Molecular marker related to content of chicken flavor substance (E, E)-2, 4-decadienal and breeding application method
The SNP molecular marker rs316165567, screened by GWAS and validated in vitro, solved the problem of low screening efficiency for chicken flavor traits, and achieved genetic improvement of chicken flavor quality and increased breeding efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-19
- Publication Date
- 2026-04-14
AI Technical Summary
Existing technologies are insufficient for efficiently and accurately screening and improving the flavor traits of chicken, especially the content of (E,E)-2,4-decadienal, resulting in low breeding efficiency and high costs.
The SNP molecular marker rs316165567 was screened on chicken chromosome 14 using genome-wide association analysis (GWAS), and its significant correlation with the content of (E,E)-2,4-decadienal was verified by in vitro experiments. Primers were provided for PCR amplification and genotyping to realize molecular marker-assisted breeding.
It significantly increased the content of (E,E)-2,4-decadienal in chicken meat, improved the flavor quality of chicken meat, increased breeding efficiency and economic benefits, and provided a genetic improvement pathway for the flavor quality of chicken meat.
Smart Images

Figure CN121852569A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene detection technology, specifically relating to a molecular marker and its selection and application method related to the content of chicken flavor compound (E,E)-2,4-decadienal. Background Technology
[0002] Chicken is the second largest source of meat protein for Chinese consumers, and its unique flavor, rich nutrition, high protein, and low fat content make it a popular and high-quality meat product. With the rapid development of livestock and poultry farming and the continuous improvement of people's living standards, consumer demand for chicken has shifted from pursuing quantity to demanding quality. Aroma is a core indicator of chicken quality. Therefore, increasing the content of aroma compounds in chicken is one of the most direct ways to improve its quality. The aroma of meat is produced by VOCs entering the nasal cavity with airflow. However, due to the complexity and trace amounts of VOCs in chicken, large-scale, precise direct phenotypic screening is costly and inefficient in practice, becoming a major bottleneck in the genetic improvement of flavor traits. Against this backdrop, indirectly improving these traits through molecular marker-assisted selection is an effective way to improve breeding efficiency and achieve genetic improvement of chicken flavor quality.
[0003] VOCs are produced from aroma precursors in meat through complex chemical changes, including aldehydes, alcohols, and alkanes. Aldehydes have a low threshold and are considered to contribute significantly to the aroma of chicken. Furthermore, multiple studies using GC-O, OAV, recombination, and deletion methods have identified (E,E)-2,4-decadienal as a key component of chicken aroma, primarily derived from fatty acid metabolism (especially linoleic acid). Current research largely focuses on the metabolic mechanism of (E,E)-2,4-decadienal, but candidate genes and molecular markers regulating (E,E)-2,4-decadienal content in chicken are rarely reported.
[0004] PRKAR1B The gene-encoded protein (R subunit) is an important component of the protein kinase A (PKA) complex. Literature indicates that PKA can phosphorylate genes related to fatty acid metabolism, such as FABP4 and PLCD1. Therefore, it is evident that… PRKAR1B This gene is a potential important functional candidate gene affecting (E,E)-2,4-decadienal in chicken meat; however, to date, no research reports have identified functional mutation sites in this gene. This invention, through various omics analyses and in vitro experiments, confirms that… PRKAR1B The gene is an important functional gene that affects the content of (E,E)-2,4-decadienal, a flavor compound in chicken, and provides an important gene target for the genetic improvement of chicken flavor quality traits. Summary of the Invention
[0005] The primary objective of this invention is to provide an SNP molecular marker and its selection and application method that is significantly correlated with the content of (E,E)-2,4-decadienal, a flavor compound in chicken.
[0006] To address the needs of breeding and production practices, this invention uses the representative local chicken breed, Beijing You Chicken (BY, n=405), as the experimental material. During the rearing process, a free-feeding and watering pattern was adopted, and the diet followed the feeding standards for yellow-feathered broilers (NY / T33-2004). Slaughter was conducted at 135 days of market age, and breast muscle samples were collected. The content of (E,E)-2,4-decadienal was determined using gas chromatography-mass spectrometry (GC-MS). Further, combined with whole-genome resequencing data, genome-wide association analysis (GWAS) was performed to screen and identify SNP molecular markers significantly associated with the (E,E)-2,4-decadienal content in chicken meat. The results of this study provide crucial evidence for marker-assisted breeding and contribute to the genetic improvement of chicken meat flavor and quality.
