Corn Waxy1 mutant gene and application thereof

Abstract

The invention discloses a corn Waxy1 mutant gene and protein, the corn Waxy1 gene is successfully subjected to fixed-point editing by designing gRNA (guide Ribonucleic Acid), so that the genomic sequence of the corn Waxy1 gene is deleted by 39 bp, the protein frame shift is changed, the GT1 structural domain is lost, and further improved corn characters are obtained. Compared with a wild type Zheng 58, the waxiness of the obtained gene edited corn plant grains is obviously improved, the amylose content of the corn grains is 0.07%-0.43%, the amylopectin content is 99.57%-99.93%, the proportion of the amylopectin in the corn grains is obviously improved compared with that of the wild type Zheng 58, and the target character performance is stable.

Description

Technical Field

[0001] This invention relates to the field of bio-breeding technology, and more specifically, to maize. Waxy1 Mutant genes and their applications. Background Technology

[0002] Corn (Zea mays L.) has firmly established itself as my country's largest crop, serving as a vital food, feed, and industrial raw material. my country's demand for corn is increasing year by year, and there are also higher requirements for the diversity of corn varieties. my country has a wide variety of corn types, which are classified into waxy corn, common corn, and high-amylose corn based on differences in amylose content. Waxy corn, belonging to the genus Zea in the tribe Zea of ​​the Poaceae family, has a unique soft and palatable texture and a sweet, sticky, and fragrant flavor compared to common corn. Besides being eaten fresh, waxy corn can also be used for quick-freezing, making canned eight-treasure porridge, etc., and is highly favored by consumers in China and Southeast Asia. Waxy corn is also an important raw material for modern industry. Waxy corn kernels have a high proportion of amylopectin. Compared with ordinary starch, amylopectin contains more branches in its molecules, thus having better gelling properties and stability. The amylopectin in waxy corn kernels is easily soluble in water and has strong viscosity. It has weak coagulation properties and is not easy to precipitate or retrograde during storage. It is widely used in important industrial fields such as food, brewing, textiles, papermaking, adhesives, pharmaceuticals and casting.

[0003] However, the traditional breeding process for waxy corn is lengthy and complex, with low breeding efficiency and long time consumption. It also inevitably produces problems such as linkage burdens, affecting the overall traits of waxy corn materials. With the development of genome editing technology, especially the emergence of CRISPR technology, the shortcomings of traditional breeding can be effectively addressed, breeding efficiency improved, and the breeding cycle shortened. The application of new gene editing technologies in this field provides new ideas for maize genetic breeding.

[0004] Creating waxy maize materials by specifically inducing targeted mutations in genes related to waxiness in maize using gene editing technology has significant application value. However, research on the created waxy maize materials is currently very limited, and progress is relatively slow. Summary of the Invention

[0005] To address at least one deficiency or improvement need in the prior art, the present invention provides a corn Waxy1 The purpose of mutants and their applications is to improve the waxy trait of maize kernels and increase the proportion of amylopectin in maize kernels. The final result is that the target trait is excellent and genetically stable across different generations.

[0006] To achieve the above objectives, according to one aspect of the present invention, a method for improving the waxiness of corn kernels is provided. Waxy1The mutant genotype, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0007] According to another aspect of the invention, a method for improving the waxiness of corn kernels is also provided. Waxy1 A mutant protein, the amino acid sequence of which is shown in SEQ ID NO.4.

[0008] According to another aspect of the invention, a biological material is also provided, comprising the mutant, wherein the biological material is one or more of a recombinant expression vector, plasmid, expression cassette, or recombinant bacteria.

[0009] According to another aspect of the invention, a gene knockout vector is also provided, the vector having a Wimi-Cas12Y7 backbone and containing sgRNA as shown in SEQ ID NO.5 and SEQ ID NO.6.

[0010] According to another aspect of the invention, a host cell containing the vector is also provided, the host comprising any one of Escherichia coli, Agrobacterium tumefaciens, or non-renewable plant parts.

[0011] Furthermore, the present invention also provides the application of the mutant genotype, the mutant protein, the biological material, the vector, the host, or the kit as described in improving the waxiness of maize kernels.

[0012] According to another aspect of the invention, a method for improving the waxiness of corn kernels is also provided, comprising using gene editing technology to... Waxy1 The gene is modified; or, the nucleotide sequence of the mutant is expressed in wild-type maize, wherein the gene editing technology uses sgRNA sequences as shown in SEQ ID NO.5 and SEQ ID NO.6.

[0013] According to another aspect of the present invention, a method for breeding maize is also provided, comprising using gene editing technology to... Waxy The gene is modified; or, the nucleotide sequence of the mutant is expressed in wild-type maize.

[0014] Furthermore, the method includes the step of introducing the mutant into plant cells, plant seeds, plant tissues, plant parts, or a plant, wherein the plant is maize.

[0015] Furthermore, the maize in question is the inbred line Zheng 58.

