Moso bamboo PeHECT1 gene and application thereof

Abstract

The invention discloses a moso bamboo stalk elongation and drought resistance double-effect regulation gene PeHECT1, and relates to the technical field of plant molecular biology. The PeHECT1 gene overexpression vector is transferred into a japonica rice variety Nipponbare through an agrobacterium tumefaciens-mediated rice mature embryo callus transformation method, and the result shows that compared with a wild type strain, an overexpression strain shows obvious drought resistance under the drought stress condition, the length between stem nodes of the overexpression strain is obviously changed, and the yield of the overexpression strain is obviously increased. The stalk length is obviously shortened. The result provides a theoretical basis for research on moso bamboo stalk elongation and drought resistance, and also provides important resources for rice plant type improvement and drought resistance improvement.

Description

Technical Field

[0001] This invention relates to the field of plant molecular biology; specifically, it relates to a type of moso bamboo. PeHECT1 Genes and their applications. Background Technology

[0003] The rapid growth of moso bamboo is highly dependent on water. Its rapid stem elongation relies on the active division of internode meristems, a process disrupted by drought stress, leading to abnormal internode development. More critically, bamboo lacks a cambium layer, and the xylem vessels formed early in its development must bear the responsibility of water transport throughout its life. Under drought conditions, the xylem is prone to embolism, hindering water conduction and triggering a series of physiological responses, such as stomatal closure and activation of the antioxidant system, to maintain survival. Therefore, elucidating the molecular mechanisms by which moso bamboo balances drought stress and growth, and identifying key regulatory genes, is of urgent practical significance for improving the drought resistance of moso bamboo through molecular breeding and ensuring industrial security. Summary of the Invention

[0004] This invention provides a bamboo gene that can alter rice plant height and drought resistance. PeHECT1 And its applications.

[0005] To address the problems of existing technologies, this invention provides a gene regulating stem elongation and drought resistance in moso bamboo. PeHECT1 The amino acid sequence encoded by the gene is shown in SEQ ID NO:2; preferably, the nucleotide sequence (CDS-encoded sequence) of the gene is shown in SEQ ID No:1.

[0006] As an improvement to the gene of the present invention: the nucleotide sequence further includes mutants, alleles or derivatives generated by adding, substituting, inserting or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID No:1.

[0007] This invention also provides the above-mentioned genes regulating stem elongation and drought resistance in moso bamboo. PeHECT1 The encoded protein has the amino acid sequence shown in SEQ ID NO.2.

[0008] As an improvement to the protein of the present invention: the amino acid sequence further includes an amino acid sequence or derivative generated by adding, substituting, inserting or deleting one or more amino acids or homologous sequences of other species in the amino acid sequence shown in SEQ ID NO.2.

[0009] The present invention also provides a biomaterial, wherein the biomaterial is any one of the following:

[0010] A: An expression cassette capable of overexpressing a gene with a nucleotide sequence as shown in SEQ ID NO.1; B: A recombinant vector containing the expression cassette described in A; C: Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B; D: Non-renewable plant parts containing the expression cassette described in A, the recombinant vector described in B, or the recombinant microorganism described in C.

[0011] Preferably, the recombinant vector is ProUbi::PeHECT1 -GFP-3×Flag; More preferably, the recombinant vector has a multiple cloning site region sequentially linked with a Ubi promoter, PeHECT1 Genes, GFP and Flag genes ProUbi:: PeHECT1 -GFP-3×Flag plant expression vector.

[0012] This invention also provides applications of the above-mentioned gene, protein, or biological material, wherein the application is at least one of the following: A. Enhance drought stress resistance; B. Regulating intersegmental length; C. Regulate plant height.

