DHX36 gene molecular marker related to motility traits of bovine sperms and application of DHX36 gene molecular marker
By identifying the CG base mutation at position 231 of the bovine DHX36 gene, and using specific primer sets to detect bovine sperm motility traits, highly freeze-resistant bulls were screened, solving the problem of insufficient motility of bovine frozen semen after thawing and improving the quality and fertilization efficiency of frozen semen products.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-17
- Publication Date
- 2026-04-14
AI Technical Summary
In existing technologies, the motility of frozen bovine semen after thawing is less than half of that before freezing, resulting in reduced fertilization efficiency. Furthermore, there are significant differences in freeze resistance among different individuals, making it difficult to improve batch consistency and quality of frozen semen products through genotypic selection.
By identifying the CG base mutation at position 231 of the bovine DHX36 gene, a specific primer set was provided for detecting bovine sperm motility traits. Using SNP sites as molecular markers, high-freezing-resistant bulls were screened to achieve genotype selection.
It significantly improved the normal and post-thaw motility of bovine sperm, enhanced the quality consistency and fertilization efficiency of frozen semen products, and provided a theoretical basis for genetic improvement.
Smart Images

Figure CN121852566A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of animal genetic engineering technology, and in particular relates to a molecular marker of the DHX36 gene associated with bovine sperm motility and its application. Background Technology
[0002] Artificial insemination technology holds a central position in the genetic improvement of modern beef and dairy cattle, stemming not only from the large-scale utilization of breeding bull genetic resources but also profoundly from the meticulous management of frozen semen quality control. Under the influence of ultra-low temperature freezing and thawing, sperm cell membranes and mitochondrial structures face the dual challenges of cold shock and mechanical damage from ice crystals, resulting in post-thawing semen motility being less than half of its pre-freezing value, thus weakening its ability to fertilize oocytes. To ensure fertilization efficiency, the motility of thawed bovine frozen semen must not be lower than 40%, a threshold that has become a rigid benchmark for farm operations and semen quality inspection.
[0003] The final quality of semen is influenced by factors such as semen collection management, dilution formulation, freezing procedures, and individual genetic background. Among these, genetic heterogeneity among bull individuals constitutes a key variable—significant differences exist in the tolerance of sperm to freezing stress among different individuals, and differences in their antifreeze phenotype can lead to fluctuations in sperm motility exceeding 20% after thawing. Single nucleotide polymorphisms (SNPs), due to their high-density and high-throughput detection characteristics, have become the preferred tool for elucidating the genetic basis of sperm antifreeze properties. Currently, several SNP loci have been identified that are significantly associated with sperm motility, membrane integrity, and mitochondrial function after freezing and thawing. These loci can serve as molecular markers for early screening of highly antifreeze bulls, enabling a leap from "phenotypic selection" to "genotypic selection," and systematically improving the batch consistency and quality of frozen semen products.
[0004] Studies have shown that the DHX36 (DEAH-box helicase 36) gene can untie the G4 structure in DNA / RNA, which is crucial for regulating gene transcription and translation. Its absence in spermatocytes leads to meiotic defects. Other studies have also indicated that DHX36 plays a role in early germ cell differentiation and late spermatogenesis; its deficiency leads to germ cell degeneration, increased epithelial cell vacuolation, and reduced sperm count, suggesting a potential impact on sperm quality. However, whether and how DHX36 SNPs affect sperm cryopreservation resistance, especially post-thaw motility, remains unclear. Summary of the Invention
[0005] The purpose of this invention is to provide a molecular marker of the DHX36 gene associated with bovine sperm motility traits and its application, aiming to solve the problems raised in the background art.
[0006] To achieve the above objectives, the present invention provides the following technical solution:
[0007] The application of a molecular marker of the DHX36 gene associated with bovine sperm motility traits in the preparation of a kit for detecting bovine sperm motility traits in normal and thawed conditions, wherein the bovine sperm motility traits include bovine sperm motility traits in both normal and thawed conditions; the DHX36 gene molecular marker is located at position 231 of the bovine DHX36 gene fragment as shown in SEQ ID NO:1, where there is a CG base mutation, resulting in a single nucleotide polymorphism in the gene.