[0016] In summary, compared with the prior art, the above-described technical solutions conceived by this invention can achieve the following beneficial effects: This invention provides an inventive corn Waxy1Mutant genes and proteins were successfully synthesized by designing gRNAs to modify maize. Waxy1 Targeted gene editing resulted in a 39 bp deletion of the genome sequence, leading to a frameshift change in the protein and the loss of the GT1 domain, thus producing an improved waxy trait in maize. Compared to wild-type Zheng 58, the total starch content of the gene-edited maize kernels remained unchanged, but the proportion of amylopectin was significantly increased. Specifically, the amylose content was 0.07%–0.43%, significantly lower than the 17.10%–19.74% of wild-type Zheng 58, while the amylopectin content was 99.57%–99.93%, significantly higher than the 80.26%–82.90% of wild-type Zheng 58. This indicates that the starch component in the gene-edited maize kernels is almost entirely amylopectin, significantly improving the waxy texture of the maize. Furthermore, this trait remained stable across different generations of maize, indicating that it can be stably inherited. Attached Figure Description

[0017] Figure 1 The target gene provided in the embodiments of the present invention Waxy1 Structural diagram; Figure 2 This is a comparison diagram of protein domains before and after target gene editing provided in an embodiment of the present invention; Figure 3 This is a physical map of the gene editing expression vector Wimi-Cas12Y7-Waxy1 provided in this embodiment of the invention; Figure 4 This is a schematic diagram of the primers for detecting the editing site in gene-edited maize plants provided in an embodiment of the present invention; Figure 5 This is a comparison diagram of genome sequencing target site editing provided in an embodiment of the present invention; Figure 6 This is an image showing the electrophoresis results of PCR amplification of the target gene editing region provided in an embodiment of the present invention; M: DNA Marker, the band size is indicated above, in units of bp; N: Blank control water; 1-5: Genomic DNA of Zheng 58, product size 1131bp; 6-7: Genomic DNA of T2 generation unmixed glutinous rice 101, product size 1092 bp; 8: T3 generation unmixed glutinous rice 101 genomic DNA, product size 1092 bp; 9: T4 generation of unprocessed rice glutinous rice 101 genomic DNA, product size 1092 bp.

[0018] Figure 7 This is a comparison diagram of the target site sequencing peaks of T2-T4 generation gene-edited maize plants and wild-type Zheng 58 provided in the embodiments of the present invention. Detailed Implementation

[0019] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. Furthermore, the technical features involved in the various embodiments of this invention described below can be combined with each other as long as they do not conflict with each other.

[0020] In order to create a new waxy corn material, this invention selected the conventional backbone inbred line Zheng 58. Waxy1 Genes as target genes, Waxy1 The gene encodes a granule-bound starch synthase. This invention utilizes the CRISPR / Cas12Y7 gene editing tool to edit this target gene, obtaining a... Waxy1 mutant gene △ Waxy, This resulted in a 39 bp deletion in the original sequence, and the editing altered the splicing method, leading to a mutated Δ. W The axy1 gene coding frame was altered and terminated prematurely, resulting in a protein frameshift change. Waxy1 The gene encodes 605 amino acids and contains two functional domains: the GT5 domain and the GT1 domain. The mutant △ obtained after gene editing in this invention... Waxy1 The gene encodes 277 amino acids and completely loses the GT1 domain, thus losing the function and activity of the original protein, resulting in the improved waxy corn trait, such as... Figure 2 What is shown is W axy 1 Comparison of protein domains before and after gene editing.

[0021] in Waxy1 The gene sequence is 3945 bp in length, as shown in SEQ ID NO.1. The mutant gene obtained after editing is △ Waxy1 The length is 3906 bp, and the sequence is shown in SEQ ID NO.2. Waxy1 The gene encodes 605 amino acids, and the amino acid sequence is shown in SEQ ID NO.3. The mutated △ Waxy1 The gene encodes 277 amino acids, and the amino acid sequence is shown in SEQ ID NO.4.

[0022] The present invention will be further described in detail below with reference to specific embodiments. It should be noted that the specific embodiments are for explanation and not limitation of the present invention. Unless otherwise specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments used that do not specify the manufacturer are all commercially available products.

[0023] (1)Waxy1 sgRNA targeting sequence design The target genes selected in this invention Waxy1 The reference genome of maize Zheng58, numbered Zm00103aa038207, can be downloaded from https: / / download.maizegdb.org / Zm-Zheng58-REFERENCE-CAAS_FIL-1.0 / Waxy1 The gene sequence, which exists only once in maize, is located at Chr9:26221256~26225200, with a full genome length of 3945 bp, containing 13 exons, and encoding a 605 aa protein. The specific structure is as follows... Figure 1 As shown. Its nucleotide sequence is shown in SEQ ID NO.1.

[0024] The gene editing tool used in this embodiment is the CRISPR / Cas12Y7 system, which is used to edit the target gene. Waxy1 The target points are designed and edited on the code reading frame, and targets with high target scores, low miss rates, and appropriate positions are selected.

[0025] The preferred DNA sequences of the two target regions in this invention are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively: gRNA1: AGCAGAGAAGGCAACCTTTTGCGT; gRNA2:TCTGCTGAACTGAACAACGCCGT The two sgRNA molecular sequences in this invention were obtained through artificial synthesis.

