KASP molecular marker linked with major QTL (Quantitative Trait Loci) of chromosome 5 of corn leaf included angle character and application of KASP molecular marker

Abstract

The invention relates to the technical field of plant molecular genetic breeding, in particular to a KASP molecular marker linked with a major QTL (Quantitative Trait Loci) of a chromosome 5 of a corn leaf included angle character and application of the KASP molecular marker. According to the invention, 212 important inbred lines from breeding projects in southeast of China are used as populations, based on a Maize 6H-60K single nucleotide polymorphism (SNP) high-density chip, the populations are successfully positioned to an SNP site which is located on a chromosome 5 and is closely linked with a major QTL site of a corn leaf included angle, and a KASP molecular marker K8657 is successfully developed, and the polymorphism is C or A. Experiments prove that when the polymorphic site of the KASP molecular marker is CC, the included angle of corn leaves is small; when the polymorphic site of the KASP molecular marker is AA, the included angle of the corn leaves is large. Therefore, the invention provides an excellent molecular marker for corn density-tolerant plant type breeding improvement.

Description

Technical Field

[0001] This invention relates to the field of plant molecular genetics and breeding technology, and in particular to a KASP molecular marker linked to a major QTL site on chromosome 5 of maize leaf angle trait and its application. Background Technology

[0002] Ideal maize plant type includes compact plant structure, strong stalks, well-developed root system, uniform ear height, adaptability to mechanization, appropriate leaf spacing, and tolerance to high planting density. Cultivating an ideal plant type and improving photosynthetic efficiency has a significant impact on grain yield. Leaf angle is closely related to photosynthetic utilization rate per unit area. Studies have found that higher planting density allows compact maize to utilize solar radiation more efficiently. Increasing the planting density of compact maize optimizes the light and nitrogen distribution in the maize canopy, increases light energy interception in the ear and lower part of the ear, promotes dry matter accumulation in the later stages of growth, and consequently increases yield per unit area. Research has shown that although compact maize has a greater yield advantage when planted at high density, as density increases, plant height, ear height, and ear height coefficient all increase. Lodging rate increases with ear height, while the number of rows per ear, number of kernels per ear, and 100-kernel weight decrease with increasing ear height. Therefore, finding a suitable planting density for compact maize is a prerequisite for ensuring overall yield.

[0003] Leaf angle, referring to the angle between the midrib of a leaf and the stem, is a complex quantitative trait controlled by multiple genes. Primarily regulated by additive gene effects, it is a key factor influencing the ideal plant architecture of maize. Leaf angle directly affects light capture efficiency and planting density tolerance, thus influencing population light utilization and ultimately maize yield. Therefore, studying the genetic mechanisms of leaf angle is crucial for improving maize plant architecture and increasing yield. In recent years, with breakthroughs in molecular biology and high-throughput sequencing technologies, genome-wide association studies (GWAS) have been widely used by researchers in genetic trait studies of various crops such as cotton, maize, rapeseed, rice, and wheat. The principle lies in using association analysis of phenotypic and genomic genetic variations (such as single nucleotide polymorphisms, SNPs) in large-scale populations to locate phenotypic-related genetic loci and elucidate complex crop traits.

[0004] To enrich the research on maize leaf angle, this invention utilizes 212 important inbred lines from a breeding project in southeastern China as a population. Based on the Maize6H-60K single nucleotide polymorphism (SNP) high-density chip, a SNP site closely linked to the major QTL site of maize leaf angle was located, and the KASP molecular marker was successfully developed, providing a new approach for maize high-density planting tolerance breeding improvement. Summary of the Invention

[0005] The purpose of this invention is to provide a KASP molecular marker linked to a major QTL locus on chromosome 5 related to the leaf angle trait in maize and its application, thereby addressing the problems existing in the prior art. This invention provides an excellent KASP molecular marker for improving maize plant architecture and for breeding maize that tolerates high-density planting. By using this KASP molecular marker to assist in the selection and breeding of maize that tolerates high-density planting, maize with a small leaf angle and tolerance to high-density planting can be cultivated. Therefore, this KASP molecular marker has the advantages of high accuracy, high efficiency, and high cost-effectiveness.

