefore, how to efficiently and safely remove thifensulfuron residues from agricultural soils has become a key scientific issue for agricultural environmental governance and sustainable production.

[0004] While existing physicochemical remediation methods (such as adsorption, chemical oxidation, and photolysis) can remove pollutants to some extent, they generally suffer from drawbacks such as high energy consumption, high cost, and potential secondary pollution. In contrast, microbial degradation technology, due to its green, economical, and eco-friendly characteristics, has become one of the ideal approaches for controlling pesticide residue pollution. By screening microorganisms with specific metabolic capabilities, efficient biotransformation and mineralization of recalcitrant organic pollutants such as thifensulfuron can be achieved, thereby realizing the ecological purification of pollutants in the environment.

[0005] Therefore, developing a composite functional microbial strain that combines highly efficient thifensulfuron degradation capabilities with plant growth-promoting functions is crucial. This would not only effectively remove thifensulfuron residues from farmland soil and restore the balance of the soil ecosystem, but also significantly promote crop growth and quality improvement. This has significant scientific implications and broad application prospects for achieving green agricultural development and ecological restoration. However, current technologies lack corresponding microbial strains. Therefore, there is an urgent need in this field for a composite functional microbial strain with high degradation efficiency, stable growth-promoting effects, strong environmental adaptability, and the ability to colonize and reproduce in farmland soil. This would overcome the technical bottleneck of single-function strains having limited effectiveness in practical applications and failing to simultaneously achieve the dual goals of soil remediation and crop yield increase, providing a practical solution for pesticide residue control and green agricultural production. Summary of the Invention

[0006] The purpose of this invention is to provide a Klebsiella strain capable of degrading thifensulfuron-methyl while simultaneously promoting plant growth. Addressing the problems of thifensulfuron-methyl in farmland soil, including its tendency to remain in soil, high migration rate, long degradation cycle, and potential phytotoxicity to subsequent crops (especially sugar beets), this invention provides a composite functional microbial strain with highly efficient thifensulfuron-methyl degradation capabilities and plant growth-promoting functions. This invention obtains a Klebsiella strain through screening, isolation, and identification. Klebsiella This strain (sp. strain HDJY-1) can not only grow using thifensulfuron as its sole carbon and energy source, but also secrete plant growth-promoting substances such as indoleacetic acid (IAA) and possess nitrogen-fixing capabilities. Through application in the plant rhizosphere environment, it can simultaneously achieve the biodegradation of thifensulfuron residues in farmland and promote plant growth, thereby remediating contaminated soil, improving crop growth, and increasing yield, demonstrating significant ecological and economic benefits.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a Klebsiella pneumoniae strain, the Latin name of which is... Klebsiella sp., the collection name is Klebsiella sp.HDJY-1, deposited at the China Center for Type Culture Collection, on November 17, 2025, with accession number CCTCC NO: M 20252578.

[0008] The present invention also provides the application of the Klebsiella pneumoniae in the degradation of thifensulfuron-methyl.

[0009] The present invention also provides the application of the aforementioned Klebsiella pneumoniae in promoting plant growth.

[0010] Preferably, the plant is a sugar beet.

[0011] The present invention also provides a bacterial agent containing the aforementioned Klebsiella pneumoniae.

[0012] The present invention also provides a method for preparing the bacterial agent, comprising the following steps: inoculating the Klebsiella pneumoniae in a culture medium containing thifensulfuron-methyl and culturing it for 72-96 hours.

[0013] Preferably, the culture medium is an inorganic salt liquid culture medium containing thifensulfuron, wherein the concentration of thifensulfuron in the culture medium is 10~300 mg·L. -1 .

[0014] Preferably, the inorganic salt liquid culture medium is formulated as follows: K₂HPO₄·3H₂O 0.5~1.5 g·L⁻¹ -1 MgSO4·7H2O 0.2~0.6 g·L -1 NaCl 0.5~1.5 g·L -1 CaCl2·2H2O 0.05~0.09 g·L -1 , FeCl3·6H2O 0.005~0.015 g·L -1 and NH4Cl 0.5~1.5 g·L -1 The pH of the inorganic salt liquid culture medium is 6-8.