[0026] (2) The gRNA was ligated into the gene editing backbone vector Wimi-Cas12Y7 via homologous recombination cloning to construct the gene editing vector Wimi-Cas12Y7-Waxy1. This gene editing vector contains Cas12Y7, gRNA, and bar genes. Cas12Y7 is driven by the maize UBI promoter, gRNA by the ZmU6 promoter, and the bar gene by the CaMV35S promoter. This vector is derived from *Escherichia coli*, and the backbone vector is a universal vector that has been used internationally for many years. It is not pathogenic and will not evolve into a pathogenic vector. Its map is shown below. Figure 3 As shown. In one embodiment, the construction process is roughly as follows: pass Bsa I enzyme digestion was performed to remove the ccdB sequence from the backbone carried by Wimi-Cas12Y7. BsaDigest the backbone vector Wimi-Cas12Y7 with enzyme I at 37°C for approximately 1 hour; the digestion system is 50 μl, containing 1 μg (10 μl) of Wimi-Cas12Y7. Bsa Enzyme I is 1 μl. Bsa The buffer for enzyme I was 5 μl, and H2O was 34 μl. The digested vector product was recovered from the gel using the DC301 kit (Novozymes PCR Gel Recovery Kit). The intermediate template was amplified using dual-target primers, and then the gel was excised and recovered.

[0027] (3) Ligate the enzyme digestion vector product and the PCR product.

[0028] Ligation system (mixed on ice): 2 μl of the enzyme digestion vector product obtained in step (2), 5 μl of the PCR product obtained in step (2), 1 μl of homologous recombinase, 1 μl of recombinase buffer, and 1 μl of H2O. The PCR instrument was run with the Ligase program at 50℃ for 20 min before transforming E. coli.

[0029] (4) The ligation product was transformed into Escherichia coli to obtain the gene editing vector Wimi-Cas12Y7-Waxy1. After removing the competent E. coli DH5α cells from the refrigerator, they were quickly placed on ice. After 5 minutes, when the bacterial block was dissolved, the ligation product obtained in (3) was added: 10 μl of ligation product + 100 μl of competent E. coli DH5α cells. The mixture was placed on ice for 25 min, then heat-shocked at 42℃ for 45 s, placed on ice for 2 min, and 100 μl of antibiotic-free LB was added. The mixture was shaken at 37℃ and 200 rpm for 1 h. The mixture was then plated and incubated with LB + Kana at 37℃ for one day.

[0030] The above-described vector construction process is only one embodiment provided by the present invention. Other conventional gene editing vector construction methods can be used for construction, and no specific or unique limitation is imposed.

[0031] Example 2: Transformation of the knockout vector into maize KN5585 This invention employs an Agrobacterium-mediated genetic transformation method, the specific method and process of which are as follows: 2.1 Callus preparation This type of embryogenic callus is characterized by rapid growth, soft texture, loose and brittle structure, and bright color. It can be subcultured for extended periods and retain its embryogenic capacity for a considerable time.

[0032] 2.2 Preparation of Agrobacterium 1) Two days before infection, streak Agrobacterium on LB medium and incubate in the dark at 28°C, or pick single clones and shake them in liquid LB medium. 2) Collect the bacterial cells and transfer them to a 50 mL centrifuge tube. Resuspend the bacterial cells in the infection medium to make the concentration of the infection solution between OD660 and 0.8 and 1.5. 3) Activate Agrobacterium by shaking the prepared infection solution on a shaker at 28°C and 200 rpm for 2 hours for infection.

[0033] 2.3 Infection 1) Select pretreated callus tissue and transfer it to an infection culture medium; 2) Soak the callus tissue in the invasion staining solution for 10-30 minutes, break up the callus tissue clumps, and shake well to ensure that the callus tissue is fully in contact with Agrobacterium. 3) Aspirate the remaining infection solution and transfer the infected callus tissue into a co-culture medium. Incubate in the dark at 19°C for 3 days. 2.4 Resumption of Culture Rinse the callus surface 3-5 times with sterile water containing antibiotics. Once the water is no longer cloudy, discard the liquid and transfer the callus to a Petri dish lined with filter paper. Dry the callus surface in a laminar flow hood. Transfer to recovery medium and incubate in the dark at 28°C for 7-10 days. Then transfer to selection medium.

[0034] 2.5 Screening 1) After recovery culture, the transformed callus tissue was transferred into a selection medium supplemented with antibiotics and cultured in the dark at 28°C for 20-30 days; 2) Transfer the callus tissue into a sterile petri dish, break it up, and then press it thin. 3) Pick out the brighter callus particles on the UV operating table, clump 3-5 particles together, and transfer them into a new selection medium; 4) Incubate in the dark at 28℃ for 20 days, then transfer to a new screening medium for subculture and propagation; 5) After two cycles (40 days), the callus tissue that emits fluorescence again is picked (the callus tissue is not broken up).