[0007] Screening for molecular markers associated with (E,E)-2,4-decadienal faces numerous challenges, including the susceptibility of their concentrations to various factors and their relatively weak genetic effects. To improve the reliability of research, it is necessary to obtain accurate and stable phenotypic data through large-sample assays, and to utilize deep whole-genome resequencing to fully explore genetic variations within the population. Based on this, combining phenotypic and genotypic data for GWAS analysis and in vitro experimental identification can more effectively identify reliable molecular markers significantly associated with this substance.
[0008] Specifically, the technical solution of the present invention is as follows: A molecular marker associated with the chicken flavor compound (E,E)-2,4-decadienal, wherein the SNP molecular marker is rs316165567, which contains a nucleotide sequence with a C / A polymorphism at position 2,519,798 bp on chicken chromosome 14; The physical locations of the above molecular markers are referenced from the GRCg6a version of the chicken reference genome (the sequence information of the Gallus_gallus-6.0 version of the chicken reference genome published in NCBI).
[0009] In this invention, the genotype of the molecular marker rs316165567 was significantly correlated with the content of (E,E)-2,4-decadienal in chicken meat. Specifically, when the genotype at this locus was AA, the content of (E,E)-2,4-decadienal in the corresponding chicken meat sample was higher; when the genotype was AC, the content was intermediate; and when the genotype was CC, the content was lower.
[0010] Molecular marker rs316165567 showed significant performance in functional prediction and evolutionary conservation. Its chCADD score of 9.654 suggests that this site has a high potential functional influence; at the same time, its PhastCons score is as high as 0.997, indicating that this site is highly conserved during evolution.
[0011] The present invention also provides primers for amplifying the above-mentioned molecular markers.
[0012] In this invention, the primers for amplifying the molecular marker rs316165567 are shown in SEQ ID NO. 1-2; SEQ ID NO. 1: CCTGAGCTCGCTAGCCTCGAG SEQ ID NO.2: CAGTACCGGATTGCCAAGCTT The present invention also provides a reagent or kit containing the above-mentioned primers.
[0013] The present invention further provides any of the above applications of the molecular markers, primers, reagents, or kits: (1) Application of molecular marker-assisted early prediction of (E,E)-2,4-decadienal content in chicken meat; (2) Application in the identification of flavor quality of superior chicken germplasm resources; (3) Application in improving the flavor and quality of local chickens and new breeds (breeding systems); Among them, (E,E)-2,4-decadienal refers to the core VOCs that contribute significantly to the aroma of chicken.
[0014] This invention also provides a molecular breeding method for high-quality chickens, comprising: (1) Extract genomic DNA from the chickens to be tested; (2) Using DNA as a template, perform PCR amplification using the primers described above; (3) Analyze the PCR amplification products to determine the genetic potential of chickens for breeding and propagation.
[0015] In this invention, step (3) includes: performing allele detection on the amplification products, and determining the following based on the genotyping results: The genotype of the polymorphic site contained in the molecular marker rs316165567 is AA, indicating that the chicken meat tested has a high level of (E,E)-2,4-decadienal.
[0016] The beneficial effects of this invention are as follows: The molecular-assisted breeding technology for (E,E)-2,4-decadienal content in chicken meat of the present invention can improve the (E,E)-2,4-decadienal content in chicken breast muscle by determining the genotype of the SNP locus of the chicken to be tested and selecting for the flavor and quality traits of high-quality broiler chickens in the early stage. It has great industrial application value, economic value, and scientific research value. Attached Figure Description
[0017] Figure 1 This is a Manhattan plot and a Quantile-quantile plot (QQP) of the GWAS analysis of the chicken flavor compound (E,E)-2,4-decadienal on chromosome 14 of Beijing Oil Chicken in this embodiment of the invention. The left Manhattan plot shows chromosomes 1-28 on the X-axis. The blue dashed line represents the potential significance threshold at the whole-genome level (-log10(1 / 368032)=5.57), and the red solid line represents the significance threshold (-log10(0.05 / 368032)=6.87). Values above the threshold are considered significantly correlated with the content of the substance at that SNP site. The right QQP plot shows the degree of fit between the observed and expected values.
