InDel molecular marker co-separated from length of fruit stem of bitter gourd and application of InDel molecular marker

By developing an InDel molecular marker co-separated from the pedicel length of bitter gourd, and utilizing PCR amplification and electrophoresis techniques, the problem of low breeding efficiency in existing technologies was solved, enabling rapid and low-cost identification of pedicel length and breeding improvement.

CN121852585APending Publication Date: 2026-04-14SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-29
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

The lack of molecular markers for bitter gourd stalk length in existing technologies leads to low breeding efficiency, high costs, and difficulty in selecting bitter gourd varieties with high-quality stalk lengths through early identification.

Method used

An InDel molecular marker co-separated from the pedicel length of bitter melon was developed. PCR amplification was performed using primer pairs McFPL-1-F and McFPL-1-R, and the pedicel length was identified by polyacrylamide gel electrophoresis. Combined with the kit and method, a rapid and low-cost pedicel length identification was achieved.

Benefits of technology

It enables rapid identification of fruit stalk length during the seedling stage of bitter gourd, improving breeding efficiency, reducing field selection workload and costs, shortening the breeding cycle, and is applicable to the improvement of fruit stalk length in molecular breeding of bitter gourd.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852585A_ABST
    Figure CN121852585A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular breeding of vegetables, and particularly relates to an InDel molecular marker co-segregated with the length of a fruit stem of a bitter gourd and application of the InDel molecular marker. The mutation site of the InDel molecular marker co-separated from the length of the fruit stem of the bitter gourd corresponds to the insertion / deletion of TTTTAAAAAAT at the 14693294bp on the No.3 chromosome of a bitter gourd genome, and the polymorphism of the base at the site affects the length of the fruit stem of the bitter gourd. The invention also provides a primer pair, a kit and the like for identifying the InDel molecular marker, which can be used for molecular marker-assisted selective breeding of the length of the fruit stem of the bitter gourd, improve the efficiency of genetic improvement of the length of the fruit stem of commercial fruit of the bitter gourd, shorten the breeding period and reduce the breeding cost, and has a wide application prospect in practice of the length of the fruit stem of the bitter gourd.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of vegetable molecular breeding technology, specifically relating to an InDel molecular marker co-separated from the length of bitter gourd pedicel and its application. Background Technology

[0002] Momordica charantia( Momordica charantia *Momordica charantia* (2n=2x=22) is an annual climbing vegetable crop belonging to the genus *Momordica* of the Cucurbitaceae family. It prefers warm temperatures and is intolerant of cold, and is widely cultivated in my country. Bitter melon is rich in nutrients, containing abundant amino acids, vitamins, and saponins, and also possesses high medicinal value. Furthermore, bitter melon has a long history of cultivation in China, resulting in a relatively rich variety of cultivars and types. With the advancement of agricultural mechanization, developing bitter melon varieties suitable for mechanized harvesting has become an important breeding goal. Increasing the length of the fruit stalk can better distinguish the bitter melon fruit from other tissues for mechanized harvesting. Therefore, the length of the bitter melon fruit stalk is one of the quality traits affecting mechanized harvesting and has attracted much attention from breeders.

[0003] Molecular marker-assisted selection (MMR) breeding is an important and efficient technique for genetically improving crop traits. However, no molecular markers have been reported to date that can be used for MMR selection based on bitter gourd pedicel length. Developing molecular markers that co-segregate with bitter gourd pedicel length would allow for the identification of pedicel length in early stages of bitter gourd growth and development, such as the seedling stage, thereby improving the efficiency of bitter gourd pedicel selection and reducing breeding costs. Summary of the Invention

[0004] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide an InDel molecular marker that is co-separated from the length of the bitter gourd stalk.

[0005] Another object of the present invention is to provide the application of the above-mentioned InDel molecular marker co-separated with the length of bitter gourd pedicel.

[0006] Another object of the present invention is to provide a method for determining the length of the bitter gourd stalk.