[0035] 2.6 Differentiation and Rooting 1) After heat shock, the callus tissue was transferred to predifferentiation medium and cultured in the dark at 28°C for 10 days, then transferred to light at 28°C for 10 days. 2) Transfer to differentiation medium, and when the regenerated shoots grow to 3-5 cm, transfer to rooting medium; 3) After the seedlings have developed a large number of strong roots, harden them off and transplant them. 2.7 Hardening off and transplanting 1) After rooting, remove the sealing film from the rooting bottle and harden the seedlings in the culture medium for 2-3 days; 2) Wash the roots of the culture medium and transplant them into sterilized nutrient soil. Harden the seedlings indoors for 7 days. 3) Transplant in a greenhouse or open field.

[0036] Example 3: Analysis of the mutant target gene Δ in gene-edited maize plants Waxy1 Editing status 3.1 Whole genome resequencing This invention, through preliminary steps such as gene-editing vector construction and target design, and maize transformation, obtained 10 positive T0 generation gene-edited maize lines in 2022. Subsequently, screening was conducted using methods including target sequence determination, phenotypic analysis, off-target and residual sequence analysis, and genotyping. By 2024, superior gene-editing vectors had been selected. Waxy1 Maize lines. During the intermediate-scale trial conducted in the 2024 maize planting season, T2~T4 generations were planted in the field. Waxy1 In maize plants, molecular characteristics and target trait identification were performed. The editing status of target genes was analyzed using whole-genome resequencing and PCR amplification. Specifically, in the T1 generation, high-depth sequencing was used to analyze for foreign sequence residues and off-target effects, identifying one Δ gene in the T1 generation that initially showed no foreign gene editing. Waxy1 Genomic DNA was extracted from leaves of maize and wild-type Zheng 58 maize, and resequencing was performed using high-depth whole-genome sequencing (sequencing platform: BGI DNBSEQ, sequencing length: PE150). Results are as follows: Figure 4 As shown, the alignment of target regions extracted from the BAM files of gene-edited maize and the control Zheng 58 reveals that the target gene in gene-edited maize... Waxy1 There is a 39 bp (CAAAGGTTGCCTTCTCTGCTGAACTGAACAACGCCGTCT) deletion.

[0037] 3.2 Target site PCR amplification and sequencing This invention uses PCR amplification and sequencing to further determine the genomic sequence of the edited target gene. Waxy1 Specific primer pairs 23A0860 and 23A0904 were designed, and the primer sequences are shown in Table 1. The PCR reaction system and reaction procedure are shown in Tables 2 and 3, and the primer design positions are as follows. Figure 5 As shown. The specific qualitative PCR system was designed based on the sequence of the transgenic editing site. The forward primer was located upstream of the editing site in the maize genome of Weiminuo 101, and the reverse primer was located at the editing site. The specific amplified fragment sequence of maize Weiminuo 101 (5'-3') is shown, with single underlines indicating primer positions and boxes indicating the partial sequence of deleted bases at the editing site: Zheng 58 and T2~T4 generations were amplified using conventional PCR methods. Waxy1 The genome sequence of the target gene in maize plant was obtained, and the target gene sequence in the receptor and the target gene editing status were determined by first-generation sequencing.

[0038] Table 1 Primer list for PCR amplification detection of edit sites

[0039] Table 2 PCR reaction system

[0040] Table 3 PCR reaction procedure:

[0041] Zheng 58 and △ Waxy1 Electrophoresis results of PCR amplification products of target genes in maize plants are as follows: Figure 6 As shown in the figure, the results indicate that the expected fragments were obtained in all PCR experiments. The PCR products were recovered and sequenced. The sequencing results and sequence peak diagrams are shown below. Figure 7 As shown. Sequence alignment results indicate that the target gene of Zheng 58 is... Waxy After editing, the target gene of Weiminuo 101 was deleted by 39 bp (the sequence below from 255 to 293 bp, CAAAGGTTGCCTTCTCTGCTGAACTGAACAACGCCGTCT), which is consistent with the previous whole genome resequencing results.

[0042] Example 4 This example provides gene-edited maize △ Waxy1 Application in maize breeding To further test the invention △ Waxy1 The effect of mutants on the waxy trait of maize kernels was investigated by the inventors at three experimental sites—Beijing, Nanjing (Jiangsu), and Gongzhuling (Jilin)—from May to October 2024. Waxy1 After harvesting the mutant maize plants and the control Zheng 58 (three biological replicates for each material at each location), the maize kernels were dried, threshed, and then sent to the Institute of Agricultural Product Quality and Safety, Heilongjiang Academy of Agricultural Sciences (Grain and Products Quality Inspection and Testing Center, Ministry of Agriculture and Rural Affairs (Harbin)) for determination of total starch, amylose, and amylopectin content in the kernels of gene-edited maize Weimi Nuo 101 and control maize Zheng 58. Three replicates of Weimi Nuo 101 and Zheng 58 harvested from three planting sites were set up for each site, with each replicate consisting of 300 g of maize kernels, and sent to the testing center for starch analysis. The starch (dry basis) detection method followed GB 5009.9-2023; the amylose content detection method followed NY / T 55-1987; and the amylopectin content detection method followed the dual-wavelength spectrophotometric method of DB32 / T 2265-2012. The results are shown in Table 4.