[0018] Figure 2 The difference in (E,E)-2,4-decadienal content among different genotypes of rs316165567 in this invention. Figure 3 For the transcriptome PRKAR1B Correlation between gene expression data and (E,E)-2,4-decadienal content.
[0019] Figure 4 This is a graph showing the dual-luciferase reporter results for rs316165567. The wild-type homozygous genotype is CC, and the mutant homozygous genotype is AA. When rs316165567 mutates from CC to AA... PRKAR1B Increased gene promoter activity.
[0020] Figure 5 The left side shows the correlation between important VOCs. The right side shows the differences in the content of other important VOCs, except for (E,E)-2,4-decadienal, among different subtypes of rs316165567.
[0021] Figure 6 Analysis of the meat aroma intensity and overall acceptability of exogenously added (E,E)-2,4-decadienal.
[0022] Figure 7 A comparison of (E,E)-2,4-decadienal content in Beijing Oil Chicken and Wenchang Chicken. Detailed Implementation
[0023] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the present invention. Modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the present invention are all within the scope of the present invention.
[0024] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the equipment and reagents used in the examples are all commercially available.
[0025] Detailed information on the molecular markers of this invention is shown in Table 1, and primer information is shown in Table 2.
[0026] Table 1. Detailed information on molecular markers
[0027] Specifically, this includes the C / A mutation at position 2,519,798 on chicken chromosome 14 (GGA14).
[0028] Table 2 Primer Information
[0029] The detection of the above molecular marker site genotypes can be performed using the genome of the chicken to be tested as a template. After PCR amplification using the primers (SEQ ID NO.1-2) in Table 2, the alleles of the amplification primers can be detected and sequenced using direct sequencing or other effective methods.
[0030] This site is located in the negative strand of the gene. PRKAR1B Within the introns. To follow convention and be consistent with genome browser coordinates, all primers and sequence information in this paper are represented by the complementary sequence of the positive strand (reference strand) corresponding to that site.
[0031] The PCR reaction program was as follows: 94℃ for 5 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 1 min, for a total of 35 cycles; 72℃ for 5 min. The PCR reaction volume (in 20 μl units) consisted of: 10 pg-1 μg template DNA, 0.5 μl upstream primer, 0.5 μl downstream primer, 10 μl 2×Taq PCR MasterMix, and ddH2O to a final volume of 20 μl.
[0032] Example 1. GWAS analysis to identify SNP sites associated with the content of (E,E)-2,4-decadienal, a flavor compound in chicken. The experimental animals used in this invention were Beijing Oil Chickens (n=405). During the rearing process, they were allowed free access to feed and water, and their diet followed the feeding standards for yellow-feathered broilers (NY / T33-2004). After slaughter at 135 days of age, the content of the flavor quality trait (E,E)-2,4-decadienal was determined using GC-MS (detailed data are described in Table 3).
[0033] Table 3. Descriptive statistics of phenotypic data
[0034] DNA Extraction: 0.5 mL blood samples were collected from the wing veins of all experimental chickens using blood collection tubes. Whole-genome DNA was extracted using the standard phenol-chloroform method. Subsequently, the concentration and purity (OD260 / 280 and OD260 / 230 ratios) of the DNA samples were determined using a Nanodrop 2000 / 2000C nucleic acid and protein analyzer. After passing the initial testing, the purity and integrity of the samples were further verified by 0.7% agarose gel electrophoresis. Finally, DNA samples meeting quality control requirements were sent to BGI Genomics Co., Ltd. in Shenzhen for whole-genome resequencing.
[0035] Quality control was performed on the genotypic data of 405 individuals using PLINK v1.9 software. The quality control criteria were set as follows: locus detection rate (geno) > 0.95, minimum allele frequency (MAF) > 0.05, and individual detection rate (mind) > 0.95. A total of 9,085,690 SNP loci were retained after quality control. Subsequently, based on the quality-controlled genotypic data, GWAS analysis of the flavor compound (E,E)-2,4-decadienal was performed using GEMMA software.
[0036] Specifically: Where y is the phenotypic vector, i.e., (E,E)-2,4-decadienal; W is the indicator matrix of fixed effects, with the first column being 1 and subsequent columns being fixed effect or covariate values; α is the coefficient vector of fixed effects; x is the genotype vector; β is the SNP effect; u is the random effects vector; and e is the residual vector; MVN n Let be an n-dimensional multivariate normal distribution, where λ is the ratio of the two variance components. Let K be the residual variance, and I be the kinship matrix calculated based on SNP. n It is an identity matrix.
