Low-temperature-resistant pseudomonas georgi Bei 21 and application thereof
By inoculating the compost with the low-temperature resistant Pseudomonas guillochéri (Bei 21), the problem of difficult compost fermentation at low temperatures was solved, enabling rapid initiation and promotion of compost fermentation at 0℃, thus improving compost quality and promoting forage growth.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-18
- Publication Date
- 2026-04-14
AI Technical Summary
Under low temperature conditions, grassland composting fermentation is difficult, cannot be started or is incomplete, resulting in a decline in compost quality and an inability to effectively promote pasture growth.
Using the low-temperature resistant Pseudomonas bengalii Bei 21 as a fermentation agent, the fermentation of compost can be initiated and promoted at 0℃ by inoculating the compost raw materials with this strain, and fertilizer that promotes the growth of pasture can be prepared.
It effectively initiates composting fermentation under low-temperature conditions, shortens the fermentation cycle, improves compost quality, and promotes the growth of pasture grasses, especially ryegrass and sweet clover.
Smart Images

Figure CN121852293A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural biotechnology, specifically to a low-temperature resistant strain of Pseudomonas gasseri Bei 21 and its applications. Background Technology
[0002] Grassland animal husbandry produces a large amount of manure, and returning this manure to the grasslands is an important measure to maintain the nutrient balance of the grassland soil. However, raw manure contains a large number of harmful microorganisms and parasite eggs; direct application can lead to the spread of pests and diseases and environmental pollution. Furthermore, when raw manure is applied directly to the soil, the toxic substances such as NH3 and H2S produced during fermentation can cause "seedling burn," which is detrimental to crop growth. Therefore, raw manure needs to be rendered harmless before being used as organic fertilizer.
[0003] High-temperature aerobic composting is a relatively economical and effective way to treat livestock and poultry manure. Inoculating with exogenous microorganisms can accelerate the high-temperature aerobic composting process, shorten the fermentation cycle, reduce nitrogen loss, improve compost quality, accelerate cellulose degradation, and enable the compost to quickly enter the maturation stage.
[0004] Ordinary composting agents primarily focus on raising the temperature of the compost, neglecting the impact of the composting bacteria on plants. After composting matures, its main function is to promote plant growth through the nutrients within the compost itself. However, using plant probiotics as a composting agent allows these beneficial secondary metabolites to be produced during the composting process. Furthermore, some probiotics remain in the compost, which, when applied to the soil, further promotes plant growth. This approach is more cost-effective than directly cultivating plant probiotics. Additionally, the longer composting time results in a richer variety of secondary metabolites produced by the probiotics.
[0005] Most of my country's grasslands are located in cold or high-altitude mountainous areas in the north or south. The low winter temperatures and long duration make it difficult for compost to heat up and complete high-temperature fermentation, or the fermentation is incomplete. As a result, various pathogens in the compost cannot be killed, leading to the inability to start compost fermentation, a longer fermentation cycle, and a reduction in compost quality. Therefore, the development of composting agents that can start fermentation under low-temperature conditions is of great value. Summary of the Invention
[0006] To address the shortcomings of existing technologies, this invention provides a low-temperature resistant strain of Pseudomonas gaisii, Bei 21, and its applications. This strain can rapidly initiate composting fermentation at 0°C, solving the problem of difficult composting fermentation in winter and giving the compost more significant physiological activity. Furthermore, the fertilizer obtained from composting can effectively promote pasture growth, which is beneficial to agricultural production.
[0007] To achieve the above objectives, the present invention provides the following technical solution: A strain of pyrothermic Pseudomonas gasseri ( Pseudomonas gessardii The proposed taxonomic name for *Pseudomonas gesnezoffii* Bei 21 is... Pseudomonas gessardii The depositary institution is Guangdong Provincial Center for Microbial Culture Collection; the depositary address is: Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou; the deposit number is GDMCC No: 67313; and the deposit date is November 17, 2025.
[0008] A fermentation agent comprising *Pseudomonas gesnezoffii* Bei 21 with accession number GDMCC No: 67313.