[0013] Another objective of this invention is to provide a breeding method for improving the drought resistance of moso bamboo by utilizing transgenic techniques to enhance... PeHECT1 The expression level of the gene, the PeHECT1 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0014] Beneficial effects: This invention provides a gene that regulates both stem elongation and drought resistance in moso bamboo. PeHECT1 Its encoded proteins and applications. The method of transforming mature rice embryo callus tissue using Agrobacterium-mediated transformation... PeHECT1 Gene overexpression vectors were transferred into the japonica rice variety *Nipponbare*. Results showed that, compared to wild-type lines, the overexpressing lines not only exhibited significant drought resistance under drought stress but also showed marked changes in stem internode length, with a significant reduction in stem length. These results provide a theoretical basis for studying the balance between stem elongation and drought resistance in bamboo, and also offer important resources for improving rice plant architecture and enhancing drought resistance. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0016] Figure 1 For the present invention PeHECT1 A diagram showing the domain divisions of proteins encoded by genes.

[0017] Figure 2 Constructed for the present invention HECT1 Overexpression vector map information.

[0018] Figure 3 For the present invention PeHECT1 Positive identification images of overexpressing transgenic rice. In the images, A is the electrophoresis image of the positive identification of the overexpressing transgenic plant, N is the negative control, P is the positive control (product amplified using the plasmid as a template), and 1-8 are the transgenic plant numbers; B is the expression level analysis image of the PeHECT1 gene in the overexpressing transgenic rice.

[0019] Figure 4 Overexpression of the present invention PeHECT1 Phenotypic analysis of transgenic rice. PeHECT1-OE-1 and PeHECT1-OE-2 are transgenic rice lines overexpressing PeHECT1; A shows the phenotypic diagram of the overexpressing transgenic rice at the heading stage and the phenotypic diagram of internode length analysis; B shows the plant height of the overexpressing transgenic plants; C shows the paraffin section cell analysis diagram of the overexpressing transgenic rice; D shows the statistical diagram of longitudinal section cell length of the overexpressing transgenic rice stem; Bar = 10cm.

[0020] Figure 5 This is a graph showing the drought resistance analysis of PeHECT1-overexpressing transgenic rice. In the graph, A represents the drought resistance phenotype of PeHECT1-overexpressing transgenic rice; B represents the enzyme activity statistics of transgenic rice under drought stress; Bar = 10 cm. Detailed Implementation

[0021] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0022] Example 1: Cloning and Expression Pattern Analysis of PeHECT1 in Moso Bamboo (1) Gene sequence acquisition Based on the Phyllostachys edulis genome information included in the PLAZA plant database, the gene sequence (SEQ ID No. 1) of the HECT E3 ubiquitin ligase PeHECT1 was obtained, and the PeHECT1 protein sequence was obtained after translation. Analysis of the PeHECT1 protein sequence (SEQ ID No. 2) domains using the InterPro website showed that it possesses a representative HECT domain (see Appendix). Figure 1 ).

[0023] SEQ ID NO.1:

[0024] SEQ ID NO.2: MAPSAPAAPSESDSSSNPSSAVQLFVRNLDSRTAVIRARPEETVEEVLGRLDQAVGRRGDLRLVYAGRDLPPKGTIGALRLPSEATLHINFRLRSTLLPGAWYLASQIIAAAKHSTATAVISPQQLVRTFLDNASTLHRTENASTLPRPRNANTFNRSVAEHLDVFLRSGAAGELVRLYLSKSASDRDTAKGAIECFLQPNAVLQIWTAPVLMEFCRLIGLGAGRSDQLYTACRGMLATVLSMPHWRPPPSPDQPRDWVIEQVVPFAQEMADAVMNRIDAQSWSATATVEATRNLIEFCSFFSVLRREVRALRAPSPPCVPTGATQQSRWKTAPPETIISLLTRVEKCMERFEMTLPRSSRRKRAAPSAEQPHTDWVNSVWTVLTELDAWSWMHKDVALALRAKLAVRKASLDALVLRVGRDRSQGIHWIAKHKDLLTFEARRHLAMTMLPELKRGAAALPLHEMLIDRSRLLSDSFEYITQATREQLHATQFVEFKDEEATGPGVMREWLCMVCHALFNPQHVLFSPCPRDRRRFFLNPSSVVDPLHLKYYGFAGRIIGLALMHKIPVGIFFDRTLFLQLAGIPITLDDIADADPCMHARFRQILEMDPDLVDSDALGLTFAREVEVLGSRKLIELIPGGKDIAVDSNNRRNYIDLLIQDRFVNSTKNQLIHFTEGFTCMLVSSRLCGVVSSQFYRAFFKSLDPEDFDQMLGGSNSTIDVKDWRAHTEYSGYREKDDQINWFWQAVKSMTVEQQRRLLFFWTSVKYLPFDGFDGLSSRLFISRALSESPDHLPSSRTCFYRLNLPDYTSSSMMQSRLQMIVQEHVSSSFGAF 。