[0008] Another object of the present invention is to provide a specific primer set, wherein the specific primer set is used to identify the molecular marker of the DHX36 gene associated with bovine sperm motility traits, comprising a forward primer and a reverse primer as shown in SEQ ID NO:2-3, respectively; the bovine sperm motility traits include the motility traits of normal bovine sperm and thawed sperm; the DHX36 gene molecular marker is the 231st site of the bovine DHX36 gene fragment as shown in SEQ ID NO:1, which has a CG base mutation, resulting in a single nucleotide polymorphism in the gene.
[0009] Another object of the present invention is to provide the application of the above-mentioned specific primer set in the preparation of a kit for detecting the normal and thawed motility traits of bovine sperm.
[0010] This invention provides a molecular marker for the DHX36 gene associated with bovine sperm motility. Genotype determination through sequencing allows for association between genotype and normal and thawed sperm motility. Analysis results show significant differences in normal and thawed sperm motility among individuals with different genotypes. This invention utilizes a specific primer set to obtain the bovine DHX36 gene fragment associated with normal and thawed sperm motility, and uses specific SNP sites within this fragment as molecular markers, providing a theoretical basis and practical application for marker-assisted selection in cattle. Attached Figure Description
[0011] Figure 1 The results of 1.5% agarose gel electrophoresis are shown for the DHX36 gene amplification products in Example 1. In the figure, lane M is the standard molecular weight marker, and lanes 1-5 are 5 randomly detected PCR products with a clear and specific band at the 452bp position.
[0012] Figure 2 The image shows the sequencing peaks of the PCR products of the three genotypes of the DHX36 gene in Example 1. In the image, the arrows indicate the mutation sites; for CC genotype individuals, the site is a C base; for CG genotype individuals, the site is a C / G base; and for GG genotype individuals, the site is a G base.
[0013] Figure 3The results of 1.5% agarose gel electrophoresis are shown for the DHX36 gene amplification products in Example 2. In the figure, lane M is the standard molecular weight marker, and lanes 1-6 are 6 randomly detected PCR products, which have a clear and specific band at the 452bp position.
[0014] Figure 4 The image shows the sequencing peaks of the PCR products of the three genotypes of the DHX36 gene in Example 2. In the image, the arrows indicate the mutation sites; for CC genotype individuals, the site is a C base; for CG genotype individuals, the site is a C / G base; and for GG genotype individuals, the site is a G base. Detailed Implementation
[0015] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0016] In one embodiment of the present invention, a specific mutation site of the bovine DHX36 gene fragment (452 bp, nucleotide sequence as shown in SEQ ID NO:1) is identified by cloning the fragment to serve as a method for detecting polymorphisms in genes related to normal bovine sperm motility and thawed sperm motility, providing a meaningful DHX36 gene molecular marker for bovine marker-assisted breeding. Specifically, the DHX36 gene molecular marker is the 231st site of the bovine DHX36 gene fragment as shown in SEQ ID NO:1, which has a CG base mutation, resulting in a single nucleotide polymorphism.
[0017] In another embodiment of the present invention, a specific primer set is also provided, wherein the specific primer set is used to identify the above-mentioned molecular marker of the DHX36 gene associated with bovine sperm motility traits, specifically including the forward primer and the reverse primer as shown in sequence listing SEQ ID NO:2-3, respectively.
[0018] In another embodiment of the present invention, a method for screening molecular markers suitable for bovine sperm normal and thawed motility traits and for use in bovine marker-assisted selection is also provided. The DHX36 gene molecular marker is used to screen or evaluate breeding bulls with high sperm normal and thawed motility. The method specifically includes the following steps:
[0019] S1. Genomic DNA is extracted from the blood of individuals to be screened and amplified by PCR using the specific primer set mentioned above to obtain PCR products. Due to the presence of a CG base mutation at position 231 of the DNA sequence of the PCR product fragment, SNP polymorphism is generated.