[0037] The content of the flavor compound (E,E)-2,4-decadienal was significantly associated with a region of approximately 0.30 Mb on chromosome 14 (chr14:2,431,296-2,734,657). Figure 1 ).
[0038] Further annotation of all sites within the chr14: 2,431,296-2,734,657 region revealed a highly conserved significant site located at... PRKAR1B The intronic region of the gene was identified, thus pinpointing this site (rs316165567) as a key candidate site influencing this flavor trait.
[0039] The differences between different genotypes at the rs316165567 locus were analyzed by combining phenotypic data, and the results are as follows: Figure 2 As shown, at this SNP locus on chromosome 14, individuals with the AA genotype have significantly higher levels of (E,E)-2,4-decadienal, which can be identified as a favorable genotype at this locus. This indicates that the rs316165567 locus can be used for early molecular marker-assisted breeding to determine the content of the chicken flavor compound (E,E)-2,4-decadienal.
[0040] Table 4. Distribution of the rs316165567C / A genotype in the Beijing Oil Chicken population.
[0041] Example 2. Validation of the effectiveness of the rs316165567 molecular marker Based on the (E,E)-2,4-decadienal content phenotype and individual genotype of all individuals used, a G matrix was constructed using GEMMA software; The PVE (equivalent to generalized heritability, calculated using the formula genotype variance / phenotype variance = Vg / Vp) was calculated. In the population of materials used in this claim, the PVE of rs316165567 was 2.40%, which has a high genetic explanatory power.
[0042] RNA sequencing was performed on the pectoral muscle tissue of Beijing Youji chickens (n=73). Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, California, USA). RNA concentration and purity were determined using a NanoDrop ND-2000 spectrophotometer (Thermo Fisher Scientific, Waltham, Massachusetts, USA), and RNA integrity was assessed by agarose gel electrophoresis. RNA sequencing was performed by Novogene Corporation (Beijing, China) using the Illumina NovaSeq 6000 platform (Illumina Inc., San Diego, California, USA). The association between the gene and (E,E)-2,4-decadienal was assessed using tools (Spearman) provided by Metaware (https: / / cloud.metware.cn / # / tools), see [link to Metaware documentation]. Figure 3 , PRKAR1BThe gene was significantly positively correlated with (E,E)-2,4-decadienal (r = 0.24). P <0.05).
[0043] The results of dual-luciferase reporter gene system analysis showed that the rs316165567 site could significantly enhance [the response]. PRKAR1B Transcriptional activity of gene promoters. Specifically, when this site is mutated from CC type to AA type, promoter activity is significantly increased ( Figure 4 Phenotypic data analysis revealed that the (E,E)-2,4-decadienal content was significantly higher in individuals with the AA genotype than in those with the CC genotype. These results suggest that the rs316165567 locus may promote… PRKAR1B The expression of [something] positively regulates the biosynthesis of (E,E)-2,4-decadienal.
[0044] Except for 1-octen-3-one, (E,E)-2,4-decadienal showed significant positive correlations with other important VOCs, indicating that important flavor VOCs may be co-regulated. Figure 5 ).
[0045] Further investigation revealed that the rs316165567 mutation not only increased the content of (E,E)-2,4-decadienal, but also significantly increased the content of the other 14 important VOCs. Figure 5 ).
[0046] Example 3. Comparison of (E,E)-2,4-decadienal content and quality changes among different genotypes.
[0047] The (E,E)-2,4-decadienal content in the pectoral muscle of Beijing Oil Chickens carrying the CC genotype at the rs316165567 locus was 0.0468 ppm, while that of the AC genotype was 0.0585 ppm and that of the AA genotype was 0.07393 ppm. The AA genotype had a decadienal content that was 0.0271 ppm higher than that of the CC genotype, representing an increase of 57.91%.
[0048] Because (E,E)-2,4-decadienal has an extremely low odor threshold (0.00007 ppm), even minute changes in its content can significantly affect sensory flavor. Therefore, it can be inferred that the content of decadienal at different rs316165567 loci (CC and AA genotypes) has a significant impact on the flavor quality of chicken.