[0043] The results show that at harvest, the starch content of gene-edited maize kernels from generations T2 to T4 did not differ significantly from the control Zheng 58 across different generations. However, the proportion of amylopectin was significantly increased. The amylose content was 0.07%–0.43%, significantly lower than the control's 17.10%–19.74%, while the amylopectin content was 99.57%–99.93%, significantly higher than the control's 80.26%–82.90%. This indicates that the starch component in the gene-edited maize kernels of this invention is almost entirely amylopectin, with almost no amylose, significantly improving the waxy texture of the kernels. Furthermore, this target trait remained stable across different generations, indicating that the target trait can be stably inherited.

[0044] Table 4. Comparison of starch content in different generations of Weimi Nuo 101 seeds

[0045] Numerical values ​​are expressed as mean ± standard deviation. Differences in data between different materials were compared using a t-test (α = 0.05). Those skilled in the art will readily understand that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

[0046] Sequence List: SEQ ID NO.1 atcgtggggg gcgcgggcgg aggagagcgt ggcgagggcc gagagcagcg cgcggccggg 60 tcacgcaacg cgccccacgt actgccctcc ccctccgcgc gcgctagaaa taccgaggcc 120 tggaccgggg ggggccccgt cacatccatc catcgaccga tcgatcgcca cagccaacac 180 cacccgccga ggcgacgcga cagccgccag gaggaaggaa taaactcact gccagccagt 240 gaagggggag aagtgtactg ctccgtcgac cagtgcgcgc accgcccggc agggctgctc 300 atctcgtcga cgaccaggtt ctgttccgtt ccgatccgat ccgatcctgt ccttgagttt 360 cgtccagatc ctggcgcgta tctgcgtgtt tgatgatcca ggttcttcga acctaaatct 420 gtccgtgcac acgtcttttc tctctctcct acgcagtgga ttaatcggca tggcggctct 480 ggccacgtcg cagctcgtcg caacgcgcgc cggcctgggc gtcccggacg cgtccacgtt 540 ccgccgcggc gccgcgcagg gcctgagggg ggcccgggcg tcggcggcgg cggacacgct 600 cagcatgcgg accagcgcgc gcgcggcgcc caggcaccag cagcaggcgc gccgcggggg 660 caggttcccg tcgctcgtcg tgtgcgccag cgccggcatg aacgtcgtct tcgtcggcgc 720 cgagatggcg ccgtggagca agaccggcgg cctcggcgac gtcctcggcg gcctgccgcc 780 ggccatggcc gtaagcgcgc gcaccgagac atgcatccgt tggatcgcgt cttcttcgtg 840 ctcttgccgc gtgcatgatg catgtgtttc ctcctggctt gtgttcgtgt atgtgacgtg 900 tttgttcggg catgcatgca ggcgaacggg caccgtgtca tggtcgtctc tccccgctac 960 gaccagtaca aggacgcctg ggacaccagc gtcgtgtccg aggtacggcc accgagacca 1020 gattcagatc acagtcacac acaccgtcat atgaaccttt ctctgctctg atgcctgcaa 1080 ctgcaaatgc atgcagatca agatgggaga cgggtacgag acggtcaggt tcttccactg 1140 ctacaagcgc ggagtggacc gcgtgttcgt tgaccaccca ctgttcctgg agagggtgag 1200 acgagatctg atcactcgat acgcaattac caccccattg taagcagtta cagtgagctt 1260 tttttccccc cggcctggtc gctggtttca ggtttgggga aagaccgagg agaagatcta 1320 cgggcctgtc gctggaacgg actacaggga caaccagctg cggttcagcc tgctatgcca 1380 ggtcaggatg gcttgctact acaacttcag atcatctgta tgcagcagta tacaccgatg 1440 agaaatgcat gctgttctgc aggcagcact tgaagctcca aggatcctga gcctcaacaa 1500 caacccatac ttctccggac catacggtaa gagttgcagt cttcgtatat atctgttgag 1560 ctcgacaatc ttcacaggaa acggcccatc agacggactg tcattttaca ctgactactg 1620 ctgctgctct tcgtccatcc atacaagggg aggacgtcgt gttcgtctgc aacgactggc 1680 acaccggccc tctctcgtgc tacctcaaga gcaactacca gtcccacggc atctacaggg 1740 acgcaaaggt tgccttctct gctgaactga acaacgccgt cttcgttctc catgctcgta 1800 tatacctcat ctggtggtgg tgcttctctg aaactgaaac tgaaactgac tgcatgtctg 1860 tctgaccatc ttcacgtact acctaccaga ccgctttctg catccacaac atctcctacc 1920 agggccggtt cgccttctcc gactacccgg agctgaacct cccggagaga ttcaagtcgt 1980 ccttcgattt catcgacggg tctgttttcc tgcgtgcatg tgaacattca tgaatggtaa 2040 cccacaactg ttcgcgtcct gctggttcat tatctgacct gattgcatta ttgcagctac 2100 gagaagcccg tggaaggccg gaagatcaac tggatgaagg ccgggatcct cgaggccgac 2160 agggtcctca ccgtcagccc ctactacgcc gaggagctca tctccggcat cgccaggggc 2220 tgcgagctcg acaacatcat gcgcctcacc ggcatcaccg