[0015] Preferably, the culture temperature is 15~45℃, the culture pH is 4~10, and the culture rotation speed is 100~150 rpm.

[0016] The beneficial effects of this invention are as follows: Compared with existing technologies, this invention has significant technical advantages and application effects. First, the HDJY-1 strain provided by this invention possesses highly efficient thifensulfuron degradation capabilities, enabling it to grow using thifensulfuron as its sole carbon source. It exhibits a high degradation rate and strong environmental adaptability, significantly shortening the residual period of thifensulfuron in the soil, thereby effectively reducing the risk of phytotoxicity to subsequent crops. Second, this strain possesses the dual functions of pollutant degradation and plant growth promotion. In addition to efficiently degrading herbicides, it can secrete plant growth-promoting substances such as indoleacetic acid (IAA) and has nitrogen-fixing capabilities, achieving a synergistic effect between soil pollution remediation and plant growth promotion. Simultaneously, the HDJY-1 strain exhibits broad environmental adaptability, maintaining high physiological activity and degradation performance across a wide temperature and pH range, making it suitable for different regions and various farmland ecological conditions, offering high application flexibility. Furthermore, the bioremediation method of this strain is eco-friendly and highly safe, avoiding the drawbacks of traditional physical or chemical remediation methods such as high energy consumption, high cost, and the risk of secondary pollution, aligning with the technological orientation of green agriculture and sustainable development. Finally, the HDJY-1 strain has good potential for industrial application and can be used to prepare microbial agents, biofertilizers or environmental remediation agents. It has broad prospects for promotion and significant economic value in the fields of herbicide residue management in farmland, crop yield increase and ecological restoration.

[0017] Preservation Instructions

[0018] Klebsiella pneumoniae, the Latin name of which is... Klebsiella sp., the collection name is Klebsiella sp.HDJY-1, deposited at the China Center for Type Culture Collection, Wuhan University, Wuhan, China, on November 17, 2025, with accession number CCTCC NO: M 20252578. Attached Figure Description

[0019] Figure 1 This is a colony morphology diagram of the HDJY-1 strain of the present invention on a solid plate; Figure 2 This is a phylogenetic tree diagram of the 16S rRNA of the HDJY-1 strain of this invention; Figure 3 The growth characteristics of the HDJY-1 strain of this invention under different concentrations, pH values, and temperatures; Figure 4 This invention demonstrates the degradation ability of the HDJY-1 strain at different concentrations, pH levels, and temperatures. Figure 5 This invention demonstrates the promoting effect of the HDJY-1 strain on beet growth. Detailed Implementation

[0020] This invention provides a Klebsiella pneumoniae strain, the Latin name of which is... Klebsiella sp., the collection name is Klebsiella sp.HDJY-1, deposited at the China Center for Type Culture Collection, on November 17, 2025, with accession number CCTCC NO: M 20252578.

[0021] The present invention also provides the application of the Klebsiella pneumoniae in the degradation of thifensulfuron-methyl.

[0022] The present invention also provides the application of the aforementioned Klebsiella pneumoniae in promoting plant growth.

[0023] In this invention, the plant is preferably a beet.

[0024] The present invention also provides a bacterial agent containing the aforementioned Klebsiella pneumoniae.

[0025] The present invention also provides a method for preparing the bacterial agent, comprising the following steps: inoculating the Klebsiella pneumoniae in a culture medium containing thifensulfuron-methyl and culturing it for 72-96 hours.

[0026] In this invention, the culture time is further optimized to 84 hours, and the culture medium is preferably an inorganic salt liquid culture medium containing thifensulfuron, wherein the concentration of thifensulfuron in the culture medium is preferably 10-300 mg·L⁻¹. -1 More preferably 10~100 mg·L -1 More preferably 50 mg·L -1 .

[0027] In this invention, the preferred formulation of the inorganic salt liquid culture medium is: K₂HPO₄·3H₂O 0.5~1.5 g·L⁻¹ -1 MgSO4·7H2O 0.2~0.6 g·L -1 NaCl 0.5~1.5 g·L -1 CaCl2·2H2O 0.05~0.09 g·L -1 , FeCl3·6H2O 0.005~0.015 g·L -1 and NH4Cl 0.5~1.5 g·L -1 Further preferred: K2HPO4·3H2O 1g·L -1 MgSO4·7H2O 0.4 g·L -1 NaCl 1 g·L -1 0.07 g·L CaCl2·2H2O -1 FeCl3·6H2O 0.01 g·L -1and NH4Cl 1 g·L -1 The pH of the inorganic salt liquid culture medium is preferably 6-7, and more preferably 6.5.