[0009] Preferably, the preparation method of the above-mentioned fermenting agent includes the following steps: (1) Activation culture of strain: Pseudomonas beckiae Bei 21 was cultured on LB medium and incubated in the dark at 15~30℃ for 1-3 days to obtain the activated strain; (2) Preliminary fermentation culture: The activated strain was fermented in LB medium to obtain seed liquid. The culture conditions were: temperature of 15~30℃, rotation speed of 180~240 r / min for 18~72 h. (3) Secondary fermentation culture: The above seed liquid was inoculated into LB medium at an inoculation amount of 4~10 wt% to obtain a culture medium for secondary fermentation and to prepare the fermentation agent. The culture conditions were: temperature of 15~30℃, rotation speed of 180~240 r / min, and shaking fermentation culture for 18~72 h.
[0010] The above-mentioned fermentation agent is used for compost fermentation and can be started at low temperature. The application method is to evenly sprinkle the fermentation agent on the compost raw materials, mix it evenly, and the amount of fermentation agent is 0.2%-4% of the mass of the compost raw materials.
[0011] Furthermore, the fermentation agent can also be applied by adding the fermentation agent to sterilized auxiliary agents, drying it at low temperature to make microbial powder, and then adding it to the composting raw materials during composting.
[0012] The aforementioned Pseudomonas galbana Bei 21 was used to promote the growth of forage grass, and the method of application was to apply fertilizer prepared by composting and fermenting Pseudomonas galbana Bei 2 to the forage grass to promote its growth.
[0013] This invention provides a low-temperature resistant strain of *Pseudomonas bengaliensis* Bei 21 and its applications. Compared with existing technologies, its advantages are as follows: The strain *Pseudomonas gesnezoffii* Bei 21 of this invention can grow in cow dung and can be used for composting cow dung. Moreover, this strain can grow at 0°C and can initiate composting fermentation at low temperatures. At the same time, the fertilizer produced by this strain has a good growth-promoting effect on ryegrass and sweet clover. Therefore, the compost prepared using this invention has a better effect on promoting the growth of pasture than ordinary composting agents. Attached Figure Description
[0014] Figure 1 This is a schematic diagram of a ryegrass seedling according to the present invention; Figure 2 This is a growth effect diagram of the second round of growth promotion experiment of ryegrass according to the present invention. The two bottles on the left are the control group, and the two bottles on the right are the groups with added Bei 21 bacteria. Figure 3 This is a growth effect diagram of the Osmanthus fragrans growth-promoting experiment of the present invention, in which the three cups on the left are the control group and the three cups on the right are the groups with added Bei 21 bacteria; Figure 4 This is a diagram showing the growth of the Bei 21 strain of the present invention (the left side is the front of the petri dish, and the right side is the back of the petri dish). Figure 5 This is a phylogenetic tree of the Bei 21 strain of the present invention; Figure 6 This is a schematic diagram of the composting experiment of the present invention; Figure 7 This is a schematic diagram illustrating the temperature changes during the initiation of composting fermentation at temperatures as low as 0°C, according to the present invention. Figure 8 This is an electrophoresis diagram from Embodiment 2 of the present invention.
[0015] The following is *Pseudomonas gesnezoffii* Bei 21 ( Pseudomonas gessardii The proposed taxonomic name of Bei 21) Pseudomonas gessardii The depositary institution is Guangdong Provincial Microbial Culture Collection Center (GDMCC); the deposit address is: Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou; the deposit number is GDMCC No: 67313; and the deposit date is November 17, 2025. Detailed Implementation
[0016] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0017] Example 1: Strain screening: (1) Initial screening of solid culture media: Rhizosphere soil samples from grassland pasture in Malong District, Qujing City, Yunnan Province were collected. 2g of each sample was added to 10ml of sterile water and mixed thoroughly to obtain a mixed sample. 100μl of each mixed sample was evenly spread onto beef extract peptone culture dishes (considering the stringent screening conditions, the samples were spread directly without dilution). The dishes were then incubated at 0℃ for 14 days to obtain colonies. If the colonies were dense, 5-8 colonies with different morphologies were selected from each culture plate.