[0020] S2. Sequencing the PCR product to determine the base type at position 231, and obtaining the sequencing results;
[0021] S3. The genotypes of the individuals to be screened were determined based on the sequencing results, and correlation analysis was performed with the normal and thawed sperm motility traits of bovine sperm. The genotypes included CC, CG, and GG. The results showed that individuals with specific genotypes would have higher normal and thawed sperm motility. Specifically, individuals with CC genotypes had better normal and thawed sperm motility than those with CG and GG genotypes.
[0022] In this embodiment of the invention, by association analysis of the genetic polymorphism of the bovine DHX36 gene and the normal and thawed sperm motility traits, the influence of the DHX36 gene specific site SNP and its genetic polymorphism on normal and thawed sperm motility was clarified. This embodiment of the invention provides an important theoretical basis and application prospect for using the DHX36 gene as a molecular marker for auxiliary selection of normal and thawed sperm motility and related reproductive performance in bovine production, and for its application in genetic improvement.
[0023] The following embodiments are implementation examples of the technical solution of the present invention in practical applications, but are not limited thereto. Unless otherwise specified, all materials and reagents involved are commercially available products; unless otherwise specified, all experimental methods used are conventional methods.
[0024] Example 1: This example uses extracted bovine genomic DNA as a template, designs a pair of specific primers, clones a partial DNA sequence of the bovine DHX36 gene, and performs sequencing and genotyping. The association between different genotypes and normal and thawed bovine sperm motility traits is then analyzed to provide molecular markers for marker-assisted selection in cattle, as detailed below:
[0025] 1. Cloning of a partial DNA fragment of the bovine DHX36 gene: To ensure good primer quality, the specific primers used in this embodiment of the invention were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the specific sequences of the specific primers are as follows:
[0026] Forward primer: DHX36-fwd (as shown in SEQ ID NO:2 in the sequence listing): TGCGGTGTCTGATCC;
[0027] Reverse primer: DHX36-rev (as shown in SEQ ID NO:3 in the sequence listing): CTATGATTAAAACGACTCCC.
[0028] The Taq enzyme, buffer, magnesium ions, dNTPs, etc. required in the PCR reaction can be selected by the user. To obtain good results quickly, this embodiment of the invention uses the 2× chemical dye quantitative PCR premix from MonAmp Biotechnology Co., Ltd. for PCR amplification. The specific reaction system is as follows: 10.0 μL of 2×MonAmp ChemoHS qPCR Mix (provided in the product packaging), 0.5 μL each of forward and reverse primers (concentration of 10 pmol / μL), 0.5 μL of genomic DNA (containing 10-50 ng DNA), and 8.5 μL of distilled water. The PCR reaction conditions are: 94℃ pre-denaturation for 1 minute; 94℃ denaturation for 45 seconds, 60℃ annealing for 45 seconds, 72℃ extension for 45 seconds, for a total of 35 cycles; and a final extension at 72℃ for 5 minutes.
[0029] 2. PCR product sequencing and genotype determination: Bovine genomic DNA was amplified using primers DHX36-fwd (SEQ ID NO:2) and DHX36-rev (SEQ ID NO:3) to obtain a specific amplified fragment of 452 bp. The sequence of this fragment is shown in SEQ ID NO:1 of the sequence listing, specifically:
[0030] TGCGGTGTCTGATCCCCACTTGTAAATGTGGAAGAGTGGTGAAAATCCTAAACTACTGATTCAATAAAAAGTGTTTTAAGATCCCTGTCTGTAGATCTGGTATAGGCTAATATGCTTTAGATGTGTTTTTAACAATTTTTATGTATTTGTTTTCCAAACAGCATTACCATTGATGATGTAGTTTATGTAATAGATGGAGGAAAAATAAAAGGAGACGCACTTTGACA CACAGAACAACATCAGTACAATGTCTGCTGAGTGGGTCAGTAAAGCCAATGCTAAACAGAGGAAGGGTCGAGCTGGAAGGTAAGATCAGACCTTTGAAGTCCTTACAAAAACACCAAAAATTTTGTGTACCAAATTTACTTAAGGAAGTTCCCTTTCAGCTTTTAAAAACTTAACTGCAGCATGTTTTTACTCCCCAGCAGATGGGGGAGTCGTTTTAATCATAG.