[0007] The objective of this invention is achieved through the following technical solution: An InDel molecular marker cosegregated with the length of bitter melon pedicel has been identified. The mutation site corresponds to the insertion / deletion of TTTTAAAAAAT at chromosome 14693294 bp on chromosome 3 of the bitter melon reference genome, Momordica charantia cv. OHB3-1_v2.0. The polymorphism of the base at this site affects the length of bitter melon pedicel.

[0008] The nucleotide sequence of the InDel molecular marker co-separated from the length of the bitter melon stalk is shown below (SEQ ID NO. 1), wherein M in the sequence represents a TTTTTAAAAAAT insertion or deletion: TTGTAACAATAAAAGGGCAACTGCAGCAATGGCCAAATTTAATAACACG M (TTTTAAAAAAT / delTTTTAAAAAAT)GACCAAAACCTATGGGATATTGCAATATGGCTAAATGATTTTTTTTTTAAAATACTGATAAAATGTTTAGACAAATATACTCTTGTAACCAATTAGATATATATGATAGCGATCTAAGATTTTTG A primer pair for identifying the aforementioned InDel molecular marker includes primers McFPL-1-F and McFPL-1-R, the nucleotide sequences of which are shown below: McFPL-1-F: 5'-TTGTAACAATAAAGGGCAACTG-3'; McFPL-1-R: 5'-CAAAAATCTTAGATCGCTATCA-3'.

[0009] A kit for identifying the InDel molecular marker described above, comprising the primer pair described above.

[0010] The kit preferably further comprises dNTPs, reaction buffer, and Taq enzyme.

[0011] The application of the InDel molecular marker, the primer pair, or the kit in identifying the trait of bitter gourd pedicel length.

[0012] The application of the InDel molecular marker, the primer pair, or the kit in screening bitter gourd varieties with long pedicels.

[0013] The application of the InDel molecular marker, the primer pair, or the kit in molecular breeding of bitter gourd.

[0014] A method for determining the length of bitter melon fruit stalk includes the following steps: (1) Extract DNA from the bitter melon to be tested; (2) Using the bitter gourd DNA extracted in step (1) as a template, and using the primer pairs or the primer pairs in the above kit as amplification primers, perform PCR amplification and polyacrylamide gel electrophoresis. (3) Based on the electrophoresis results, determine the genotype and the length of the bitter gourd stalk.

[0015] The preferred PCR amplification system is: 50-100 ng of genomic DNA template, 10 μM each of forward and reverse primers, 200 μM dNTPs, 1×PCR reaction buffer, and 1 U of Taq enzyme.

[0016] The preferred PCR amplification reaction procedure is as follows: Pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 30 s, annealing at 51-55℃ for 30 s, extension at 72℃ for 12 s, cycled 35 times; finally extension at 72℃ for 5 min.

[0017] The method for determining genotype and bitter gourd pedicel length is as follows: If the electrophoretic band pattern of the bitter gourd to be tested is the same as that of the bitter gourd inbred line '23S083', that is, there is no 11bp insertion, the fruit stalk of the commercial fruit will be long; if the electrophoretic band pattern of the bitter gourd to be tested is the same as that of the bitter gourd inbred line '23S184', that is, there is an 11bp insertion, the fruit stalk of the commercial fruit will be short.

[0018] A method for genetically improving bitter melon includes the following steps: Determine the genotypes of the aforementioned InDel molecular markers in the offspring of bitter gourd, and make corresponding selections based on the genotypes of the InDel molecular markers: select plants with the genotype of not inserting the TTTTTAAAAAAT at position 14693294bp on chromosome 3 of the bitter gourd reference genome Momordica charantia cv. OHB3-1_v2.0, and eliminate plants with the genotype of inserting the TTTTTAAAAAAT at that position.