[0006] This invention utilizes the Maize6H-60K whole-genome SNP chip developed by the Maize Research Center of the Beijing Academy of Agricultural and Forestry Sciences for genotyping, identifying genotypes in 212 important inbred lines from a breeding project in southeastern China. Combining leaf angle phenotypic data from four replicates over two years, the "BLINK" model in the GAPIT tool was used to analyze the detection of leaf angle QTLs in these four replicates over two years, further determining the stability of major-effect QTLs. This invention discovered a major-effect leaf angle QTL located on chromosome 5, named LA-5, which is an environmentally stable QTL. This invention predicted candidate genes for this QTL and developed a tightly linked KASP marker for the LA-5 gene locus. The results of this study enhance the understanding of the molecular regulatory mechanism of leaf angle and provide molecular markers that can be used for breeding maize leaf angle traits.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] This invention provides a KASP molecular marker linked to a major QTL site on chromosome 5 that is associated with the leaf angle trait in maize. The nucleotide sequence of the KASP molecular marker is as shown in SEQ ID NO. 1, and an A or C mutation is present at the 31st base of the sequence.

[0009] The present invention provides KASP primer pairs for the above-mentioned KASP molecular markers, wherein the KASP primer pairs include nucleotides such as K8657F1 as shown in SEQ ID NO. 2, nucleotide sequences such as K8657F2 as shown in SEQ ID NO. 3, and nucleotide sequences such as K8657R1 as shown in SEQ ID NO. 4.

[0010] This invention provides the application of the above-mentioned KASP molecular marker or the above-mentioned KASP primer pair in the preparation of products for detecting the size of the angle between maize leaves.

[0011] Preferably, the product includes reagents, reagent kits, and chips.

[0012] This invention provides a product for identifying the size of the angle between maize leaves, the product comprising the aforementioned KASP primer pair.

[0013] Preferably, the product includes reagents, reagent kits, or chips.

[0014] This invention provides the application of the above-mentioned KASP molecular marker, the above-mentioned KASP primer pair, or the above-mentioned product in identifying the size of the angle between maize leaves.

[0015] This invention provides a method for determining the size of the angle between corn leaves, comprising:

[0016] Using the genome of the maize sample to be tested as a template, the template was amplified by PCR using the KASP primer combination described above, and genotyping was performed based on the amplification results.

[0017] Preferably, if the genotyping result of the KASP molecular marker is CC, the maize sample to be tested is determined to be a maize variety with a small leaf angle; if the genotyping result is AA, the maize sample to be tested is determined to be a maize variety with a large leaf angle; and if the genotyping result is CA, the maize sample to be tested is determined to be a maize variety with a medium leaf angle.

[0018] This invention provides the application of the above-described SNP molecular markers, the above-described KASP primer pairs, or the above-described products in any of the following:

[0019] (1) Application in screening corn with small leaf angles;

[0020] (2) Improve maize germplasm resources;

[0021] (3) Improve maize plant type;

[0022] (4) Cultivate maize varieties that are tolerant to dense planting.

[0023] The present invention discloses the following technical effects:

[0024] This invention utilizes 212 important inbred lines from a breeding project in southeastern China as a population. Based on the Maize6H-60K single nucleotide polymorphism (SNP) high-density microarray, it successfully located an SNP site on chromosome 5 that is tightly linked to a major QTL site for maize leaf angle and successfully developed the KASP molecular marker K8657. Through in-depth research, this invention reveals for the first time a KASP molecular marker linked to a major QTL site on chromosome 5 for the maize leaf angle trait, which can be used to effectively and efficiently improve the size of the maize leaf angle. Experimental verification shows that when the polymorphic site of the KASP molecular marker is CC, the maize leaf angle is smaller; when the polymorphic site of the KASP molecular marker is AA, the maize leaf angle is larger. This invention provides an excellent molecular marker for improving the plant type of maize tolerant to high-density planting. By using molecular marker-assisted selection to breed materials tolerant to high-density planting, it is possible to cultivate maize with compact leaf angles and tolerance to high-density planting, with advantages of high accuracy, high efficiency, and high cost-effectiveness. This invention will contribute to the cloning of maize leaf angle-related genes and the development of functional markers for these genes. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 A schematic diagram showing the distribution of leaf angle traits in a population of 212 important inbred lines from a breeding project in southeastern China;