gcatcgtcaa cggcatggac 2280 gtcagcgagt gggaccccag cagggacaag tacatcgccg tgaagtacga cgtgtcgacg 2340 gtgagctggc tagctagctg attctgctgc ctggtcctcc tgctcatgct ggttcggttc 2400 tgacgcggca agtgtacgta cgtgcgtgcg acggtggtgt ggtgtccggt tcaggccgtg 2460 gaggccaagg cgctgaacaa ggaggcgctg caggcggagg tcgggctccc ggtggaccgg 2520 aacatcccgc tggtggcgtt catcggcagg ctggaagagc agaagggccc cgacgtcatg 2580 gcggccgcca tcccgcagct catggagatg gtggaggacg tgcagatcgt tctgctggta 2640 cgtgtgcgcc gcccgccacc cggctactac atgcgtgtat cgttcgttct actggaacat 2700 gcgtgtgagc aacgcgatgg ataatgctgc agggcacggg caagaagaag ttcgagcgca 2760 tgctcatgag cgccgaggag aagttcccag gcaaggtgcg cgccgtggtc aagttcaacg 2820 cggcgctggc gcaccacatc atggccggcg ccgacgtgct cgccgtcacc agccgcttcg 2880 agccctgcgg cctcatccag ctgcagggga tgcgatacgg aacggtacga gagagaaaaa 2940 aacatcctga atcctgacga gagggacaga gacagattga ttatgaatgc ttcatcgatt 3000 tgaattgatt gatcgatgtc tcccgctgcg actcttgcag ccctgcgcct gcgcgtccac 3060 cggtggactc gtcgacacca tcatcgaagg caagaccggg ttccacatgg gccgcctcag 3120 cgtcgacgta agcctacctc tgccatgttc tttcttcttt ctttctgtat gtatgtatgt 3180 atgtacgaat cagcaccgcc attcttgttt cgtcgtcctc tcttcccagt gcaacgtcgt 3240 ggagccggcg gacgtcaaga aggtggccac caccttgcag cgcgccatca aggtggtcgg 3300 cacgccggcg tacgaggaga tggtgaggaa ctgcatgatc caggatctct cctggaaggt 3360 acgtacgccc gccccgccag agcagagcgc caagatcgat cgaccgaccg accacacgta 3420 cgcgcctcgc tcctgtcgct gaccgtggtt taatttgcga aatgcgcagg gccctgccaa 3480 gaactgggag aacgtgctgc tcagcctcgg ggtcgccggc ggcgagccag gggtcgaagg 3540 cgaggagatc gcgccgctcg ccaaggagaa cgtggccgcg ccctgaagag ttcggcctgc 3600 agggcccctg atctcgcgcg tggtgcaaag atgttgggac atcttcttat atatgctgtt 3660 tcgtttatgt gatatggaca agtgtgtgta gctgcttgct tgtgctagtg taatgtagtg 3720 tagtggtggc cagtggcaca acctaataag cgcatgaact aattgcttgc gtgtgtagtt 3780 aagtaccgat cggtaatttt atattgcgag taaataaatg gacctgtagt ggtggagtaa 3840 ataatccctg ctgttcggtg ttcttatcgc tcctcgtata gatattatat agagtacatt 3900 tttctctctc tgaatcctac gtttgtgaaa tttctatatc attack SEQ ID NO.2 atcgtggggg gcgcggggcgg aggagagcgt ggcgagggcc gagagcagcg cgcggccggg 120. tcacgcaacg cgccccacgt actgccctcc ccctccgcgc gcgctagaaa taccgaggcc tggaccgggg ggggccccgt cacatccatc catcgaccga tcgatcgcca cagccaacac cacccgccga ggcgacgcga cagccgccag caggagga taaactcact gccagccagt gaagggggag aagtgtactg ctccgtcgac cagtgcgcgc accgcccggc agggctgctc 300 atctcgtcga cgaccaggtt ctgttccgtt ccgatccgat ccgatcctgt ccttgagttt 360 cgtccagatc ctggcgcgta tctgcgtgtt tgatgatcca ggttcttcga acctaaatct 420 gtccgtgcac acgtcttttc tctctctcct acgcagtgga ttaatcggca tggcggctct 480 ggccacgtcg cagctcgtcg caacgcgcgc cggcctgggc gtcccggacg cgtccacgtt 540 ccgccgcggc gccgcgcagg gcctgagggg ggcccggcg tcggcggcgg cggacacgct 600 cagcatgcgg accagcgcgc gcgcggcgcc caggcaccag cagcaggcgc gccgcgggggg 660 caggttcccg tcgctcgtcg tgtgcgccag cgccggcatg aacgtcgtct tcgtcggcgc 720 cgagatggcg ccgtggagca agaccggcgg cctcggcgac gtcctcggcg gcctgccgcc 780 ggccatggcc gtaagcgcgc gcaccgagac atgcatccgt tggatcgcgt cttcttcgtg 840 ctcttgccgc gtgcatgatg catgtgtttc ctcctggctt gtgttcgtgt atgtgacgtg 900 tttgttcggg catgcatgca ggcgaacggg caccgtgtca tggtcgtctc tccccgctac 960 gaccagtaca aggacgcctg ggacaccagc gtcgtgtccg aggtacggcc accgagacca 1020 gattcagatc acagtcacac acaccgtcat atgaaccttt ctctgctctg atgcctgcaa 1080 ctgcaaatgc atgcagatca agatgggaga cgggtacgag acggtcaggt tcttccactg 1140 ctacaagcgc ggagtggacc gcgtgttcgt tgaccaccca ctgttcctgg agagggtgag 1200 acgagatctg atcactcgat acgcaattac caccccattg taagcagtta cagtgagctt 1260 tttttccccc cggcctggtc gctggtttca ggtttgggga aagaccgagg agaagatcta 1320 cgggcctgtc gctggaacgg actacaggga caaccagctg cggttcagcc tgctatgcca 1380 ggtcaggatg gcttgctact acaacttcag atcatctgta tgcagcagta tacaccgatg 1440 agaaatgcat gctgttctgc aggcagcact tgaagctcca aggatcctga gcctcaacaa 1500 caacccatac ttctccggac catacggtaa gagttgcagt cttcgtatat atctgttgag 1560 ctcgacaatc ttcacaggaa acggcccatc