[0019] The bitter melon mentioned can be THMC-227, Ruyu bitter melon, Prachi bitter melon, Chunqiu bitter melon, Meilv bitter melon, Chuangfu bitter melon, Nuohe bitter melon, Chaoqun 520 bitter melon, Nongboshi bitter melon, Baokang No. 1 bitter melon, Xiutian bitter melon, Long bitter melon, No. 5 Dading bitter melon, Zhenwang bitter melon, Thailand 400 bitter melon, Qinchao bitter melon, Huizhou local bitter melon, Haifeng bitter melon, Cuizhu No. 9, Hainan bitter melon, Jiangmen Dading bitter melon, Xiuzhen bitter melon, Caifucheng bitter melon, etc.

[0020] The present invention has the following advantages and effects compared with the prior art: (1) In this invention, the bitter gourd inbred line '23S083' with a long pedicel (10.87±4.03 cm) and the bitter gourd inbred line '23S184' with a short pedicel (3.77±1.92 cm) were used as parents to construct a population of 241 plants for initial mapping and a large population of 1076 plants for fine mapping. Then, molecular markers for the initial mapping interval were developed, linkage analysis was performed, and gene loci were finely mapped. Finally, an InDel molecular marker cosegregated with the bitter gourd pedicel length trait was identified and developed. This molecular marker is located at 14693294 bp on chromosome 3 of the bitter gourd genome and is a TTTTAAAAAAT insertion / deletion. The polymorphism of the bases at this site affects the bitter gourd pedicel length.

[0021] (2) This invention provides a primer pair (McFPL-1) for identifying the above-mentioned molecular markers, a kit containing the primers, and a method for identifying the length of bitter gourd pedicel. The primer pair, kit, or method can be used to effectively, quickly, and cost-effectively identify the bitter gourd pedicel length trait, and establish a molecular marker-assisted selection breeding technology for rapid improvement of the bitter gourd pedicel length trait.

[0022] (3) This invention can be used for molecular marker-assisted selection breeding of bitter gourd pedicel length. The length of the pedicel of the fruit during the green-mature stage can be identified based on the genotype of bitter gourd seedlings, which helps breeders quickly screen out the ideal plants they need, improves the efficiency of genetic improvement of bitter gourd commercial fruit pedicel length, reduces the workload and cost of field selection, and greatly shortens the breeding period. It has broad application prospects in the breeding practice of bitter gourd pedicel length. Attached Figure Description

[0023] Figure 1 This is a morphological illustration of the pedicel length of bitter gourds with long pedicels (23S083), bitter gourds with short pedicels (23S184), and the F1 generation of bitter gourds obtained from their hybridization during the commercial fruit stage.

[0024] Figure 2 This is a schematic diagram of the gene mapping process for bitter gourd pedicel length. In the diagram: a: ​​BSA-seq analysis results of bitter gourd pedicel length based on ΔSNP-Index, where the blue line represents the threshold line with a confidence level of 0.95; b: Based on local molecular marker linkage mapping, the gene controlling bitter gourd pedicel length was initially mapped between FPL5 and FPL8, with the numbers below representing the genetic location of the corresponding marker on chromosome 3; c: Using a large F2 population (n=1076), the gene controlling bitter gourd pedicel length was finely mapped between FPL5 and FPL13, with the numbers below representing the physical location of the corresponding marker on chromosome 3; d: Genotyping results of the 44 recombinant plants selected through fine mapping, where white, black, and gray represent the genotypes of the mapped regions, the right side shows the average pedicel length of the recombinant plants with the corresponding genotype, 'a' and 'b' are their significance markers, and n is the number of recombinant plants corresponding to that genotype.

[0025] Figure 3 This is a graph showing the genotyping results in a natural population; where a: insertion / deletion information for the 11 bp in both parents; b: genotyping results for this marker in 23S083, 23S184, F1, and the natural population; c: distribution of pedicel lengths for the two genotypes in the natural population, where n represents the number of plants with the corresponding genotype. p The result obtained after t-test p -value. Detailed Implementation

[0026] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0027] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field.

