Molecular marker related to heading stage of wheat and application of molecular marker
By developing the molecular marker MTA73-3A-ID2 related to wheat heading date, the problem of time-consuming and labor-intensive identification of heading date in wheat breeding has been solved, enabling a rapid, stable, and low-cost breeding process, improving the efficiency and quality of wheat variety selection, and promoting the breeding of high-yield new varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-17
- Publication Date
- 2026-04-14
AI Technical Summary
There are few reports on molecular markers related to wheat heading period in existing technologies, which makes wheat breeding time-consuming and labor-intensive, and makes it difficult to achieve efficient genetic improvement and variety selection.
The molecular marker MTA73-3A-ID2 associated with wheat heading date was developed. The SNP locus AX-111551340 was identified through genome-wide association analysis. Primers MTA73-3A-ID2-F/R were designed for PCR amplification. Genotypes were detected by non-denaturing polyacrylamide gel electrophoresis to identify wheat heading date traits.
It enables rapid, stable, and low-cost identification of wheat heading stage traits, improves the efficiency and selection quality of the breeding process, helps in the cultivation of high-yield new varieties, and reduces breeding costs.
Smart Images

Figure CN121852610A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to molecular markers and their applications, specifically to molecular markers related to the heading stage of wheat and their applications, belonging to the field of crop selection and breeding technology. Background Technology
[0002] Wheat (Triticum aestivum L.) is one of the most important food crops grown globally. Currently, with increasing extreme weather events, climate change is severely impacting wheat production. Achieving stable wheat yields to ensure global food security has become one of the major challenges facing breeders. Heading date (HD) is a key trait for wheat adaptation to different climates, regions, and planting seasons. Therefore, genetic improvement of the wheat heading date trait is crucial for achieving high and stable wheat yields. Traditional breeding processes require significant time and effort. However, with the rapid development of high-throughput sequencing and gene chip technologies, genome-wide association studies (GWAS) have become a fast and convenient method, greatly promoting research on SNP marker-based association analysis of wheat agronomic traits. In summary, utilizing genome-wide association analysis to identify significantly associated loci with wheat heading date and developing molecular markers will provide effective marker resources for marker-assisted breeding, thereby reducing breeding workload, assisting in the development of high-yielding new wheat varieties, and ensuring global food security and sustainable agricultural development.
[0003] Currently, there are still few reports on molecular markers related to the wheat heading stage in wheat ear research. Summary of the Invention
[0004] The purpose of this invention is to provide a molecular marker related to wheat heading stage and its application, providing effective gene resources and molecular markers for crop genetic improvement and genome selection-assisted breeding.
[0005] To achieve the above objectives, the present invention adopts the following technical solution: The application of the molecular marker MTA73-3A-ID2 associated with wheat heading date, wherein the molecular marker MTA73-3A-ID2 is closely associated with the SNP site AX-111551340, which is significantly associated with wheat heading date. AX-111551340 is located on wheat chromosome 3A, and its physical location in the Chinese spring reference genome sequence Ref Seq v2.1 is 539337183. The molecular marker MTA73-3A-ID2 is amplified using the wheat genomic DNA to be tested as a template by the upstream primer shown in SEQ ID NO: 1 and the downstream primer shown in SEQ ID NO: 2. The nucleotide sequence is shown in SEQ ID NO: 3 or SEQ ID NO: 4. When the nucleotide sequence is as shown in SEQ ID NO: 3, the genotype of the wheat to be tested is CTAGTAAAAA. When the nucleotide sequence is as shown in SEQ ID NO: 4, the genotype of the wheat to be tested is C. Compared with wheat with genotype CTAGTAAAAA, wheat with genotype C has a significantly earlier heading date.