[0049] Sensory evaluation was conducted by adding 1, 10, 50, 100, and 1000 ppm of (E,E)-2,4-decadienal to cooked Beijing oil chicken meat (background content approximately 0.05 ppm). Figure 6 ).
[0050] The sensory evaluation was conducted by a team of six men and six women, all aged between 20 and 30, and all of whom had received systematic training in odor perception.
[0051] Adding 1 ppm significantly enhances meat aroma and improves flavor acceptability, confirming that (E,E)-2,4-decadienal makes a key contribution to the overall flavor of chicken. When the concentration rises to 10 ppm, the overall acceptability begins to decline, indicating that the concentration is approaching the upper limit of its flavor contribution threshold. When the concentration reaches 50 ppm or above, the overall aroma of chicken is disturbed, and the intensity of the meat aroma and the acceptability of the flavor are significantly reduced, indicating that excessive addition will lead to the deterioration of flavor quality.
[0052] Therefore, (E,E)-2,4-decadienal can serve as a sensitive and crucial flavor indicator in chicken flavor breeding. Precise control of its content through rs316165567 molecular marker-assisted selection can effectively improve flavor quality while avoiding negative sensory effects caused by excessive accumulation, making it of significant application value for targeted genetic improvement of chicken flavor.
[0053] Example 4. Population validation of the rs316165567 molecular marker Three hundred and sixty-two Wenchang chickens were selected and slaughtered at 115 days of age. The content of (E,E)-2,4-decadienal in the breast muscle was measured. Venous blood was collected simultaneously, and genomic DNA was extracted for analysis. DNA samples that passed the initial analysis were subjected to 0.7% agarose gel electrophoresis to determine their purity and integrity. The DNA samples were then sent to BGI Genomics Co., Ltd. in Shenzhen for whole-genome resequencing.
[0054] The genotype data of 362 individuals were processed for quality control using PLINK v1.9 software. The quality control standards were: locus detection rate (geno) > 0.95, minimum allele frequency (MAF) > 0.05, and individual detection rate (mind) > 0.95.
[0055] To further verify the genetic effect of the rs316165567 locus in the population, the (E,E)-2,4-decadienal content in the Wenchang chicken population was compared with that in the Beijing You chicken population. The results are as follows: Figure 7As shown, the content of (E,E)-2,4-decadienal in the Wenchang chicken population was significantly higher than that in the Beijing You chicken population. Genotyping at the rs316165567 locus in both populations (Table 5) revealed that the frequency of the favorable AA genotype was significantly higher in Wenchang chickens than in Beijing You chickens, a result consistent with the trend of phenotypic differences. The above population genetic evidence indicates that the rs316165567 locus is a key mutation that can broadly affect the content of the flavor compound (E,E)-2,4-decadienal in chicken meat. In breeding practice, assisted selection at this locus can be used to improve the flavor quality of chicken meat.
[0056] Table 5. Distribution of the rs316165567C / A genotype in the Wenchang chicken population.
[0057] Example 5. Early selection method for the flavor quality trait (E,E)-2,4-decadienal using the SNP molecular markers of the present invention. All selected individuals had wing vein blood collected at approximately 28 days of age, and EDTA anticoagulant was added. The blood was then stored at -20°C for later use.
[0058] Genomic DNA was extracted using the salting-out method, dissolved in ddH2O, and the purity and concentration of the DNA were determined by both agarose gel electrophoresis and ultraviolet spectrophotometry. The DNA was then diluted to a concentration of 50 ng / μl.
[0059] Amplification was performed using the primers in Table 2 and the PCR reaction conditions described above. Allele sequencing of the amplified products was performed using direct sequencing to genotype the SNP locus rs316165567.
[0060] Based on genotyping results, healthy male and female hens with the AA genotype at the rs316165567 locus were selected for breeding. At 14 weeks of age, the entire flock was tested for pullorum disease and leukosis, and positive individuals were culled to improve the overall disease resistance of the flock and reduce breeding risks and costs. Once the flock reached 24-26 weeks of age and entered the egg-laying period, the egg-laying performance of the hens was recorded, and individuals that did not lay eggs or had low egg production rates were culled. Around 30 weeks of age, when the breeding flock reached its peak egg production, healthy male and female hens with favorable genotypes were selected for mating combinations. Inbreeding within three generations must be avoided during mating, and the individual numbers of the male and female hens involved in mating were recorded in detail to establish a complete pedigree file.