[0028] In this invention, the culture temperature is preferably 15~45℃, more preferably 20~35℃, and even more preferably 30℃; the culture pH is preferably 4~10, more preferably 6~8, and even more preferably 7; and the culture rotation speed is preferably 100~150 rpm, and even more preferably 125 rpm.

[0029] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0030] Example 1 Screening and Identification of Strains HDJY-1

[0031] 1. Source of microbial strains

[0032] From experimental corn fields at the Hulan Campus of Heilongjiang University in Harbin, Heilongjiang Province, where thifensulfuron-methyl herbicide has been used for a long period of time and continuously, 500 g of soil surface samples (0-20 cm) were taken and placed in sterilized waterproof paper bags and stored in a refrigerator at 4°C.

[0033] 2. Isolation and purification of strains

[0034] Take 150g of soil sample and place it in a 250mL Erlenmeyer flask. Add an appropriate amount of distilled water and place it on a shaker at 125 rpm and 35℃ for 30 min. After standing for 30 min, take 3 mL of the supernatant and transfer it to a sterile inorganic salt medium containing 50 mL. Add 10 mg·L⁻¹ of water. -1 Thifensulfuron was enriched using a gradient pressure acclimatization method, gradually increasing the concentration of thifensulfuron, ultimately reaching 50 mg / L. -1 Thifensulfuron-methyl was inoculated into an inorganic salt solid culture medium using the plate method. After the bacteria grew, the bacterial solution at the optimal dilution was spread on plates for subculturing. Colonies of different shapes and colors were picked and purified repeatedly until single colonies appeared. Finally, a thifensulfuron-methyl degrading bacterium named HDJY-1 was successfully screened.

[0035] Formula for inorganic salt culture medium: K2HPO4·3H2O: 1 g·L -1 MgSO4·7H2O: 0.4 g·L -1 NaCl: 1 g·L -1 CaCl2·2H2O: 0.07 g·L -1 FeCl3·6H2O: 0.01 g·L -1 NH4Cl: lg·L -1pH=7.0; Formula for inorganic salt solid culture medium: Add 3 g·L to the basic inorganic salt culture medium formula. ‐1 Agar was obtained by sterilizing both culture media at 121°C for 30 min and then cooling to room temperature.

[0036] 3. Identification of HDJY-1 strain

[0037] (1) Morphological observation of the strain

[0038] Add 3 g·L to the inorganic salt culture medium formula. ‐1 Agar powder was used to adjust the pH to 7.0, and the medium was sterilized at 121°C for 30 minutes to obtain an inorganic salt solid culture medium. After the medium cooled to approximately 50°C, thifensulfuron stock solution was aseptically added in a laminar flow hood to bring the final concentration of thifensulfuron in the inorganic salt solid culture medium to 50 mg·L⁻¹. -1 After mixing, invert the plate. Place the plate in a 30℃ incubator and incubate in the dark for 72 h. The colonies are round, regular, smooth, and approximately white in color. Figure 1 ).

[0039] (2) Physiological and biochemical indicators

[0040] The determination of catalase, starch hydrolysis test, methyl red test, VP test, gelatin hydrolysis test, and utilization tests of citrate were all conducted in accordance with the "Handbook for Systematic Identification of Common Bacteria".

[0041] Physiological and biochemical assays of strain HDJY-1 showed that it was Gram-negative, but positive for urase, glycolysis, gelatin liquefaction, litmus milk, VP, and citrate tests, and negative for starch hydrolysis and methyl red tests. The results of its physiological and biochemical identification are shown in Table 1.