agacggactg tcattttaca ctgactactg 1620 ctgctgctct tcgtccatcc atacaagggg aggacgtcgt gttcgtctgc aacgactggc 1680 acaccggccc tctctcgtgc tacctcaaga gcaactacca gtcccacggc atctacaggg 1740 acgtcgttct ccatgctcgt atatacctca tctggtggtg gtgcttctct gaaactgaaa 1800 ctgaaactga ctgcatgtct gtctgaccat cttcacgtac tacctaccag accgctttct 1860 gcatccacaa catctcctac cagggccggt tcgccttctc cgactacccg gagctgaacc 1920 tcccggagag attcaagtcg tccttcgatt tcatcgacgg gtctgttttc ctgcgtgcat 1980 gtgaacattc atgaatggta acccacaact gttcgcgtcc tgctggttca ttatctgacc 2040 tgattgcatt attgcagcta cgagaagccc gtggaaggcc ggaagatcaa ctggatgaag 2100 gccgggatcc tcgaggccga cagggtcctc accgtcagcc cctactacgc cgaggagctc 2160 atctccggca tcgccagggg ctgcgagctc gacaacatca tgcgcctcac cggcatcacc 2220 ggcatcgtca acggcatgga cgtcagcgag tgggacccca gcagggacaa gtacatcgcc 2280 gtgaagtacg acgtgtcgac ggtgagctgg ctagctagct gattctgctg cctggtcctc 2340 ctgctcatgc tggttcggtt ctgacgcggc aagtgtacgt acgtgcgtgc gacggtggtg 2400 tggtgtccgg ttcaggccgt ggaggccaag gcgctgaaca aggaggcgct gcaggcggag 2460 gtcgggctcc cggtggaccg gaacatcccg ctggtggcgt tcatcggcag gctggaagag 2520 cagaagggcc ccgacgtcat ggcggccgcc atcccgcagc tcatggagat ggtggaggac 2580 gtgcagatcg ttctgctggt acgtgtgcgc cgcccgccac ccggctacta catgcgtgta 2640 tcgttcgttc tactggaaca tgcgtgtgag caacgcgatg gataatgctg cagggcacgg 2700 gcaagaagaa gttcgagcgc atgctcatga gcgccgagga gaagttccca ggcaaggtgc 2760 gcgccgtggt caagttcaac gcggcgctgg cgcaccacat catggccggc gccgacgtgc 2820 tcgccgtcac cagccgcttc gagccctgcg gcctcatcca gctgcagggg atgcgatacg 2880 gaacggtacg agagagaaaa aaacatcctg aatcctgacg agagggacag agacagattg 2940 attatgaatg cttcatcgat ttgaattgat tgatcgatgt ctcccgctgc gactcttgca 3000 gccctgcgcc tgcgcgtcca ccggtggact cgtcgacacc atcatcgaag gcaagaccgg 3060 gttccacatg ggccgcctca gcgtcgacgt aagcctacct ctgccatgtt ctttcttctt 3120 tctttctgta tgtatgtatg tatgtacgaa tcagcaccgc cattcttgtt tcgtcgtcct 3180 ctcttcccag tgcaacgtcg tggagccggc ggacgtcaag aaggtggcca ccaccttgca 3240 gcgcgccatc aaggtggtcg gcacgccggc gtacgaggag atggtgagga actgcatgat 3300 ccaggatctc tcctggaagg tacgtacgcc cgccccgcca gagcagagcg ccaagatcga 3360 tcgaccgacc gaccacacgt acgcgcctcg ctcctgtcgc tgaccgtggt ttaatttgcg 3420 aaatgcgcag ggccctgcca agaactggga gaacgtgctg ctcagcctcg gggtcgccgg 3480 cggcgagcca ggggtcgaag gcgaggagat cgcgccgctc gccaaggaga acgtggccgc 3540 gccctgaaga gttcggcctg cagggcccct gatctcgcgc gtggtgcaaa gatgttggga 3600 catcttctta tatatgctgt ttcgtttatg tgatatggac aagtgtgtgt agctgcttgc 3660 ttgtgctagt gtaatgtagt gtagtggtgg ccagtggcac aacctaataa gcgcatgaac 3720 taattgcttg cgtgtgtagt taagtaccga tcggtaattt tatattgcga gtaaataaat 3780 ggacctgtag tggtggagta aataatccct gctgttcggt gttcttatcg ctcctcgtat 3840 agatattata tagagtacat ttttctctct ctgaatccta cgtttgtgaa atttctatat 3900 cattac SEQ ID NO.3 MAALATSQLV ATRAGLGVPD ASTFRRGAAQ GLRGARASAA ADTLSMRTSA RAAPRHQQQA 60 RRGGRFPSLV VCASAGMNVV FVGAEAPWS KTGGLGDVLG GLPPAMAANG HRVMVVSPRY 120 DQYKDAWDTS VVSEIKMGDG YETVRFFHCY KRGVDRVFVD HPLFLERVWG KTEEKIYGPV 180 AGTDYRDNQL RFSLLCQAAL EAPRILSLNN NPYFSGPYGE DVVFVCNDWH TGPLSCYLKS 240 NYQSHGIYRD AKTAFCIHNI SYQGRFASD YPELNLPERF KSSFDFIDGY EKPVEGRKIN 300 WMKAGILEAD RVLTVSPYYA EELISGIARG CELDNIMRLT GITGIVNGMD VSEWDPSRDK 360 YIAVKYDVST AVEAKALNKE ALQAEVGLPV DRNIPLVAFI GRLEEQKGPD VMAAAIPQLM 420 EMVEDVQIVL LGTGKKKFER MLMSAEEKFP GKVRAVVKFN AALAHHIMAG ADVLAVTSRF 480 EPCGLIQLQG MRYGTPCACA STGGLVDTII EGKTGFHMGR LSVDCNVVEP ADVKKVATTL 540 QRAIKVVGTP AYEEMVRNCM IQDLSWKGPA KNWENVLLSL GVAGGEPGVE GEEIAPLAKE 600 NVAAP SEQ ID NO.4 MAALATSQLV ATRAGLGVPD ASTFRRGAAQ GLRGARASAA ADTLSMRTSA RAAPRHQQQA 60 RRGGRFPSLV VCASAGMNVV FVGAEAPWS KTGGLGDVLG GLPPAMAANG HRVMVVSPRY 120 DQYKDAWDTS VVSEIKMGDG YETVRFFHCY KRGVDRVFVD HPLFLERVWG KTEEKIYGPV 180 AGTDYRDNQL RFSLLCQAAL EAPRILSLNN NPYFSGPYGE DVVFVCNDWH TGPLSCYLKS 240 NYQSHGIYRD VVLHARIYLI WWWCFSETET ETDCMSV SEQ ID NO.5 AGCAGAGAAGGCAACCTTTGCGT SEQ ID NO.6 TCTGCTGAACTGAACAACGCCGT