[0028] In this example, the long-stalked bitter gourd inbred line '23S083' was obtained from local bitter gourds collected in Tunchang, Hainan, through 8 generations of self-pollination using conventional methods; the short-stalked bitter gourd inbred line '23S184' was obtained from bitter gourd 'Cuizhu' (a commercial variety bred in our laboratory in earlier years) through 8 generations of self-pollination using conventional methods. The average stalk length is shown in [reference needed]. Figure 3 . Example 1

[0029] 1. Experimental materials and the acquisition of identification populations or plants (1) Initial segregating population: Using the long-stalked bitter gourd inbred line '23S083' as the female parent and the short-stalked bitter gourd inbred line '23S184' as the male parent, an F2 segregating population (n=241 plants) was constructed through conventional hybridization to serve as the F2 initial segregating population for genetic analysis and initial gene mapping of stalk length. Figure 1 ).

[0030] (2) Initially, the seeds of the separated population were soaked and germinated, and then raised in seedling trays. The specific method was as follows: the seeds were soaked and germinated in a 30℃ constant temperature incubator. When the seeds began to sprout, they were sown in 50-cell seedling trays. When the seedlings grew to 4-5 true leaves, they were transplanted to the field and managed with conventional fertilizer and water.

[0031] 2. Phenotypic survey of pedicel length During the commercial fruiting period of bitter gourd, the length of the fruit stalk of each individual plant in the F2 group was investigated. A total of 3 investigations were conducted, with 2 people conducting the investigation simultaneously according to the same standard each time.

[0032] 3. DNA extraction (1) Select 0.1 g of fresh, tender green bitter gourd leaves and place them in a 2 mL centrifuge tube. Quick-freeze with liquid nitrogen and place in a grinder. Set the frequency to 65 Hz and grind for 20 s before taking them out.

[0033] (2) Add 800 μL of CTAB solution (20 mM EDTA, 100 mM Tris-HCl, 1.4 M NaCl, 2% CTAB, 2% PVP, all percentages are mass fractions) to the centrifuge tube, mix quickly, and place in a water bath at 65℃ for 25 min, inverting and mixing 3-5 times during the process.

[0034] (3) After the water bath is complete, add an equal volume of chloroform to the fume hood and mix by inverting for 5 minutes.

[0035] (4) Place it in a centrifuge and centrifuge at 12,000 rpm for 8 min.

[0036] (5) Take the supernatant and transfer it to a 1.5 mL centrifuge tube, then add an equal volume of isopropanol and shake gently.

[0037] (6) After standing at 4℃ for 30 min, centrifuge at 12000 rpm for 8 min.

[0038] (7) Discard the supernatant, wash the precipitate twice with a 75% ethanol solution, and then remove the residual solution.

[0039] (8) Dry at 35℃, cool and then add 50 μL of sterile water to dissolve the DNA precipitate.

[0040] (9) After the DNA precipitate has completely dissolved, store at -20℃ for later use.

[0041] 4. DNA pool construction and sequencing Based on the survey results of the fruit stalk length of the F2 pre-positioning segregation population of bitter gourd, DNA from 30 bitter gourd plants with long fruit stalks was selected and mixed in equal amounts to form a long fruit stalk gene pool, and DNA from 30 bitter gourd plants with short fruit stalks was selected and mixed in equal amounts to form a short fruit stalk gene pool. A total of 4 samples, including DNA from the two parent lines, were used for library construction and sequencing.

[0042] 5. Preliminary gene mapping analysis for the length of the fruit stalk in commercial bitter melon. (1) The raw data produced by sequencing were filtered. The filtering process used the Soapnuke software developed by BGI to remove adapter contamination and low-quality reads, resulting in high-quality clean data.

[0043] (2) The cleandata obtained in step (1) was aligned to the reference genome using the short sequence alignment software BWA (Version: 0.1.17-r1188). Momordica charantia On cv.OHB3-1_v2.0 version).

[0044] (3) Based on step (2), the UnifiedGenotyper function of GATK (GATK3.4) software is used to detect SNP variations in the population and filter out the high-quality SNP sites obtained.

[0045] (4) Based on the high-quality SNP sites obtained in step (3), the SNP-index parameters and ΔSNP-index values ​​are further calculated by sliding window by calculating the depth of alleles between offspring pools. The sliding window size is 200Kb and the sliding step size is 100Kb.