[0042] Table 1 Physiological and biochemical characteristics of strain HDJY-1

[0043] (3) Molecular biological identification

[0044] After extracting genomic DNA from the isolated strain, polymerase chain reaction (PCR) amplification was performed using universal primers 27F (AGAGTTTGATCCTGGCTCAG, SEQ ID NO. 1) and 1492R (TACGGCTACCTTGTTACGACTT, SEQ ID NO. 2) for bacterial 16S rDNA. The PCR reaction system was prepared according to standard methods, and the amplification program was set as follows: pre-denaturation at 96℃ for 5 min; followed by 35 cycles, each cycle including denaturation at 96℃ for 30 s, annealing at 56℃ for 30 s, and extension at 72℃ for 1 min; finally, a final extension at 72℃ for 5 min was performed to complete the reaction. The amplified products were detected by 1% agarose gel electrophoresis, and the results showed that the fragment size was consistent with the expectation, indicating that the amplification results were correct. The purified PCR products were sent to a professional sequencing institution for sequencing analysis. The obtained 16S rDNA sequence was submitted to the National Center for Biotechnology Information (NCBI) database for BLAST homology comparison to determine the systematic taxonomic position of the strain. The comparison results showed that this strain was similar to Klebsiella spp. Klebsiella The sequence similarity of this strain (sp.) was the highest, with sequence homology exceeding 99%; the 16S rDNA sequence of this strain has been registered in GenBank, accession number PX500225. To further validate the classification results, a phylogenetic tree was constructed using MEGA 11.0 software based on the neighbor-joining method. Phylogenetic analysis showed that this strain clustered with representative strains of the genus Klebsiella in the same branch, indicating a close evolutionary relationship, as shown in the phylogenetic tree below. Figure 2 As shown.

[0045] Example 2: Growth of HDJY-1 strain under different environmental factors

[0046] 1. Effects of different thifensulfuron concentrations on the growth of HDJY-1 strain

[0047] Different thifensulfuron concentrations (10 mg·L) were set up. -1 25 mg·L -1 50 mg·L -1 100 mg·L -1 200 mg·L -1 300 mg·L -1 Inorganic salt liquid culture medium was inoculated with 1% (v / v) HDJY-1 bacterial suspension and cultured with shaking at 30℃ and 125 rpm. Samples were taken periodically within 0–84 h to measure OD. 600 The values ​​were used to analyze the growth of the strain at different concentrations of thifensulfuron.

[0048] 2. Effects of different pH values ​​on the growth of strain HDJY-1

[0049] In a concentration of 50 mg·L -1 Inoculate 1% (v / v) bacterial suspension into an inorganic salt liquid medium containing thifensulfuron-methyl, and use 1 mol·L⁻¹ water. -1 The pH of the inorganic salt liquid culture medium was adjusted to 4, 5, 6, 7, 8, 9, and 10 respectively using HCl or NaOH solutions. The medium was then incubated with shaking at 30℃ and 125 rpm. Each group was divided into three replicates. Samples were taken periodically within 0–84 hours, and OD values ​​were measured. 600 The pH value was used to assess the effect of pH on the growth of the strain.

[0050] 3. Effects of different temperatures on the growth of HDJY-1 strain

[0051] In a concentration of 50 mg·L -1 Inoculate 1% (v / v) bacterial suspension (OD) into an inorganic salt liquid medium containing thifensulfuron at a concentration of [missing value]. 600 =1), pH 7, and incubated at 15, 20, 25, 30, 35, 40, and 45℃ with shaking at 125 rpm. Each group had three replicates, and samples were taken periodically within 0–84 hours to measure OD. 600 Values ​​were used to assess the effect of temperature on the growth of the strain.

[0052] The growth characteristics of the experimental results are as follows: Figure 3 As shown, the strain exhibits broad environmental adaptability and can thrive at pH 7, temperature 30℃, and concentration 50 mg·L⁻¹. -1 The growth activity was best in thifensulfuron.