[0027] Figure 2 The density distribution of single nucleotide polymorphisms (SNPs) on chromosomes of 212 inbred lines;

[0028] Figure 3 A schematic diagram of the location of the major QTL locus LA-5 for the leaf angle of maize, i.e., the Manhattan plot of the association analysis of leaf angle in the associated population;

[0029] Figure 4 This is a schematic diagram illustrating allelic analysis using the peak SNP molecular marker of the major QTL locus on chromosome 5 of maize as a trait of leaf angle in this invention.

[0030] Figure 5 This is a schematic diagram illustrating the results of the detection of 52 hybrids / hybrid combinations and 20 inbred lines using the KASP molecular marker K8657 according to the present invention. Detailed Implementation

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0033] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0034] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.

[0035] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0036] Example 1: Determination of leaf angle phenotype in inbred line populations

[0037] The 212 inbred lines used in this invention came from a breeding project in southeastern China. These materials can be divided into 10 groups: improved Reid, P group, Tang Sipingtou group, Lancaster, early-maturing hard-grain group, Lüda red bone group, Reid group, IDT group, X group, and Mixed group.

[0038] This population was planted in Fengyang County, Anhui Province, China (32°N, 117°E) in 2023 and 2024, divided into two environments: 23FY (planted in 2023) and 24FY (planted in 2024). Two replicates were set up for the 212 inbred lines, using single-row planting in plots with a row length of 5.00 m, row spacing of 0.60 m, and plant spacing of 0.33 m. Field management was the same as conventional field management practices. After maize reached maturity, five individual plants were randomly selected from each inbred line, and the leaf angle of the three leaves above the ear was measured. The mean of the leaf angles of the three leaves above the ear was taken as the phenotypic value. The maize leaf angle was defined as the angle between the midrib of the leaf and the stem, measured in degrees (°). Based on the leaf angle phenotypic values ​​of the 212 materials in all environments, the best linear unbiased estimate (BLUE value) was calculated, and the results are shown in Tables 1-3. Figure 1 ( Figure 1 The distribution of the leaf angle phenotype of 212 inbred lines is shown in the figure. It is drawn using phenotypic data and can be used to visually represent the distribution of the leaf angle phenotype in this population, reflecting that the phenotype is controlled by multiple genes of the quantitative trait.

[0039] Table 1. Best linear unbiased estimates (BLUE values) for some materials.

[0040]

[0041] Table 2. Best linear unbiased estimates (BLUE values) for some materials.

[0042]

[0043] Table 3. Best linear unbiased estimates (BLUE values) for some materials.

[0044]

[0045] Example 2: Obtaining a high-quality SNP dataset for an association population

[0046] Leaf samples were collected from 212 population-related natural populations of maize plants from important inbred lines from a breeding project in southeastern China when the maize reached the five-leaf stage, and DNA was extracted using the CTAB method.

[0047] DNA was extracted using the CTAB method. The reagents and procedures are as follows (refer to Doyle et al.; 1987):

[0048] 1. Preparation of reagents

[0049] (1) Tris-HCl (1.0 M pH 8.0): 60.58 g Tris-Base and 21 mL concentrated HCl were added to ddH2O and brought to a final volume of 500 mL.

[0050] (2) EDTA (0.5 M, pH 8.0): 186 g EDTA and 25 g NaOH (granules) were added to ddH2O and brought to a final volume of 1 L.

[0051] (3) 2% CTAB: 81.9g NaCl, 100mL 1.0 M Tris-HCl (pH 8.0), 40mL 0.5 M EDTA (pH 8.0), 20g CTAB, add ddH2O to make up to 1 L, sterilize and it can be used for DNA extraction.

[0052] (4) 5M NH4AC: 385.4g NH4AC plus ddH2O to make up to 1 L.

[0053] (5) 76% Ethanol (containing 10 mM NH4AC): 760 mL of anhydrous ethanol and 2 mL of 5M NH4AC, add dd H2O to make up to 1 L.