[0046] Preliminary gene mapping analysis of bitter melon fruit stalk length revealed a region at the end of chromosome 3 that is significantly associated with the bitter melon fruit stalk length trait (confidence level = 0.95). This region is located at 13,014,217-15,476,182 bp and has a physical length of approximately 2.46 Mb. Figure 2 a).

[0047] 6. Development and linkage analysis of molecular markers for initial localization regions Based on the whole-genome resequencing results of the parents '23S083' and '23S184', nine pairs of polymorphic markers (FPL1-FPL9) were developed within the associated region (13,014,217-15,476,182 bp) obtained in step 5 (Table 1). These nine polymorphic markers were used to genotype 241 individual plants from the initial F2 segregating population. The specific method was as follows: (1) PCR amplification Using genomic DNA from 241 individual plants of the F2 initial localization segregation population as templates, PCR amplification was performed using primers listed in Table 1. The specific PCR amplification reaction system (10 μL) consisted of: 50-100 ng of genomic DNA template, 10 μM each of forward and reverse primers, 200 μM dNTPs, 1×PCR reaction buffer, and 1 U of Taq enzyme. The specific PCR amplification reaction program was: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles; and a final extension at 72℃ for 5 min, followed by storage at 16℃.

[0048] (2) Polyacrylamide gel electrophoresis After PCR amplification, the PCR products were detected and analyzed by 6% polyacrylamide gel electrophoresis. The specific method is as follows: ① Reagent preparation: Weigh 500 g of urea, 250 g of acrylamide, 43.2 g of Tris, 22 g of H3BO3, 13 g of methylenebisacrylamide, and 22.976 g of EDTA·Na. Add pure water and stir to dissolve, then bring the volume to 4 L to obtain PAGE collagen solution; Weigh 108 g of Tris, 55 g of H3BO3, and 27.44 g of EDTA·Na. Add pure water and stir to dissolve, then bring the volume to 1 L to obtain 5×TBE solution.

[0049] ② Gel preparation: Weigh 1 g of agar powder, heat it in a microwave oven to dissolve it in 100 mL of water, pour it into the bottom of the electrophoresis glass plate, and wait for it to cool and solidify; measure 50 mL of PAGE collagen solution, and add 880 μL of ammonium persulfate solution (10% by mass) and 14 μL of TEMED to it, shake it gently to mix, and then quickly pour it into the electrophoresis glass plate with the bottom sealed, and quickly insert the sample grid; after the collagen solution solidifies and forms, gently remove the sample grid, and immediately rinse the residual gel in the sample well with tap water; put the assembled electrophoresis glass plate into the electrophoresis tank, and add 0.5×TBE electrophoresis buffer, and set aside for use.

[0050] ③ Electrophoresis: Add 2 μL of 6×Loading buffer to 10 μL of PCR product, mix well, and then use a microsyringe to add 2 μL to the sample well. Adjust the electrophoresis apparatus voltage to 300 V for electrophoresis, and adjust the electrophoresis time according to the size of the PCR product.

[0051] ④ Gel washing: After electrophoresis, peel the polyacrylamide gel from the electrophoresis glass plate and place it in a 0.1% AgNO3 solution. Shake gently on a shaker for 5 min. Discard the AgNO3 solution and immediately rinse twice with pure water. Then add silver staining solution (1.5% NaOH, 0.2% Na2B4O7·10H2O and 0.5% HCHO solution, all percentages are mass fractions). Shake gently on a shaker until the PCR product bands are clearly visible (about 4-6 min). Finally, discard the silver staining solution, add plenty of tap water to stop the colorimetric reaction, take a picture and record the molecular marker band pattern.

[0052] Based on the initial molecular marker mapping, linkage analysis revealed that markers FPL5 and FPL8 co-segregated with the pedicel length phenotype. Therefore, the pedicel length gene locus for commercial fruit can be further located between markers FPL5 and FPL8, with a physical distance of approximately 471.68 kb. Figure 2 b).