[0053] Example 3: Degradation capacity of HDJY-1 strain for thifensulfuron under different environmental conditions

[0054] Under the aforementioned environmental conditions, the strain was cultured at 125 rpm for 84 h, and the residue of thifensulfuron was determined. After cultivation, samples were taken and pretreated using organic solvent extraction combined with rotary evaporation. After filtration, the residue of thifensulfuron in the system was determined by high-performance liquid chromatography (HPLC), and the degradation rate was calculated based on the changes in initial and residual concentrations. The results showed that strain HDJY-1 could reduce the residue of thifensulfuron at 10 mg·L⁻¹ within 84 h. -1 Thifensulfuron can be completely degraded, at 50 mg·L⁻¹. -1 The degradation rate reached 86.35%, demonstrating strong thifensulfuron degradation ability. The degradation trends under different environmental conditions are as follows: Figure 4 As shown in the figure, the results indicate that the strain maintains high degradation activity over a wide range of temperature and pH, demonstrating its good environmental adaptability and stable biodegradation performance.

[0055] Example 4: Transcriptome sequencing of HDJY-1 strain

[0056] Collect cells in the logarithmic growth phase of both single strains and strains supplemented with thifensulfuron, collecting at least 10 mL of OD from each sample. 600 The bacterial culture with a concentration of 1 was centrifuged and enriched, and the supernatant was discarded. Total RNA was extracted from the precipitate. The concentration and purity of the extracted RNA were detected using Nanodrop (Thermo Scientific, NC2000), and its integrity was verified by agarose gel electrophoresis. Subsequently, the qualified RNA samples were purified by cDNA synthesis and PCR amplification, and then the transcriptome was sequenced by Majorbio Co., Ltd. using the Illumina Hiseq platform. The sequencing results showed that the HDJY-1 strain contained a variety of functional genes related to plant growth promotion, including genes related to the indoleacetic acid (IAA) synthesis pathway, nitrogen fixation, and siderophore-related genes. However, after the addition of thifensulfuron-methyl, the expression of these genes was not affected, and the promotion of gene expression was only related to genes related to the IAA synthesis pathway and nitrogen fixation. These results indicate that the HDJY-1 strain not only has the ability to degrade organic pollutants but also has an intrinsic basis for the expression of plant growth-promoting genes, providing a molecular-level theoretical basis for its application in agricultural ecological restoration.

[0057] Example 5: Determination of IAA production capacity of HDJY-1 strain

[0058] Qualitative determination: The Salkowski colorimetric method was used to determine the bacterial secretion of IAA. The activated strain was adjusted to OD using sterile distilled water. 600 With a value of 1, the isolated endophytic bacteria were inoculated at a concentration of 1% (v / v) into a solution containing 100 mg·L⁻¹. -1 In L-tryptophan culture medium, each treatment was repeated three times. The same amount of sterile water was added to the L-tryptophan-containing culture medium as a control. The mixture was placed in a shaker at 30°C and fermented at 150 rpm for 24 h. After the reaction, the mixture was centrifuged at 12000 rpm for 3 min. 4.5 g of FeCl3 was dissolved in 1 L of 10.8 mol·L⁻¹ broth. -1 Prepare a Salkowski colorimetric solution using concentrated sulfuric acid. Take 2 mL of the supernatant and add 2 mL of Salkowski colorimetric solution. Let the solution stand in the dark for 30 min to react.

[0059] Functional validation further confirmed that this strain can produce IAA and has growth-promoting ability (Table 2).

[0060] Table 2. Genes related to growth-promoting function in strain HDJY-1

[0061] SEQ ID NO .3:

[0062] SEQ ID NO .4:

[0063] SEQ ID NO .5: ATGGAACGCTATGAGACGCTGTTTGCCCAACTGAAAAATCGCCAGGAAGGCGCCTTCGTTCCCTTTGTCACCCTTGGCGATCCGGGACCGGAGCAGTCGCTCAAAATTATCGATGCGCTGATCGAAGGCGGCGCCGATGCCCTTGAGCTGGGGATCCCTTTCTCCGACCCGCTGGCGGACGGCCCGACCATTCAGGGCGCGGCCCTGCGCGCCTTCGCCGCGGGAGTGACCCCGGCGCAGTGCTTTGAGATGCTGGCGGCGATCCGCCAGAAGCATCCGACCATCCCAATCGGCCTGCTGATGTACGCCAACCTCGTCTTCAGCCCGGGCATCGATGCGTTCTATGCCCAGTGCGCCCGCGTCGGCGTCGACTCGGTGCTGGTGGCCGACGTGCCGGTGGAAGAGTCCGCCCCGTTCCGCCAGGCGGCGATGCGCCATAACATCGCGCCGATTTTCATCTGCCCGCCCAATGCGGATGACGATTTACTGCGCCAGATTGCTTCTTATGGCCGCGGCTACACCTATCTGCTGTCGCGCGCCGGAGTGACGGGTGCGGAAAATCGCGCCGCACTGCCGCTGCACCACCTGGTGGAGAAGCTGGCGGAATATCACGCCGCGCCGCCGCTGCAGGGCTTTGGTATCTCCGCGCCGGAGCAGGTGAGCGCCGCCATTGACGCCGGGGCCGCCGGGGCTATCTCCGGTTCCGCCATCGTCAAAATCATCGAACGCCACCTCGATGAGCCGCAGACCATGCTCGACGAACTGAAAGCCTTCGTCCAGAGCCTGAAGGCGGCGACCAAAACCGCCTGA。