[0054] (6) 3 M NaAc (pH 5.2): 246.09 g NaAc was added to dd H2O and HAC to make up to 1 L, and the pH was adjusted to 5.2 with HAC.

[0055] (7) 24:1 solution: Add 22 mL of isoamyl alcohol to 500 mL of chloroform and mix well.

[0056] 2. DNA extraction steps using the CTAB method

[0057] 1) Take a small amount of tender leaves (cotyledons for seedlings that germinate indoors) in a 2 mL centrifuge tube with a number written on it and freeze it in a freezer at -20℃ for later use;

[0058] 2) Grind the sample using a grinding mill. After removing the centrifuge tube, place it on ice, open the cap and add clean steel balls, along with 100 μL of 2% CTAB. After closing the cap, place the tube in the grinding mill adapter (28 times / s, 30s). After grinding, remove the centrifuge tube, open the cap, pour out the steel balls, and then add 300 μL of 2% CTAB. (When using the grinding mill, strictly follow the instructions and pay attention to balance and symmetry.)

[0059] 3) Place the centrifuge tubes on a centrifuge tray and incubate them in a water bath at 55-60°C for 50-60 minutes, gently shaking them every 10 minutes. After the water bath, place them in a fume hood to cool to room temperature (approximately 30-60 minutes).

[0060] 4) Add an equal volume (400 μL) of 24:1 solution to the tube, shake gently for 10 min, and then centrifuge at 12000 rpm for 10 min;

[0061] 5) Transfer the supernatant (200 μL) to a 1.5 mL centrifuge tube with the same number as the original tube (pre-fill with 1 / 10 volume of 3M NaAc of the supernatant), add two volumes of frozen anhydrous ethanol (incubated overnight at -20℃), and let stand for 20~30 min.

[0062] 6) If the DNA clumps are large, you can directly pick out the DNA with the pipette tip and pour out the ethanol. If the amount of DNA is small, close the cap, centrifuge at 8000 rpm for 2 minutes, and then open the cap to pour out the ethanol.

[0063] 7) Then add 76% ethanol to wash the precipitate (can be left overnight), turning occasionally, repeating 1-2 times;

[0064] 8) Gently pour out the alcohol, place the DNA at the bottom of the tube, let it dry at room temperature, add TE or ddH2O to dissolve, incubate at 37°C for 1 hour, then shake well. For long-term storage, please store in a -20°C freezer.

[0065] After obtaining DNA from 212 important inbred lines, genotyping was performed using the Maize6H-60K whole-genome SNP chip developed by the Maize Research Center of the Beijing Academy of Agricultural and Forestry Sciences. During genotyping, SNPs with heterozygosity greater than 10%, allele frequency less than 5%, and deletion rate greater than 20% were removed, resulting in 58,455 SNP markers. The number of SNPs on chromosomes 1 to 10 were 9552, 7344, 7264, 6591, 6423, 5068, 4991, 4886, 4873, and 4232, respectively. Figure 2 The horizontal axis represents the physical location (Mb), and the vertical axis represents the linkage group.

[0066] Example 3 Genome-wide association analysis

[0067] The leaf angle phenotype and SNP dataset obtained were analyzed using the "BLINK" model in the GAPIT software package. A genome-wide association analysis was performed to obtain the p-value for each locus of the leaf angle trait. When the p-value was less than 8.55359 × 10⁻⁶, the p-value was considered acceptable. -7 A significant SNP is defined as (−log(p)>6.07), and the SNP with the smallest p-value is the peak SNP. Analysis revealed that the peak SNP for the leaf angle trait is AX-107953621 (A / C) on chromosome 5. The reference genome is version V3 of B73. The corresponding leaf angle phenotype groupings are: when the SNP at the AX-107953621 position is CC, the average leaf angle of the material is 19.74°; when it is AA, the average leaf angle of the material is 29.49°. Figure 4 The p-value at this site was 1.18 × 10⁻⁶. -8The phenotypic explanation rate (PVE) is 9.77%, located at position 20828657 bp on chromosome 5. (See...) Figure 3 As shown. The LD decay distance of this population is 200 kb (r 2 =0.15), therefore, the range of this major effect QTL position is located on chromosome 5 from 20628657bp to 21028657bp, with a peak at 20828657bp.