[0053] Table 1. Polymorphic primer sequences used for gene localization of bitter melon fruit stalk length. Example 2: Fine mapping of the bitter gourd pedicel length gene locus

[0054] 1. Experimental materials and the acquisition of identification populations or plants (1) Using the long-stalked bitter gourd inbred line '23S083' as the female parent and the short-stalked bitter gourd inbred line '23S184' as the male parent, the population was expanded through conventional hybridization methods, and an F2 population containing 1076 individual plants was constructed as a fine mapping population for fine mapping of the stalk length gene.

[0055] (2) For precise positioning of large population seeds, the seeds were soaked and germinated, and then raised in seed trays. The specific method was as follows: the seeds were soaked and germinated in a 30℃ constant temperature incubator. When the seeds began to sprout, they were sown in 50-cell seed trays. When the seedlings grew to 1-2 true leaves, samples were collected for DNA extraction.

[0056] 2. DNA extraction To avoid affecting subsequent colonization, a modified CTAB method was used to extract DNA, which is more time-saving and labor-saving. The specific method is as follows: (1) Cut a small leaf with scissors and place it on a 96-well convex PCR plate. Place two small steel balls in each well and cover the plate.

[0057] (2) Add 80 μL of CTAB solution and crush the sample using a crusher (process at 60 Hz for 120 s).

[0058] (3) Heat in a water bath at 65℃ for 20 min, then add an equal volume of chloroform and shake well by inverting the container.

[0059] (4) Place it in a centrifuge and centrifuge at 5000 rpm for 10 min.

[0060] (5) Take 50 μL of supernatant onto a new PCR plate, and then add an equal volume of isopropanol.

[0061] (6) Shake gently and place in a -20℃ refrigerator for 20 minutes.

[0062] (7) Place it in a centrifuge and centrifuge at 5000 rpm for 10 min.

[0063] (8) Discard the supernatant and remove the remaining supernatant; wash twice with a 75% ethanol solution.

[0064] (9) Place in a fume hood to air dry, add 50 μL of nuclease-free water, and use for PCR amplification after the DNA is completely dissolved.

[0065] 3. Fine-grained screening of recombinant populations (1) Genotyping of 1076 F2 individuals from a finely mapped population was performed using markers (FPL5 and FPL8) on both sides of the cosegregating region (specific steps such as PCR amplification and polyacrylamide gel electrophoresis are described in Example 1).

[0066] (2) The selected recombinants were planted at the Qilinbei Teaching Base of South China Agricultural University, and the length of the fruit stalk of the recombinant plants was investigated at the stage of commercial fruit size.

[0067] 4. Fine mapping of the gene for the length of the fruit stalk in commercial bitter melon. (1) Based on the parental resequencing results, four pairs of polymorphic molecular markers (FPL10, FPL13, FPL14, FPL15) were developed in the initial localization region (Table 1), and the above polymorphic molecular markers were used to perform genotyping of the recombinant (the specific PCR amplification and polyacrylamide gel electrophoresis steps are described in Example 1).

[0068] Based on the phenotype of fruit stalk length in the commercial fruit stage of recombinant plants, the gene controlling fruit stalk length in bitter gourd was finely mapped to the area between markers FPL5 and FPL13, with a physical distance of 255.059 kb. Figure 2 c, d). Example 3: Development and application of cosegregation markers for assisting in the screening of fruit stalk length

[0069] 1. Development of cosegregation markers to assist in screening for fruit stalk length Based on the fine-mapping regions and resequencing data obtained in Example 2, InDel co-segregating markers were developed using mutations contained within the mapping regions, resulting in a marker McFPL-1 that co-segregates with pedicel length in the F2 population. Figure 3 a. Table 2), where the McFPL-1 amplified sequence and corresponding mutation site information are shown below. There is an insertion / deletion of 11 bases (TTTTAAAAAAT) at chromosome 14693294 bp on the bitter gourd reference genome Momordicacharantia cv. OHB3-1_v2.0. This mutation site affects the length of the bitter gourd pedicel.