[0064] SEQ ID NO .6:

[0065] SEQ ID NO .7:

[0066] SEQ ID NO .8:

[0067] SEQ ID NO .9:

[0068] SEQ ID NO .10: ATGTGGAACTACTCCGAGAAAGTGAAAGACCATTTTTTTCATCCCCGCAACGCGCGCGTGGTCGACAACGCCAACGCGGTGGGCGATGTGGGTTCATTAAGCTGCGGCGATGCGCTGCGCCTGATGCTGCGGGTTGATCCGCAGACCGAGATCATCGAGGAGGCGGGCTTCCAGACCTTCGGCTGCGGCAGCGCCATCGCCTCCTCTTCCGCGCTGACGGAGCTGATTATCGGCCACACCCTGACCGAAGCCGGGCAGATCACCAACCAGCAGATCGCCGACTACCTCGACGGTCTGCCGCCGGAAAAAATGCACTGCTCGGTGATGGGCCAGGAAGCGCTGCGTGCGGCCATCGCCCATTTTCGCGGCGAAAGCCTTGAGGAGGAGCATGAGGAGGGCAAGCTGATCTGTAAGTGCTTCGGCGTCGACGAAGGGCATATTCGCCGGGCCGTGGTGAACAATGGCCTGACCACCCTCGAGGAAGTGATCAACTACACCAAAGCCGGCGGCGGCTGCACCGCCTGCCATGAAAAAATTGAGCTGGCGCTGGCGGCGATCCTCGCCCAACAGCCGCCAGCCCCCCTGCCGGTGGAGACGGCCCACGATGCGCACTGGCAAAGCGTGGTCGATACCATCAACGAACTGCGCCCGCACATTCAGGCCGACGGCGGCGACATGACGTTGCTCAACGTCACCCCGCGTCAGGTGACCGTCAGCCTCTCCGGCAGCTGCAGCGGCTGCATGATGACCGACATGACCCTCGCCTGGCTGCAGCAAAAGCTGATGGAGCGTACCGGAACTTACATGGACGTGGTGGCGGCCCCGGCCGCGGTTAACTAA。

[0069] SEQ ID NO .11: ATGCCCATCGTGATTTTCCGTGAGCGCGGCGAGGCGCTGTATGCCTATATCGCCAAACAGGATCTGGAGGCCCGGGTGCTCCAGGTCGAACATGACGAGACGGACCGCTGGGGCGGCGCGATTGCCCTCGAAGGGGGACGTCGCTACTACGTCAATCCGCAGCCGGGGCGACCCGTCTTCCCGATAAGCCTGCGCGCCACTCGCAGCACGCTGCTATAA。