[0031] Sequencing results revealed that a CG mutation at position 231 of the 452 bp fragment led to the development of different genotypes: CC, CG, and GG. Specifically, CC-type individuals were homozygous for C at position 231; CG-type individuals were C / G heterozygous at position 231; and GG-type individuals were homozygous for G at position 231 (e.g., ...). Figure 2 (As shown).
[0032] 3. Marker-Track Association Analysis: Using the applicant's experimental population as the experimental subjects, a marker-track association analysis was conducted. The One-Way ANOVA procedure in SPSS 22.0 software was used to establish the following statistical analysis model for the marker-track association analysis:
[0033] The statistical analysis model is: Y ij =μ+G i +e j .
[0034] Among them, Y ij G represents the phenotypic value of the observed individual's productive performance; μ represents the least squares mean of productive performance; G i e represents the effect of genotype on production performance. j This represents the random residuals corresponding to the observed values.
[0035] 4. Cloning of partial DNA sequence of bovine DHX36 gene and determination of different genotypes: PCR amplification products were detected by 1.5% agarose gel electrophoresis, showing them to be specific PCR products, such as... Figure 1 As shown in the image. The PCR product was recovered and sequenced, revealing a product length of 452 bp. Sequencing results showed a CG base mutation at position 231 bp of this fragment, with some sequencing peaks as shown in the image. Figure 2 As shown.
[0036] 5. Association analysis of marker traits: Association analysis of the SNP site at position 231 of the amplified sequence of the bovine DHX36 gene with normal sperm motility and post-thaw motility in bovine sperm showed that, among 94 randomly selected individuals, 18 were of the CC genotype, 23 were of the CG genotype, and 53 were of the GG genotype. The results of the significant differences (mean ± standard error) in sperm motility and normal sperm motility among individuals with different genotypes are shown in Table 1.
[0037] Table 1. Results of the analysis of significant differences in sperm motility between individuals with different genotypes and those after thawing in Example 1.
[0038] Sperm characteristics CC type individuals CG type individuals GG type individuals Normal vitality (%) <![CDATA[81.69 ± 1.31 a ]]> <![CDATA[76.24 ± 1.21 b ]]> <![CDATA[72.79 ± 0.71 c ]]> Viability after thawing (%) <![CDATA[48.25 ± 1.30 a ]]> <![CDATA[45.49 ± 0.37 b ]]> <![CDATA[43.13 ± 0.32 c ]]>
[0039] Note: In the same row, different letters on the shoulder labels of different groups of data indicate significant differences (P<0.05).
[0040] The analysis results showed that there were significant differences in sperm normality and post-thaw motility among individuals corresponding to different genotypes at this SNP locus. Overall, the sperm normality and post-thaw motility of CC-type individuals were better than those of CG or GG-type individuals. When selecting breeding bulls, CC-type individuals should be given priority, while GG-type individuals should be avoided as much as possible.
[0041] Example 2: Sixty-six individuals were randomly selected from the breeding bull population at the bull station. Blood samples were collected for genomic DNA extraction, and PCR amplification was performed using the specific primers, PCR reaction system, and conditions described above. PCR amplification was performed using 2× chemical dye-based quantitative PCR premix from MonAmChemo HS. The specific reaction system consisted of: 10.0 μL of 2×MonAmChemoHS qPCR Mix, 0.5 μL each of forward and reverse primers (both at a concentration of 10 pmol / μL), 0.5 μL of genomic DNA (containing 10-50 ng DNA), and 8.5 μL of distilled water. The PCR reaction conditions were: 94℃ pre-denaturation for 1 minute; 94℃ denaturation for 45 seconds, 60℃ annealing for 45 seconds, 72℃ extension for 45 seconds, for a total of 35 cycles; and a final extension at 72℃ for 5 minutes.