[0006] The advantages of this invention are: (1) Based on genome-wide association analysis, this invention has discovered a new and stable SNP locus (AX-111551340) that is significantly associated with the heading date of wheat, and developed the molecular marker MTA73-3A-ID2. This molecular marker can be used to identify the heading date trait of wheat to be tested and accelerate the breeding process. (2) The molecular marker MTA73-3A-ID2 developed in this invention has the advantages of stable amplification, high detection efficiency and low cost. It can be used for genetic improvement of wheat during the heading stage, providing effective marker resources for molecular marker-assisted breeding and helping to cultivate high-yield new wheat varieties. (3) By applying the molecular marker MTA73-3A-ID2 developed in this invention, which is related to the heading period of wheat, it is possible to determine whether there is a variation in the heading period locus of the wheat variety (line) to be tested. This greatly improves the selection efficiency and quality of wheat varieties (lines), minimizes costs, and directly realizes the identification of the target locus in wheat germplasm resources and breeding offspring. It provides a reliable molecular marker for the genetic improvement of wheat yield-related traits and genome selection-assisted breeding. Attached Figure Description
[0007] Figure 1 This is an image showing the electrophoretic detection results of the molecular marker MTA73-3A-ID2 on a non-denaturing polyacrylamide gel; Figure 2 This is a correlation analysis diagram of the heading period in a natural population under seven environmental conditions and BLUE. Figure 3 This is a Manhattan plot of genome-wide association analysis at the wheat heading stage. Detailed Implementation
[0008] The present invention will now be described in detail with reference to the accompanying drawings and embodiments.
[0009] I. Discovery of SNP loci associated with wheat heading stage Genome-wide association analysis (GWA) was performed on 55K microarray data and multi-environment heading date phenotypic data of 258 wheat varieties (lines) using the GAPIT mixed linear model in R. Based on previously reported loci, a novel SNP locus stably and significantly associated with wheat heading date was identified. This SNP locus is located at position 539337183 on wheat chromosome 3A (Ref Seq v2.1 of the Chinese spring reference genome), with genotypes of CC or TT, and is designated AX-111551340.
[0010] II. Molecular Marker Development Within a 1 Mb physical region upstream and downstream of AX-111551340, and combining previously reported resequencing data from 677 hexaploid wheat accessions, potential Indel sites closely associated with the significant site AX-111551340 were identified in the target region (the physical location of this Indel site is 539612293, located 275110 bp downstream of AX-111551340, with genotype C or CTAGTAAAAA). A new Indel molecular marker associated with wheat heading stage was developed (denoted as MTA73-3A-ID2).
[0011] Primers were designed targeting the aforementioned Indel site. The designed primers are MTA73-3A-ID2-F / R, and their nucleotide sequences are as follows: MTA73-3A-ID2-F: CAGGGTCATACTGTTTACCATTTTGA (SEQ ID NO: 1); MTA73-3A-ID2-R: GCCCTACGATGAGGCTATA (SEQ ID NO: 2).
[0012] The corresponding Indel molecular markers can be obtained by PCR amplification of the wheat DNA to be tested using the above primers MTA73-3A-ID2-F / R.
[0013] III. Natural Population Detection A natural population of 258 common hexaploid wheat accessions was selected (Tables 1-1 to 1-6), and the genotypes of the Indel loci were identified using the Indel molecular marker MTA73-3A-ID2.
[0014] 1. PCR amplification Using wheat genomic DNA as a template, PCR amplification was performed using the primers MTA73-3A-ID2-F / R. The PCR amplification system was 10 μL, specifically consisting of: 1 μL of DNA template with a concentration of 10 ng / μL or higher, 0.5 μL of upstream primer with a concentration of 10 μmol / L, 0.5 μL of downstream primer with a concentration of 10 μmol / L, 5 μL of 2×Taq PCR premixed reagent, and 3 μL of ddH2O. Amplification was performed using a standard amplification program, as follows: (i) Denaturation at 94℃ for 4 min; (ii) 34 cycles of standard PCR program: denaturation at 95°C for 40 s, annealing at 58°C for 40 s, extension at 72°C for 40 s; (iii) Extend at 72℃ for 5 minutes; (iv) End amplification and store at 4°C.
[0015] 2. Non-denaturing polyacrylamide gel electrophoresis detection The obtained PCR products were separated by constant voltage electrophoresis on a non-denaturing polyacrylamide gel (containing 5.85 g acrylamide and 0.15 g methylene acrylamide per 100 mL gel solution) for 3 h. The genotype of the wheat at this Indel locus was determined based on the electrophoresis results. (1) If the size of the PCR product is 342bp (SEQ ID NO: 3), then the genotype of the wheat to be tested at this Indel site is CTAGTAAAAA; (2) If the size of the PCR product is 333bp (SEQ ID NO: 4), then the genotype of the wheat to be tested at the Indel site is C.
[0016] Gel electrophoresis results of some wheat varieties (lines) are shown below. Figure 1 The genotypic identification results of all wheat varieties (lines) at this Indel locus are shown in Tables 1-1, 1-2, 1-3, 1-4, 1-5 and 1-6.