[0070] SEQ ID NO .12: ATGGCGCCGGTCGACTGGTTGACCCGCCTGTGGCGATTGTATCACGCCGGAAAAGGCTGCTTTCCGCTGCGGATGGGGCTGACTCCCGCGGCATGGCGGTCGCTGCAGCAGCGGCTGGGCGAGGTGGCGACGCCGCTGGACAGCGCGACGCTGAGCCGCCGTCGGCTGATGACCGAGCTGAATGCTACCCGCGACGAAGAGCGTCGGCAGCTGGGGCAGTGGCTGACGGAGTGGATGGCGCCGGGGGCCGAACCGATGGCGCAGATCGTCGCCGAGGTAGCGCTGGCGTTTAACCATCTGTGGGAGGATCTGGGACTCGATTCGCGGGCGGAACTGGGCCGGCTGATGAGCGACTGCTTTCCACTGCTGGTGGTGCAGAACGTCCACCATATGCGCTGGAAAAAGTTCTTTTACCGCCAGCGCTGCCTGCAATCGCAGGGGGAGATTGTCTGCCGATCGCCAAGCTGCGACGAGTGCCTGGAGCGCAGCCTCTGCTTCGAACCGCCGCCGATATAA。

[0071] SEQ ID NO .13: ATGAGACCCCGATTTACCTTTAGCGAAGCGGTCCGCGTCGTGCGCGCCATCCGTAACGATGGCACCTATGCGGGCCTGCCGTCCGGCGCCCTGCTGGTGCGCCGGGGCAGCATCGGCTATGTCCGCGACTGGGGAGTATTCTTGCAGGACCAGATCATCTACCAGATCCACTTCCCGGACTGCGACCGGGTGGTCGGCTGTCGCGAACAGGAGCTGATTGCCGGCGATCGGCCCTGGCTGGCCGGCAATCTGCAGTATGGCGATAGCGTAATCTGTCAGACGGCGCTGGCGATGCAGGGCGAGATGGTGGTCAGCGTAGGTCAGTTGGGGCGCATCGAAGCCACCGACCGGGGCGAGCATGGCGACGGCTATATCGTCGACTTCGGCGGCCGCTGGTTCCAGGTCCCGGTAAGCGCGCTGGCGCTGGCAGAGGAGGAAGAATAA。

[0072] SEQ ID NO .14: ATGCCGCCCATTAATCGTCAGTTTGATATGGTCCACGCCGACGAGTGGTCGATGAAAGTCGCCTTCGCCAGCTCCGATTACCGCCACGTCGATCAGCATTTCGGCGCCACGCCGCGGCTGGTGGTCTACGGCGTCAAAGCCGACCGGGTCACCCTGCTGCGGGTGGTGGAGTTCCCGGTCGCCAGCGGTCACCAGACCGAGAAGATAGCCGAGCGCATCCACGCCCTTGAGGATTGCGTCACCCTGTTCTGCGTGGCGATTGGCGAGGCGGTTTTTCGCCAGCTGCTGCAGGTGGGCGTCCGCGCCGAACGCGTCCCTGACCAGACCACCATCCTCGGCTTGCTGCAGGAGATCCAACTCTCCTGGTATGAAAAAGCGCAGCGCCGCAGCGCGCGGCAACGCGATCCGCAGCGCTTTAACCGCCTGCTGGAGGAGCCGGCGTGGCGGGAGGAGCCCGACCCGCTCCCCTGA。

[0073] SEQ ID NO. 15: ATGGAGTGGTTTTATCAGATCCCCGGCGTGGGCGACCTGCGCTCCGCCGATGCGTTCTTTCAGTTTTTCGCCGTTCCCTATCAGCCCGAGCGCCTGGCGCACTGCAGCCTGCCGGTGCTGGCCACCTTT CACCGCAAGCTGAAGGCGGAAGTGCCTCTGCTCAACCAGCTGGAGGATAACCCGCGCGCACTGGCTGCTGGCGCGCCGACTGCTGGCGGAGAGTTATCAGCAACAGTTCGAGGAGAACACGCCATGA.

[0074] Example 6: Determination of nitrogen fixation capacity of HDJY-1 strain

[0075] Qualitative determination: HDJY-1 bacteria were streaked onto Ashby solid plates and incubated at 28°C for 7 days. Strains that could grow normally on the culture medium and form smooth, transparent white colonies similar in color to the culture medium had nitrogen-fixing ability.

[0076] Ashby solid culture medium formula: potassium dihydrogen phosphate 0.2 g·L -1 Magnesium sulfate 0.2 g·L -1 Sodium chloride 0.2 g·L -1 0.02 g·L of calcium chloride -1 Mannitol 10.0 g·L -1 0.1 g·L⁻¹ calcium sulfate -1 ; Agar 15.0 g·L -1 .