[0018] (2) Re-screening of liquid culture medium Take a 15×150mm test tube, add 10ml of beef extract peptone liquid culture medium to each tube and sterilize it. Place the colonies picked in step (1) into the test tube and incubate at 2℃ for 7 days. Select the test tubes where the culture medium becomes turbid, transfer the bacterial solution in the test tubes to a 15ml centrifuge tube, centrifuge at 6000rpm for 5min, discard the supernatant and collect the bacterial cells to obtain the initial screening bacteria, and retain the residual bacterial solution in the original test tube.
[0019] (3) Screening of bacterial strains for promoting growth of ryegrass Take 7-9cm tall ryegrass seedlings, wash the roots, and set aside. Three seedlings constitute one treatment group (see...). Figure 1 (As shown), the bacteria were cultured in 10ml vials. The bacteria obtained from the initial screening were each added to 2ml of soil leachate (preparation of soil leachate: soil and deionized water were mixed at a ratio of m:v=1:1, boiled, and then initially filtered through non-woven gauze to remove large soil particles. The filtrate was then filtered a second time using absorbent cotton to remove any precipitate. The filtrate after cooling was the soil leachate). The bacteria were resuspended and added to the vials. The control group received soil leachate without bacteria. Each vial was replenished with soil leachate to 5ml. The vials were cultured outdoors in a sunny location for two weeks. Seedling growth was observed, and the number of surviving seedlings, average plant height, and maximum plant height were recorded for each treatment group. The formula for calculating the average plant height was: total length of main tillers (cm) / number of seedlings (plants).
[0020] Based on the above data statistics, strains with high survival rates, significantly longer maximum lengths, and higher average heights than the control were selected for a second round of growth promotion experiments.
[0021] (4) Second round of growth promotion experiment In the first round of growth-promoting experiments, the bacterial strain that resulted in all three seedlings surviving and having an average height higher than the control group was purified by streak plating using the remaining bacterial solution in the corresponding test tubes. The purified strain was then stored in slant agar. After the strain matured, it was centrifuged and enriched for the second round of growth-promoting experiments. After two weeks of cultivation, various growth data of the seedlings were collected (using the same method as the first round of growth-promoting experiments). The bacterial strain from the group with the best growth-promoting effect was selected as the target strain, designated as Bei 21. The final growth of ryegrass in the addition of Bei 21 and the control group is shown in Table 1 below. Figure 2 As shown:
[0022] Following the second round of growth-promoting experiments described above, the growth-promoting effect of Bei 21 bacteria on Osmanthus fragrans was verified. The specific growth of Osmanthus fragrans in the Bei 21-added and control groups is shown in Table 2 below. Figure 3 As shown:
[0023] In conclusion, the selected Bei 21 strain can effectively promote the growth of forage grasses such as ryegrass and sweet clover.
[0024] Example 2: Identification of Bei 21 bacteria: PCR amplification was performed using universal primers for bacterial 16S rDNA: Primer-27F: AGAGTTTGATCCTGGCTCAG; Primer-1492R: TACGGCTACCTTGTTACGACTT.
[0025] 1. Extraction of total bacterial DNA Add 5g of Chelex-100 to 100ml of sterile water and mix well. Use a sterile bamboo stick to pick up an appropriate amount of bacterial cells from each slant culture medium and place them in a PCR tube. Add 100μl of Chelex-100 aqueous solution to each tube, shake well to disperse the bacterial cells, and then incubate at 99℃ for 20min using a PCR instrument. Centrifuge and collect the supernatant, which is the total bacterial DNA, which can be directly used for the amplification of bacterial 16S rRNA.
[0026] 2. PCR amplification Reaction system: Total volume 25.0 μl, PA 1.0 μl, PB 1.0 μl, sterile water 9.5 μl, DNA template 1.0 μl, 2xmix enzyme 12.5 μl; The PCR reaction procedure is as follows: Pre-denaturation at 95℃ for 3 minutes; 35 cycles: denaturation 95℃, 15s; annealing 52℃, 15s; extension 72℃, 1min 30s; extension 72℃, 5min.
[0027] 3. Detection of PCR products – 1% agarose gel electrophoresis (1) Prepare 1% agarose gel: Weigh 0.4g of agarose and measure 40ml of 1×TAE buffer. Pour them into an Erlenmeyer flask, heat in a microwave oven to melt, add 0.5μl of nucleic acid dye and mix well. Pour into a gel tank, insert a 25-well gel casting comb, and remove the comb after the gel cools to ensure that no air bubbles are generated during the solidification process.