[0025] (2) Primer design and synthesis Based on the obtained PeHECT1The full-length CDS sequence of the gene was obtained, and the full-length primer sequence for amplifying the gene CDS was designed (PeHECT1-OE-F): tgttacttctgcaggagctc ATG GCTCCGTCCGCCCCC, SEQ ID No. 3; PeHECT1-OE-R):ctcaccatggatccggtaccGAATGCACCAAAGCTGCTGCTCA, SEQ ID No. 4.

[0026] This includes the start codon ATG (underscore) and a homologous sequence adapter (lowercase letter) for linking the vector. Primers were synthesized by Zhejiang Shangya Biotechnology Co., Ltd., and their purity was determined by PAGE.

[0027] (3) cDNA amplification and product verification Phyllostachys edulis seedlings were collected, flash-frozen in liquid nitrogen, and then stored at -80°C. Total RNA was extracted from the samples using a plant total RNA extraction kit, and the first strand of cDNA was synthesized by reverse transcription. Using this cDNA as a template, PCR amplification was performed using specific primers PeHECT1-OE-F and PeHECT1-OE-R, along with 2×PhantaMax Master Mix (Dye Plus) high-fidelity DNA polymerase from Novizan, to amplify the complete coding sequence (CDS) of the PeGPR10 gene at the target site. A full-length CDS sequence of 2502 bp was obtained, and sequencing showed that its sequence is shown in SEQ ID NO.1.

[0028] Example 2: Overexpression of moso bamboo PeHECT1 Functional verification of genes (1) Overexpression vector ProUbi::PeHECT1 Construction of -GFP-3×Flag Using moso bamboo cDNA as a template, the complete coding region of the PeHECT1 gene was amplified using primers SEQ ID No. 3 and SEQ ID No. 4. The basic vector ProUbi::GFP-3×Flag (the same ProUbi::GFP-3×Flag as in CN118620953B) was linearized using the restriction endonuclease Sac I. The PeHECT1 CDS fragment was then inserted into the vector ProUbi::GFP-3×Flag via homologous recombination to construct the recombinant plasmid. ProUbi::PeHECT1 -GFP-3×Flag. The recombinant plasmid was heat-shocked and transformed into DH5α E. coli competent cells (Shanghai Weidi Biotechnology, CAT#:DL1001s, 20×100ul), and positive clones were screened and sequenced for verification (see appendix). Figure 2 ).

[0029] (2) Genetic transformation of rice as a model plant and identification of transgenic plants Recombinant plasmids were prepared by electroporation. ProUbi::PeHECT1 -GFP-3×Flag was introduced into Agrobacterium tumefaciens strain EHA105 (Shanghai Weidi Biotechnology, CAT#:AE1010S, 10×50ul), and Agrobacterium-mediated transformation was used to transform mature embryo-induced callus tissue of the japonica rice variety Nipponbare. After two weeks of induction in induction medium, vigorously growing callus tissue was selected as recipient material and placed in a medium containing... ProUbi::PeHECT1 In a suspension of Agrobacterium tumefaciens EHA105 containing -GFP-3×Flag, shake and infect for 30 minutes. Spread the infected Nipponbare callus evenly on sterile filter paper. After the bacterial solution is absorbed, transfer the callus to a culture medium and co-culture at 28°C in the dark for 3 days. Clean the co-cultured callus with sterile water containing 400 mg / L carbenicillin. Spread the callus on a selection medium containing 50 mg / L hygromycin and 400 mg / L carbenicillin and culture under light for about 20 days. Transfer the predifferentiated callus to a differentiation medium and continue culturing under light until resistant callus seedlings emerge. Transfer the seedlings to a rooting medium and continue culturing until they reach 10-15 cm in length and have rooted. Open the sealing film of the vial, pour in sterile water, harden the seedlings for 3 days, and then transplant them into a greenhouse.