[0068] Example 4: Development of KASP molecular markers for major QTL sites at leaf angle

[0069] A KASP molecular marker was developed targeting the SNP site AX-107953621. The nucleotide sequence of this KASP molecular marker is shown in SEQ ID NO. 1, specifically:

[0070] The sequence GTTAGACAGTTTGTGCATTAGCCTTAACTT[A / C]CGTTATGGGGCAAAGATTCCTCGAGACTTCGAAGATTATGCCAGCTGGTGCCGTTGCTGGTCTCAGGTAACGCCAGCTTCGATACTTTGGAAGCATCACTGGATTATCATGCACTGCCCACTTGTTTTTCCTCCTTGTCTGCAAATAGAAAATGGCTTCACAGAAC contains an A or C mutation at the 31st base.

[0071] Based on this molecular marker, a pair of KASP primers was developed in this embodiment and named K8657.

[0072] The primer information for this KASP primer pair is as follows:

[0073] The nucleotide sequence of primer K8657F1 is SEQ ID NO. 2: CAGTTTGTGCATTAGCCTTAACTTC;

[0074] The nucleotide sequence of primer K8657F2 is SEQ ID NO. 3: CAGTTTGTGCATTAGCCTTAACTTA;

[0075] Primer K8657F1 is used to connect to the fluorescent signal adapter FAM, and primer K8657F2 is used to connect to the fluorescent signal adapter ViC (included in the kit).

[0076] The nucleotide sequence of primer K8657R1 is SEQ ID NO. 4: GTTCTGTGAAGCCATTTTCTATTTG.

[0077] The KASP amplification system is as follows: 10 μL of KASP amplification system, including 1 μL of DNA, 5 μL of KASP 2X Master Mix (Nanjing Vazyme Biotech Co., Ltd., model Q113-03), 3.6 μL of deionized water or ultrapure water, 0.1 μL of K8657F1, 0.1 μL of K8657F2, and 0.2 μL of K8657R1 primer working solution.

[0078] The KASP amplification program is as follows: preheat at 95℃ for 5 min; 95℃ for 10 s, 60℃ for 30 s, 40 cycles; 72℃ for 2 min, 16℃ for 5 min, then stop.

[0079] Genotyping: KASP amplification was performed using an ABI 7500 real-time quantitative PCR instrument, and then genotyping data was obtained using the built-in real-time quantitative PCR software. The genotyping results of the samples were determined based on the fluorescence signals: red-labeled samples (FAM fluorescent label) and blue-labeled samples (ViC fluorescent label) represent two homozygous genotypes, respectively, and green-labeled samples represent heterozygous genotypes.

[0080] Results: When the KASP molecular marker primers identified the genotype as CC, the position near the X-axis (red dot FAM) indicated a maize variety with a small leaf angle; when the genotype was AA, the position near the Y-axis (blue dot ViC) indicated a maize variety with a large leaf angle; and when the genotype was CA, the position near the middle of the Y-axis (green dot) indicated a maize variety with a medium leaf angle.

[0081] Example 5: Application of KASP molecular markers at major QTL sites in leaf angle

[0082] The 52 maize hybrids and 20 inbred lines were provided by Anhui University of Science and Technology.

[0083] SNP sites in the DNA of 52 maize hybrids and 20 inbred lines were detected using KASP primers, with a blank control (no DNA added). The method was the same as in Example 4. Results are as follows: Figure 5 (The X-axis represents FAM fluorescence, the Y-axis represents ViC fluorescence, the black area at the origin of the coordinate axes represents the blank control, and the values ​​on the coordinate axes represent fluorescence signal values) and as shown in Table 2. Figure 5 As shown in Table 4, this marker has a good genotyping effect on SNP sites, effectively distinguishing materials with different genotypes and exhibiting high amplification efficiency. Among these materials, 14 samples showed the AA genotype at the SNP site, 27 samples showed the CA genotype at the SNP site, and 31 samples showed the CC genotype at the SNP site.

[0084] Table 4 Genotypes of the K8657 marker in 52 maize hybrids and 20 inbred lines.