[0070] TTGTAACAATAAAAGGGCAACTGCAGCAATGGCCAAATTTAATAACACG M (TTTTAAAAAAT / delTTTTAAAAAAT)GACCAAAACCTATGGGATATTGCAATATGGCTAAATGATTTTTTTTTTAAAATACTGATAAAATGTTTAGACAAATATACTCTTGTAACCAATTAGATATATATGATAGCGATCTAAGATTTTTG Note: M marked in the sequence is the mutation site, indicated by an underline (the mutated base is in parentheses).

[0071] Table 2 Molecular marker McFPL-1

[0072] 2. Practical applications of co-separation markers Based on the molecular marker McFPL-1, and referring to Examples 1 and 2, genotyping was performed on the parental bitter gourd inbred lines '23S083', '23S184', F1, and 42 natural populations. The pedicel length of each individual plant in each of the 42 natural populations at the commercial fruit stage was also investigated. The genotype and phenotype matching degree of the 42 natural populations was evaluated by combining the genotypes and phenotypes of each individual plant in the parental bitter gourd inbred lines '23S083', '23S184', F1, and natural populations. Figure 3 (bc, Table 3-4), and a significance analysis was performed on the fruit stalk length. Among them, the electrophoretic band pattern of the McFPL1 molecular marker was the same as that of the bitter gourd long fruit stalk inbred line '23S083', which was " FPL1 "The genotype is identical to that of the short-stalked bitter gourd inbred line '23S184', meaning it lacks the 11bp insertion; the electrophoretic banding pattern is the same as that of the bitter gourd inbred line '23S184'." fpl1 "Genome type, i.e., the presence of an 11bp insertion."

[0073] The results showed that in natural populations, those detected as " FPL1 "The fruit stalk length of bitter gourd genotypes (e.g., 25A052, 25A008, 25A003, 25A005, 25A050, 25A046, 25A047, 25A048, 25A045, THMC-227 (6th generation) inbred lines, Ruyu bitter gourd 6th generation inbred lines, Prachi bitter gourd 6th generation inbred lines, Chunqiu bitter gourd 6th generation inbred line 25A016, Meilu bitter gourd 6th generation inbred lines, Chuangfu bitter gourd 6th generation inbred lines, Nuohe bitter gourd 6th generation inbred lines, Chaoqun 520 bitter gourd 6th generation inbred lines, Nongboshi bitter gourd 6th generation inbred lines, Baokang No. 1 bitter gourd 6th generation inbred lines, Xiutian bitter gourd 6th generation inbred lines, Long bitter gourd 6th generation inbred lines, etc.) is significantly longer than that of the genotypes tested as '…'" fpl1 "Genology of bitter gourd (e.g., No. 5 Dading bitter gourd 6th generation inbred line, Zhenwang bitter gourd 4th generation inbred line, Thai 400 bitter gourd 4th generation inbred line, Qinchao bitter gourd 6th generation inbred line, Huizhou local bitter gourd 6th generation inbred line, Haifeng bitter gourd 6th generation inbred line, Chunqiu bitter gourd 6th generation inbred line 25A011, Cuizhu No. 9 bitter gourd, Hainan bitter gourd 8th generation inbred line, Jiangmen Dading bitter gourd 6th generation inbred line, Xiuzhen bitter gourd 8th generation inbred line, Caifucheng bitter gourd 8th generation inbred line, etc.)" Figure 3 (Tables 3-4). Meanwhile, for the entire large group composed of 42 natural populations, " FPL1 "The pedicel length of the genotype is significantly greater than that of..." fpl1 "genotype( P =2.047×10 -6 Therefore, the molecular markers developed in this invention can be applied to the identification of the length of the fruit stalk in bitter gourd seedlings.

[0074] Table 3. Phenotypes and genotypes based on the molecular marker McFPL-1 in 42 natural populations of bitter melon. FPL1 )

[0075] Table 4. Phenotypes and genotypes based on the molecular marker McFPL-1 in 42 natural populations of bitter melon. fpl1 )

[0076] Note: FPL1 There is no 11bp insertion, and the genotype with a long pedicel is absent. fpl1 There is an 11bp insertion, and the genotype has a short pedicel. Additionally, 25A052, 25A008, 25A003, 25A005, 25A050, 25A046, 25A047, 25A048, and 25A045 are other bitter gourd varieties preserved in our laboratory.