[0028] (2) Spotting: Take 5 μl of PCR amplification product and add it to each spotting well. Add 5 μl of DL2000 Marker to the last spotting well.
[0029] (3) Electrophoresis: Set the program to 140V and 20min, and press “start” to start running.
[0030] (4) Remove the gel block and observe it using a gel imaging analyzer. The target fragment length is approximately 1500 bp. Compare it with the DL2000 Marker to see if there are correct bands (e.g., Figure 8 ).
[0031] 4. Identification of 16S rDNA of Bei 21 bacteria The successfully amplified PCR product was sequenced at Qingke Biotechnology Co., Ltd., as shown in SEQ ID NO.1 below: 5. Phylogenetic tree construction Sequencing results were aligned using EZbiocloud, and the type species sequence of *Pseudomonas* was downloaded from LPSN. *Pseudomonas* genus (P...) was used as the basis for sequencing. seudomonas This group is represented by [name of group], and its NJ phylogenetic tree was constructed using the software MEGA at the Pseudomonas genus level. Figure 5 Based on the combined morphological and molecular biological identification results, Bei 21 strain was identified as... Pseudomonas gessardii and named Pseudomonas gessardii Bei 21 (Pseudomonas gesnezoffii Bei21).
[0032] Example 3: Low-temperature fermentation experiment of Bei 21 bacteria: 1. Low-temperature fermentation experiment of cow dung 300g of fresh cow dung was placed in conical flasks (100g per group). A bacterial suspension of *Bei 21* bacteria, prepared using beef extract peptone liquid medium, was added to the cow dung. The mixture was stirred thoroughly with a glass rod to disperse the dung sample and increase its aeration. The samples were then incubated at 0℃ for three days. 5g of the fermentation sample was taken, and 5g of fresh cow dung stored at -20℃ was used as the control group. The samples were sent to Guangdong Meggene Technology Co., Ltd. to determine the microbial community diversity.
[0033] Sequence information at the genus level in the OTU_table was statistically analyzed, and relative abundance was calculated. Taxonomic groups with a relative abundance of 0.01% or higher (default value) were selected (i.e., the top 15 taxonomic groups). It was confirmed that *Bei 21* bacteria can grow in cow dung at 0℃.
[0034] 2. Low-temperature composting and fermentation of cow manure under low-temperature conditions 2.1 Preparation of fermentation agent: (1) Activation culture of Bei 21 bacteria: Bei 21 bacteria were cultured on LB medium and cultured in the dark in a constant temperature incubator at 15~30℃ for 2 days to obtain the activated strain; (2) The activated strain was fermented once: the activated strain was fermented once in LB medium to obtain seed liquid. The culture conditions were: temperature 15~30℃, rotation speed 200 r / min, and shaking fermentation culture for 40 h. (3) The seed liquid obtained from the first fermentation culture is subjected to a second fermentation culture: the seed liquid obtained from the first fermentation culture is inoculated into LB medium at an inoculation amount of 6 wt% to obtain a culture medium for a second fermentation. The culture conditions are: temperature of 25℃, rotation speed of 200r / min for 40h to obtain the fermentation agent.
[0035] 2.2 Composting materials: 1 ton of fresh cow manure, 30 kg of straw powder; 2.3 Composting setup (fermentation agent dosage is 1% of the total mass of compost raw materials): First, lay a layer of straw on the ground. Then, evenly spray some of the fermentation agent onto the straw powder using a spray bottle. Next, cover it with a layer of cow dung, then another layer of straw powder, and spray with bacteria (fermentation agent). Repeat this process until the fermentation agent is completely incorporated into the compost pile. The purpose of this operation is to ensure that the fermentation agent is evenly distributed in the compost. Mix the cow dung and straw powder evenly in the pile, and form it into a cone-shaped pile 1.2m high. Cover it with a tarpaulin to prevent rain and snow from falling in. Figure 6 The subsequent turning and other management measures are the same as for ordinary composting.