[0085]

[0086] The SNP genotypes of the 72 maize materials identified by the K8657 marker were correlated one-to-one with the leaf angle phenotypes, and a significance test was performed. The results are shown in Table 5. The results showed that the leaf angle of the materials containing the CC genotype was significantly reduced by 17.14° compared to the materials containing the AA genotype. This indicates that the CC genotype at the SNP locus has the effect of reducing the leaf angle.

[0087] Table 5. Significance of the association between the K8657 marker and phenotype

[0088]

[0089] Therefore, this invention, through phenotypic analysis and whole-genome microarray sequencing of the maize leaf angle trait, followed by genome-wide association analysis, detected a major QTL locus for the maize leaf angle trait on chromosome 5, contributing 9.77% to the overall leaf angle. This major QTL locus is located between bases 20628657 and 21028657 on chromosome 5 of maize, with a peak SNP of AX-107953621 (A / C). Based on this SNP molecular marker closely linked to the major QTL locus, it can be used to detect and predict the size of the maize leaf angle, to effectively select for the size of the leaf angle, and for marker-assisted breeding of maize materials with small leaf angles, accelerating the breeding process for small leaf angles and high-density planting tolerance. Therefore, the major-effect QTL locus on chromosome 5 of this invention contributes significantly to the maize leaf angle trait and plays a crucial role in its regulation. It can be used for map-based cloning and marker-assisted selection, making it suitable for large-scale application. Marker-assisted selection using the SNP molecular markers disclosed in this invention is simple, efficient, and can predict the size of the maize leaf angle. The selection target is clear and unaffected by environmental factors. It can identify individual plants with small leaf angles early in maize growth, eliminating other plants.

[0090] The functions and structural principles of this invention have been demonstrated and explained in the embodiments. Any modifications can be made to the implementation methods without departing from these principles. Therefore, this invention includes all modified embodiments based on the spirit and scope of the claims. The embodiments described above are merely preferred embodiments of this invention and are not intended to limit the scope of the invention. Various modifications and improvements made to the technical solutions of this invention by those skilled in the art without departing from the spirit of the invention should fall within the protection scope defined by the claims.

Claims

1. A KASP molecular marker linked to a major QTL locus on chromosome 5 of maize with the leaf angle trait, characterized in that, The nucleotide sequence of the KASP molecular marker is as shown in SEQ ID NO. 1, and an A or C mutation exists at the 31st base of the sequence.

2. The KASP primer pair used for the KASP molecular marker according to claim 1, characterized in that, The KASP primer pair includes K8657F1 as shown in SEQ ID NO. 2, K8657F2 as shown in SEQ ID NO. 3, and K8657R1 as shown in SEQ ID NO.

4.

3. The application of the KASP molecular marker of claim 1 or the KASP primer pair of claim 2 in the preparation of a product for detecting the size of the angle between maize leaves.

4. The application according to claim 3, characterized in that, The products include reagents, reagent kits, and chips.

5. A product for identifying the size of the angle between corn leaves, characterized in that, The product includes the KASP primer pair as described in claim 2.

6. The product according to claim 5, characterized in that, The products include reagents, reagent kits, or chips.

7. The application of the KASP molecular marker of claim 1, the KASP primer pair of claim 2, or the product of claim 5 or 6 in identifying the size of the angle between maize leaves.

8. A method for determining the size of the angle between corn leaves, characterized in that, include: Using the genome of the maize sample to be tested as a template, PCR amplification of the template was performed using the KASP primer combination described in claim 2, and genotyping was performed based on the amplification results.

9. The method according to claim 8, characterized in that, If the genotyping result of the KASP molecular marker is CC, the maize sample to be tested is determined to be a maize variety with a small leaf angle; if the genotyping result is AA, the maize sample to be tested is determined to be a maize variety with a large leaf angle; and if the genotyping result is CA, the maize sample to be tested is determined to be a maize variety with a medium leaf angle.

10. The use of the SNP molecular marker of claim 1, the KASP primer pair of claim 2, or the product of claim 5 or 6 in any of the following: (1) Application in screening corn with small leaf angles; (2) Improve maize germplasm resources; (3) Improve maize plant type; (4) Cultivate maize varieties that are tolerant to dense planting.

Images