[0077] Nitrogen fixation capacity test results are as follows Figure 5 As shown in Table 3, functional validation further confirmed the growth-promoting ability of this strain. Despite the suppression of some functional gene expression in the pollutant treatment group (TSM), the strain still possessed nitrogen fixation ability, demonstrating its potential for plant growth promotion.

[0078] Table 3

[0079] Note: CK is the blank control group, and TSM is the thifensulfuron-methyl treatment group.

[0080] Example 7: Application of HDJY-1 strain in promoting plant growth

[0081] To verify the growth-promoting effect of strain HDJY-1 on sugar beets, the following two treatment groups were set up: Control group (CK): 300 mL of half-concentration Hoagland nutrient solution was added to each pot; Treatment group (HDJY-1): On the basis of an equal volume of half-concentration Hoagland nutrient solution, 1% (v / v) HDJY-1 bacterial suspension was inoculated.

[0082] The bacterial suspension was prepared as follows: HDJY-1 strain was inoculated into LB liquid medium and cultured with shaking at 30℃ and 150 rpm until the logarithmic growth phase (OD200). 600 =1.0), centrifuge to collect bacterial cells, resuspend in sterile physiological saline and adjust to the target concentration.

[0083] The experimental results are shown in the figure below. Figure 5 As shown, compared with the CK group, the germination rate and plant height of sugar beets in the HDJY-1 treatment group were significantly improved, indicating that this strain has a significant promoting effect on sugar beet growth.

[0084] As can be seen from the above embodiments, the present invention provides a Klebsiella pneumoniae that can degrade thifensulfuron while promoting plant growth. The Latin name of the Klebsiella pneumoniae is... Klebsiella sp., the collection name is Klebsiella sp. HDJY-1, deposited at the China Center for Type Culture Collection (CCTCC) on November 17, 2025, with accession number CCTCCNO: M 20252578, exhibits excellent tolerance to both low temperatures and alkali environments. It can grow and reproduce using thifensulfuron as its sole carbon and energy source, secretes plant growth-promoting substances such as indoleacetic acid, and possesses nitrogen-fixing capabilities. Therefore, this strain can significantly promote plant growth, improve nutrient absorption efficiency, thereby increasing plant biomass and agricultural product quality, and provides an excellent strain resource for the remediation of thifensulfuron contamination in farmland soil.

[0085] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A type of Klebsiella pneumoniae, characterized in that, The Latin name of the Klebsiella pneumoniae is Klebsiella sp., the collection name is Klebsiella sp.HDJY-1, deposited at the China Center for Type Culture Collection, on November 17, 2025, with accession number CCTCC NO: M 20252578.

2. The use of Klebsiella pneumoniae as described in claim 1 in the degradation of thifensulfuron-methyl.

3. The application of Klebsiella pneumoniae as described in claim 1 in promoting plant growth.

4. The application according to claim 3, characterized in that, The plant in question is a sugar beet.

5. A bacterial agent containing the Klebsiella pneumoniae of claim 1.

6. The method for preparing the microbial agent according to claim 5, characterized in that, The procedure includes the following steps: inoculating the Klebsiella pneumoniae of claim 1 into a culture medium containing thifensulfuron-methyl and culturing it for 72-96 hours.

7. The preparation method according to claim 6, characterized in that, The culture medium is an inorganic salt liquid medium containing thifensulfuron, and the concentration of thifensulfuron in the culture medium is 10~300 mg·L. -1 .

8. The preparation method according to claim 7, characterized in that, The formulation of the inorganic salt liquid culture medium is: K₂HPO₄·3H₂O 0.5~1.5 g·L⁻¹ -1 MgSO4·7H2O 0.2~0.6 g·L -1 NaCl 0.5~1.5 g·L -1 CaCl2·2H2O 0.05~0.09 g·L -1 , FeCl3·6H2O 0.005~0.015 g·L -1 and NH4Cl 0.5~1.5 g·L -1 The pH of the inorganic salt liquid culture medium is 6-8.

9. The preparation method according to claim 7, characterized in that, The culture temperature is 15~45℃, the culture pH is 4~10, and the culture rotation speed is 100~150 rpm.

Images