[0061] This invention provides a molecular marker associated with the content of (E,E)-2,4-decadienal, a flavor compound in chicken, and its application method. The marker includes: identifying the key SNP locus rs316165567 on chicken chromosome 14 using GWAS analysis; a method for detecting this mutation site; and a technical solution for marker-assisted selection of (E,E)-2,4-decadienal based on the genotype of this locus. This invention provides a new molecular marker and breeding method for the efficient genetic improvement of chicken flavor and quality traits.
[0062] Although the above embodiments have described the present invention and its implementation in detail, it should be noted that for those skilled in the art, any changes, modifications, substitutions, combinations, simplifications, etc., made to the corresponding conditions without departing from the technical principles of the present invention should be considered as equivalent substitutions, and these improvements should also be considered within the scope of protection of the present invention.
Claims
1. The application of an SNP molecular marker in the identification of the content of (E,E)-2,4-decadienal, a flavor compound in chicken meat, characterized in that: The fragment sequence of the SNP molecular marker is ATCTCTGCATAGCAAC / AACCAGACCGACCCAT corresponds to the Gallus_gallus-6.0 version sequence information of the chicken reference genome published in NCBI. The SNP molecular marker sequence at 2,519,798bp on chromosome 14 is rs316165567, a nucleotide sequence with a site polymorphism of C / A, and genotypes CC, AC, and AA. The (E,E)-2,4-decadienal content of the AA genotype is significantly higher than that of the AC and CC genotypes.
2. A set of primer pairs for detecting the SNP molecular marker in claim 1, characterized in that, The sequences of the upstream and downstream primers of the primer pair are shown in SEQ ID NO.1-2, respectively: CCTGAGCTCGCTAGCCTCGAG (SEQ ID NO.1); CAGTACCGGATTGCCAAGCTT (SEQ ID NO. 2).
3. A method for early identification of (E,E)-2,4-decadienal content in chicken meat, characterized in that, The genotypes of the SNP molecular markers as described in claim 1 were detected in the chicken samples to be tested, wherein the (E,E)-2,4-decadienal content of the AA genotype was significantly higher than that of the AC and CC genotypes.
4. The method according to claim 3, characterized in that, Includes the following steps: (1) Extract genomic DNA from the chickens to be tested; (2) Detect the genotype of the SNP molecular marker at position 2,519,798 on chromosome 14 of the chicken to be tested; (3) PCR amplification is performed using the primer pair described in claim 2 to obtain the amplification product; (4) The alleles of the obtained PCR amplification products were sequenced by direct sequencing. (5) Based on the sequencing results, determine the genotype of the chicken to be tested.
5. Any application of the SNP molecular marker of claim 1: (1) Application of molecular marker-assisted early prediction of (E,E)-2,4-decadienal content in chicken meat; (2) Application in the identification of flavor quality of superior chicken germplasm resources; (3) Application in improving the flavor and quality of local chickens and new breeds.
6. A molecular breeding method for determining the content of (E,E)-2,4-decadienal, a flavor compound in high-quality chicken, characterized in that... include: (1) Extract genomic DNA from the chickens to be tested; (2) Using DNA as a template, perform PCR amplification using the primer pair described in claim 2; (3) Analyze the PCR amplification products to determine the genetic potential of chickens for breeding and propagation.
7. The molecular breeding method according to claim 6, characterized in that, Step (3) includes: performing allele detection on the amplification product and determining the following based on the genotyping results: when the genotype of the polymorphic site contained in the molecular marker rs316165567 is AA, it is determined that the chicken meat of the individual to be tested has a higher (E,E)-2,4-decadienal content level.
Citation Information
Patent Citations
Chicken oily essence and preparation method thereof
CN102366082A
SNP loci for increasing content of fatty acid C14: 0 in chicken and method for breeding high-quality chicken strain
CN112195253A
Molecular marker related to chicken slaughtering and meat quality traits and breeding method of high-quality and slaughtering processing type new strain
CN116179714A
Molecular marker related to slaughter traits of broiler chicken and breeding method of broiler chicken strain with high growth efficiency
CN117568484A
SNP (Single Nucleotide Polymorphism) molecular marker combination for identifying AA broiler chicken, detection kit and application of SNP molecular marker combination
CN119799906A