[0042] The amplification products were detected by 1.5% agarose gel electrophoresis, and the results showed that they were specific PCR products. Figure 3 As shown, lane M represents the standard molecular weight marker, and lanes 1-6 contain randomly selected PCR products for testing. The PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Sequencing results showed a CG base mutation at 231 bp in this fragment, with some sequencing peaks as shown... Figure 4 As shown. Of the 66 individuals examined, 14 were of the CC type; 18 were of the CG type; and 34 were of the GG type.
[0043] Based on the sperm normality and post-thaw motility records of these 66 individuals, correlation analysis was performed using the corresponding data. The correlation analysis method was the same as in Example 1. The correlation analysis results (least squares value and standard deviation) between different genotypes and sperm normality and post-thaw motility in these 66 individuals are shown in Table 2.
[0044] Table 2. Results of analysis of significant differences in sperm motility between individuals with different genotypes and those with normal sperm and sperm motility after thawing in Example 2.
[0045] Sperm characteristics CC type individuals CG type individuals GG type individuals Normal vitality (%) <![CDATA[82.99 ± 1.47 a ]]> <![CDATA[78.01 ± 1.05 b ]]> <![CDATA[72.93 ± 1.02 c ]]> Viability after thawing (%) <![CDATA[47.34 ± 0.73 a ]]> <![CDATA[45.98 ± 0.37 b ]]> <![CDATA[43.12 ± 0.44 c ]]>
[0046] Note: In the same row, different letters on the shoulder labels of different groups of data indicate significant differences (P<0.05).
[0047] The analysis results show that individuals corresponding to different genotypes of the SNP locus provided in this embodiment of the invention exhibit significant differences in sperm normality and post-thaw motility traits. CC-type individuals show better sperm normality and post-thaw motility than CG and GG-type individuals. Therefore, this embodiment of the invention provides an important theoretical basis and has good application prospects for using this SNP locus as a molecular marker for auxiliary selection of bull reproductive and production performance and for its application in genetic improvement.
[0048] Based on the above-described preferred embodiments of the present invention, and through the foregoing description, those skilled in the art can make various changes and modifications without departing from the inventive concept. The technical scope of this invention is not limited to the contents of the specification.
Claims
1. The application of a molecular marker of the DHX36 gene associated with bovine sperm motility in the preparation of a kit for detecting the motility of normal and thawed bovine sperm, characterized in that, The bovine sperm motility traits include normal and thawed bovine sperm motility traits; the DHX36 gene molecular marker is the 231st site of the bovine DHX36 gene fragment as shown in SEQ ID NO:1, where there is a CG base mutation, resulting in a single nucleotide polymorphism in the gene.
2. A specific primer set, characterized in that, The specific primer set is used to identify the molecular marker of the DHX36 gene associated with bovine sperm motility traits, and includes forward and reverse primers as shown in SEQ ID NO:2-3, respectively; the bovine sperm motility traits include the motility of bovine sperm in normal condition and after thawing; the DHX36 gene molecular marker is position 231 of the bovine DHX36 gene fragment shown in SEQ ID NO:1, which has a CG base mutation, resulting in a single nucleotide polymorphism in the gene.
3. The use of the specific primer set as described in claim 2 in the preparation of a kit for detecting the normal and thawed motility traits of bovine sperm.
Citation Information
Patent Citations
SNP (single-nucleotide polymorphism) sites related to thawed stud bull frozen semen activity and deformity rate and application thereof
CN105886639A
Methods of identifying male fertility status and embryo quality
WO2017024311A1