[0077] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. An InDel molecular marker co-separated with the length of the bitter melon fruit stalk, characterized in that... The mutation site corresponds to the insertion / deletion of TTTTTAAAAAAT at chromosome 14693294 bp on chromosome 3 of the bitter gourd reference genome Momordica charantia cv. OHB3-1_v2.

0. The polymorphism of the bases at this site affects the length of the bitter gourd pedicel.

2. The InDel molecular marker for co-separation of bitter melon fruit stalk length according to claim 1, characterized in that: The nucleotide sequence of the InDel molecular marker co-separated from the length of the bitter gourd stalk is shown in SEQ ID NO.1, wherein M in the sequence is an insertion or deletion of TTTTTAAAAAAT.

3. A primer pair for identifying InDel molecular markers co-separated from the length of bitter melon fruit stalks, characterized in that... The primer pair includes primers McFPL-1-F and McFPL-1-R, whose nucleotide sequences are shown below: McFPL-1-F: 5'-TTGTAACAATAAAGGGCAACTG-3'; McFPL-1-R: 5'-CAAAAATCTTAGATCGCTATCA-3'.

4. A kit for identifying InDel molecular markers co-separated from the length of bitter melon fruit stalk, characterized in that... The kit comprises the primer pair as described in claim 3.

5. The reagent kit according to claim 4, characterized in that... It also contains dNTPs, reaction buffer, and Taq enzyme.

6. The application of the InDel molecular marker as described in claim 1 or 2, the primer pair as described in claim 3, or the kit as described in claim 4 or 5 in identifying the pedicel length trait of bitter gourd, screening bitter gourd varieties with long pedicels, or in molecular breeding of bitter gourd.

7. A method for determining the length of the fruit stalk of bitter melon, characterized in that... It includes the following steps: (1) Extract DNA from the bitter melon to be tested; (2) Using the bitter gourd DNA extracted in step (1) as a template, and using the primer pair described in claim 3 or the primer pair in the kit described in claim 4 or 5 as amplification primers, perform PCR amplification and polyacrylamide gel electrophoresis. (3) Based on the electrophoresis results, determine the genotype and the length of the bitter gourd pedicel; The method for determining genotype and bitter gourd pedicel length is as follows: If the electrophoretic band pattern of the bitter gourd to be tested is the same as that of the bitter gourd inbred line '23S083', that is, there is no 11bp insertion, the fruit stalk of the commercial fruit will be long; if the electrophoretic band pattern of the bitter gourd to be tested is the same as that of the bitter gourd inbred line '23S184', that is, there is an 11bp insertion, the fruit stalk of the commercial fruit will be short.

8. The method for determining the length of bitter gourd pedicel according to claim 7, characterized in that: The PCR amplification system consisted of: 50-100 ng of genomic DNA template, 10 μM each of forward and reverse primers, 200 μM dNTPs, 1× PCR reaction buffer, and 1 U of Taq enzyme.

9. The method for determining the length of the bitter gourd pedicel according to claim 7, characterized in that: The PCR amplification reaction procedure is as follows: Pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 30 s, annealing at 51-55℃ for 30 s, extension at 72℃ for 12 s, cycled 35 times; finally extension at 72℃ for 5 min.

10. A method for genetic improvement of bitter melon, characterized in that... It includes the following steps: Determine the genotype of the InDel molecular marker described in claim 1 for the offspring bitter gourd, and make corresponding selections based on the genotype of the InDel molecular marker: select plants with the genotype of not inserting TTTTTAAAAAAT at chromosome 14693294bp on chromosome 3 of the bitter gourd reference genome Momordica charantia cv. OHB3-1_v2.0, and eliminate plants with the genotype of inserting TTTTTAAAAAAT at that site.