[0030] Genomic DNA of the PeHECT1 gene was extracted from transgenic rice using the CATB method. PCR molecular detection was performed using primers ubi-F: TTGATATACTTGGATGATGGCATA (SEQ ID NO.5) and PeHECT1-DNAR: GAATGCACCAAAGCTGCTGCTCA (SEQ ID NO.6). The PCR products were subjected to 1.5% agarose gel electrophoresis and observed using a gel imaging system (see Appendix). Figure 3 (See Appendix A). Eight positive transgenic plants were screened, and after two generations of self-pollination, eight homozygous independent transgenic lines were obtained. Among them, the expression levels of OE-1 and OE-2 reached 1005 and 1191 times, respectively (see Appendix A). Figure 3 (B)

[0031] (3) Overexpression PeHECT1 Regulation of rice plant height and internode length Phenotypic analysis was performed on the two transgenic lines with the highest expression levels, PeHECT1-OE1 and PeHECT1-OE2. Compared with the wild type (WT), PeHECT1-OE1 and PeHECT1-OE2 showed significantly reduced plant height and shortened internode length (see Appendix). Figure 4 (A and B). Paraffin sections of the stems showed that stem cell elongation was inhibited in the overexpression lines (see Appendix). Figure 4 (C)

[0032] (4) Overexpression PeHECT1 Regulation of drought resistance in rice Three-leaf stage rice seedlings were subjected to a 3-day drought-simulated treatment with 20% PEG6000. The results showed that wild-type plants exhibited wilting and drooping leaves, while PeHECT1-overexpressing lines maintained upright growth with no significant water loss in their leaves. After 24 hours of rehydration, wild-type seedlings partially recovered, while the overexpressing lines... PeHECT1 More rice lines showed phenotypic recovery (see appendix) Figure 5 (See Appendix A). Further analysis of oxidative stress indicators revealed that under PEG treatment, the activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) in the overexpression lines were significantly increased (P<0.05), while the hydrogen peroxide (H2O2) content was significantly decreased (P<0.01) (see Appendix A). Figure 5 (B) The results show that PeHECT1 Overexpression can significantly improve the drought adaptability of plants by enhancing antioxidant enzyme activity and reducing hydrogen peroxide content in the body.

[0033] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0034] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. PeHECT1 Genes, characterized by, The amino acid sequence encoded by the gene is shown in SEQ ID NO.

2.

2. As described in claim 1 PeHECT1 Genes, characterized by, The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. PeHECT1 protein, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.

2.

4. A biomaterial, characterized in that, The biomaterial is any one of the following: A: An expression cassette capable of overexpressing a gene with a nucleotide sequence as shown in SEQ ID NO.1; B: A recombinant vector containing the expression cassette described in A; C: Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B; D: Non-renewable plant parts containing the expression cassette described in A, the recombinant vector described in B, or the recombinant microorganism described in C.

5. The biomaterial according to claim 4, characterized in that, The recombinant vector is ProUbi::PeHECT1 -GFP-3×Flag.

6. The biomaterial according to claim 5, characterized in that, The recombinant vector has a multiple cloning site region sequentially linked to the Ubi promoter, PeHECT1 Genes, GFP and Flag genes ProUbi::PeHECT1 -GFP-3×Flag plant expression vector.

7. The application of the gene of claim 1 or 2, or the protein of claim 3, or the biological material of any one of claims 4-6, characterized in that, The application is at least one of the following: A. Enhance drought stress resistance; B. Regulating intersegmental length; C. Regulate plant height.

8. A breeding method for improving the drought resistance of moso bamboo, characterized in that, Using genetic engineering to improve PeHECT1 The expression level of the gene, the PeHECT1 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

Images