Claims

1. A method for improving the waxiness of corn kernels Waxy1 The mutant genotype is characterized by, The nucleotide sequence of the mutant genotype is shown in SEQ ID NO.

2.

2. A method for improving the waxiness of corn kernels Waxy1 The mutant protein is characterized by, The amino acid sequence of the protein is shown in SEQ ID NO.

4.

3. A biomaterial, characterized in that, Includes the mutant as described in claim 1, wherein the biological material is one or more of a recombinant expression vector, plasmid, expression cassette, or recombinant bacteria.

4. A gene knockout vector, characterized in that, The vector uses Wimi-Cas12Y7 as its backbone and contains sgRNAs as shown in SEQ ID NO.5 and SEQ ID NO.

6.

5. A host, wherein the host cell contains the vector of claim 3, wherein the host comprises any one of Escherichia coli, Agrobacterium tumefaciens, or a non-renewable plant part.

6. The application of the mutant genotype as described in claim 1, the mutant protein as described in claim 2, the biological material as described in claim 3, the vector as described in claim 4, the host as described in claim 5, or the kit as described in claim 5 in improving the waxy texture of maize kernels.

7. A method for improving the waxy texture of corn kernels, characterized in that, Including the use of gene editing technology for Waxy The gene is modified; or, the nucleotide sequence of the mutant as described in claim 1 is expressed in wild-type maize, wherein the sgRNA sequence used in the gene editing technology is shown in SEQ ID NO. 5 and SEQ ID NO.

6.

8. A method for breeding maize, characterized in that, Including the use of gene editing technology for Waxy1 Genes are modified; or, the nucleotide sequence of the mutant as described in claim 1 is expressed in wild-type maize.

9. The method as described in any one of claims 7 or 8, characterized in that, The method includes the step of introducing the mutant of claim 1 into a plant cell, plant seed, plant tissue, plant part, or plant, wherein the plant is maize.

10. The method as described in claim 9, characterized in that, The maize in question is the inbred line Zheng 58.

Images