[0017] Table 1-1 Identification results of the molecular marker MTA73-3A-ID2 in natural populations (I)
[0018] Table 1-2 Identification results of the molecular marker MTA73-3A-ID2 in natural populations (II)
[0019] Table 1-3 Identification results of the molecular marker MTA73-3A-ID2 in natural populations (Part III)
[0020] Table 1-4 Identification results of the molecular marker MTA73-3A-ID2 in natural populations (IV)
[0021] Table 1-5 Identification results of the molecular marker MTA73-3A-ID2 in natural populations (V)
[0022] Table 1-6 Identification results of the molecular marker MTA73-3A-ID2 in natural populations (VI)
[0023] IV. Genome-wide association analysis of wheat heading stage The heading date of wheat was determined for 258 natural populations grown in multiple environments. The best linear unbiased estimator (BLUE) for the heading date of wheat in multiple environments was calculated using the lme4 package in R.
[0024] The association analysis results between the Indel molecular marker MTA73-3A-ID2 and wheat heading date are shown in Table 2.
[0025] Table 2. Association analysis results between Indel molecular marker MTA73-3A-ID2 and wheat heading date.
[0026] Note: BLUE represents the best linear unbiased estimate of the heading stage under 7 environments; *** indicates P<0.001, ** indicates P<0.01.
[0027] As shown in Table 2, compared with wheat with genotype CTAGTAAAAA, wheat with genotype C had a significantly earlier heading date (P<0.001). Under different environments, wheat with genotype C had a heading date 1.28-2.30 days earlier, with an advance of 0.61-1.17%.
[0028] Correlation analysis was performed on the heading date phenotypic values of natural populations under seven environmental conditions and BLUE. The results are shown in […]. Figure 2 .Depend on Figure 2 It can be seen that the heading period has a high correlation under multiple environments and is less affected by environmental factors, which can be used for further analysis.
[0029] Combining multi-year, multi-location phenotypic data on heading date from 258 wheat 55K microarrays and natural populations, genome-wide association analysis was performed using the GAPIT MLM model in R. The results are shown below. Figure 3 .Depend on Figure 3It can be seen that the Indel molecular marker MTA73-3A-ID2 is significantly associated with the heading period trait under E3, E4, E5, E6 and BLUE environments.
[0030] The above results indicate that the Indel molecular marker MTA73-3A-ID2 can be used to identify wheat heading-related traits, and has important breeding application value for the genetic improvement of wheat yield traits and the breeding of high-yielding new wheat varieties.
[0031] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. Those skilled in the art can make other variations or modifications based on the above description. It is impossible to exhaustively list all possible implementations here. All obvious variations or modifications derived from the technical solutions of the present invention are still within the protection scope of the present invention.
Claims
1. Application of the molecular marker MTA73-3A-ID2 associated with wheat heading stage, wherein the molecular marker MTA73-3A-ID2 is closely associated with the SNP site AX-111551340, which is significantly associated with wheat heading stage. AX-111551340 is located on wheat chromosome 3A, corresponding to physical location 539337183 in the Chinese spring reference genome sequence Ref Seq v2.
1. The molecular marker MTA73-3A-ID2 is amplified using the wheat genomic DNA to be tested as a template, and amplified by the upstream primer shown in SEQ ID NO: 1 and the downstream primer shown in SEQ ID NO:
2. The nucleotide sequence is shown in SEQ ID NO: 3 or SEQ ID NO:
4. When the nucleotide sequence is as shown in SEQ ID NO: 3, the genotype of the wheat being tested is CTAGTAAAAA. When the nucleotide sequence is as shown in SEQ ID NO: 4, the genotype of the wheat being tested is C. Compared with wheat with genotype CTAGTAAAAA, wheat with genotype C has a significantly earlier heading period.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker and application thereof in highland barley heading stage character assisted breeding
CN117385091A
Molecular marker related to wheat ear length and application thereof
CN117385097A
Molecular marker related to early heading character of wheat and application of molecular marker
CN119144752A
Molecular marker closely linked with wheat flag leaf width major QTL and application of molecular marker in prediction of wheat flag leaf width
CN121046574A
Wheat breeding method using genetic map of diploid wheat created by utilizing barley est sequence
WO2007020983A1