[0036] The above experiment was conducted under an ambient temperature of 0℃, and the changes in ambient temperature and compost temperature were recorded over 33 days, as detailed below. Figure 7 As shown in the figure, the temperature change trend indicates that the fermentation agent prepared by Bei 21 bacteria can achieve better composting temperature increase at lower temperatures, and the fermentation agent prepared by Bei 21 bacteria can start composting fermentation at 0℃.
[0037] Compost Germination Index (GI) Measurement The germination index (GI) of compost is a sensitive indicator for assessing compost maturity and phytotoxicity. A GI value greater than 80% indicates no phytotoxicity and mature compost. (The experimental group below was sprayed with the fermentation agent prepared by Bei 21 bacteria during the compost fermentation process, while the control group was sprayed with deionized water during the compost fermentation process.) The fermented compost experimental group was dried at 60℃ and mixed with deionized water at a ratio of m:v=1:10. After extraction on a shaker (30℃, 200RPM) for 24 hours, it was centrifuged at 8000RPM for 5 minutes, and the supernatant was collected as the cow manure extract. A 9cm petri dish was prepared, containing 50 ryegrass seeds and 5ml of cow manure extract. Three replicates were set up for both the experimental and control groups. The mixtures were incubated at 25℃ for 80 hours, and the compost germination index (GI) was calculated. The specific calculation method was: GI = (germination rate of treatment group × average root length) / (germination rate of control group × average root length).
[0038] The germination index results of the compost are shown in Table 3 below:
[0039] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A strain of pyrothermic Pseudomonas gasseri ( Pseudomonas gessardii Bei 21, characterized in that, The proposed taxonomic name for *Pseudomonas gesnezoffii* Bei 21 is... Pseudomonas gessardii The depositary institution is Guangdong Provincial Center for Microbial Culture Collection; the depositary address is: Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou; the deposit number is GDMCC No: 67313; and the deposit date is November 17, 2025.
2. A fermentation agent, characterized in that: The fermentation agent contains *Pseudomonas gesnezoffii* Bei 21 with accession number GDMCC No: 67313.
3. The fermenting agent according to claim 2, characterized in that, The preparation method of the fermentation agent includes the following steps: (1) Activation culture of strain: Pseudomonas beckiae Bei 21 was cultured on LB medium and cultured in the dark in a constant temperature incubator at 15~30℃ for 1-3 days to obtain the activated strain; (2) Preliminary fermentation culture: The activated strain was fermented in LB medium to obtain seed liquid. The culture conditions were: temperature of 15~30℃, rotation speed of 180~240 r / min for 18~72 h. (3) Secondary fermentation culture: The above seed liquid was inoculated into LB medium at an inoculation amount of 4~10 wt% to obtain a culture medium for secondary fermentation and to prepare the fermentation agent. The culture conditions were: temperature of 15~30℃, rotation speed of 180~240 r / min, and shaking fermentation culture for 18~72 h.
4. The application of a fermentation agent as described in any one of claims 2-3 in composting.
5. The application according to claim 4, characterized in that: The application method is to evenly sprinkle the fermentation agent onto the composting raw materials, mix them evenly, and the amount of fermentation agent is 0.2%-4% of the mass of the composting raw materials.
6. The application according to claim 4, characterized in that: The application method involves adding the fermenting agent to the sterilized auxiliary agent, drying it at low temperature to make a bacterial powder, and then adding it to the composting raw materials during composting.
7. The application of Pseudomonas gesnezoffii Bei 21 as described in claim 1 in promoting pasture growth.
8. The application according to claim 7, characterized in that: The application method involves applying fertilizer prepared by composting and fermenting Pseudomonas beckii Bei 2 to pasture to promote its growth.
Citation Information
Patent Citations
Compound fungicide for low-temperature compost, and preparation method and application thereof
CN103540548A
New application and method of pseudomonas spinulosa, pseudomonas spinulosa 21 4.1 9.2-14 and product of pseudomonas spinulosa 21 4.1 9.2-14
CN115340968A
Multifunctional pseudomonas fluorescens capable of promoting forage grass growth and low-temperature compost fermentation
CN116042468A
Pseudomonas for promoting plant growth and increasing polyphyllin content and application thereof
CN117844695A
Cryophilic pseudomonas strain and application thereof
CN119875921A