Application of oligonucleotide based on NAT10 gene in preparation of medicine for reversing platinum drug resistance of non-small cell lung cancer
By designing antisense oligonucleotides with specific sequences and optimizing lipid nanoparticle delivery systems, the targeted delivery problem of platinum-based drug resistance in non-small cell lung cancer was solved, achieving efficient drug delivery to the lungs, significantly reversing drug resistance, enhancing the efficacy of chemotherapy, and reducing toxic side effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ANHUI MEDICAL UNIV
- Filing Date
- 2026-03-12
- Publication Date
- 2026-04-17
AI Technical Summary
Existing technologies struggle to efficiently target and deliver antisense oligonucleotides to lung lesions, leading to an inability to effectively reverse platinum-based drug resistance in non-small cell lung cancer. Traditional lipid nanoparticles accumulate in the liver, resulting in low lung delivery efficiency.
Design specific antisense oligonucleotide sequences (such as 5'AAATAGCTTCACAACTTTGC') to specifically bind to NAT10 gene mRNA, and combine them with optimized lipid nanoparticles (LNPs) for targeted lung delivery, achieving efficient drug delivery to non-small cell lung cancer lesions.
It significantly reverses platinum-based drug resistance in non-small cell lung cancer cells, enhances the effect of chemotherapy, reduces damage to normal cells, lowers the dosage of platinum-based drugs, improves treatment safety and tolerability, and inhibits tumor growth and metastasis.
Smart Images

Figure CN121868328A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of an oligonucleotide based on the NAT10 gene in the preparation of a drug to reverse platinum resistance in non-small cell lung cancer, and particularly relating to the application of oligonucleotides that target and silence the NAT10 gene in reversing platinum resistance in non-small cell lung cancer, inhibiting tumor cell proliferation and inducing apoptosis. Background Technology
[0002] Lung cancer is one of the most common malignant tumors worldwide and a leading cause of cancer-related death. Non-small cell lung cancer (NSCLC) accounts for approximately 85% of lung cancer cases globally and is currently the leading cause of cancer-related death worldwide, seriously threatening human life and health. In clinical practice, although patients with advanced NSCLC usually achieve some treatment response when initially receiving first-line chemotherapy, most patients develop acquired drug resistance or tumor recurrence within one year of treatment, resulting in poor chemotherapy efficacy and low overall patient survival rates. This has become a key challenge restricting the clinical treatment effect of NSCLC. In addition, traditional chemotherapy drugs have inherent defects such as strong systemic toxicity and poor targeting, which can easily cause serious damage to healthy tissues after administration, triggering a series of adverse reactions, further reducing patient treatment tolerance, and limiting their clinical application. Therefore, finding new targets for NSCLC treatment and developing drug delivery technologies that can precisely target lung lesions are of great clinical significance and research value for developing precision treatment strategies for drug-resistant NSCLC and improving patient prognosis. This is also a current research hotspot and urgent need in the biomedical field for lung cancer treatment.
[0003] Platinum-based chemotherapy is currently the first-line foundational drug for non-small cell lung cancer (NSCLC). With its broad-spectrum anti-tumor activity, it plays a crucial role in NSCLC treatment, effectively inhibiting tumor cell proliferation, inducing tumor cell apoptosis, and prolonging patient survival. However, clinical practice has shown that approximately 50% of patients with advanced NSCLC gradually develop resistance to platinum-based chemotherapy, leading to decreased chemotherapy efficacy, tumor recurrence, or progression, becoming a major bottleneck restricting the effectiveness of NSCLC chemotherapy. The development of platinum-based chemotherapy resistance in NSCLC is usually closely related to enhanced tumor cell DNA damage repair capabilities and abnormal lipid metabolism activation, which is also one of the core reasons for chemotherapy failure, tumor recurrence, and progression.
[0004] N-acetyltransferase 10 (NAT10), the only identified protein possessing both an acetyltransferase domain and an RNA-binding domain, regulates the N4 acetylcytosine modification level of mRNA, thereby affecting mRNA stability and translation efficiency, and participating in the regulation of various physiological and pathological processes such as cell proliferation, differentiation, and apoptosis. Recent studies have found that NAT10 exhibits abnormally high expression in various malignant tumors, and its high expression is closely related to poor prognosis and tumor metastasis progression in cancer patients. Further research has confirmed that NAT10 can participate in the regulation of tumor chemotherapy resistance by simultaneously regulating enhanced DNA damage repair capacity and abnormal activation of lipid metabolism. Therefore, NAT10 has become a highly promising druggable target for overcoming tumor chemotherapy resistance.
[0005] Antisense oligonucleotides (ASOs) are a class of promising nucleic acid drugs. Their core mechanism of action involves sequence-specific hybridization with target gene RNA, specifically inhibiting the expression and function of the target gene, thereby achieving the treatment of diseases such as tumors. Compared with traditional chemotherapy drugs, ASOs have significant advantages such as high targeting, a broad range of therapeutic targets, and a simple drug development process, showing promising application prospects in the field of gene therapy. Based on this, ASOs targeting the NAT10 gene have become an important research direction for reversing chemotherapy resistance in non-small cell lung cancer. However, their clinical application is significantly limited: although ASOs can selectively silence NAT10 gene expression, they are easily cleared by the liver and kidneys during in vivo metabolism, making it difficult to achieve effective therapeutic levels at the lung lesion site, thus failing to fully exert their therapeutic effect in reversing chemotherapy resistance. Therefore, developing drug carriers that can efficiently and targetedly deliver antisense oligonucleotides to the lung lesion site has become the key to overcoming this technical bottleneck.
[0006] Messenger RNA (mRNA) therapy has demonstrated good safety and efficacy in clinical applications, with lipid nanoparticles (LNPs) currently serving as the primary non-viral vector platform for mRNA delivery. However, traditional LNPs suffer from significant tissue targeting limitations: after systemic administration, the drug primarily accumulates in the liver, making targeted delivery to the lungs difficult; while atomized LNPs are susceptible to shear stress generated by aerosolization during application and are easily captured by the pulmonary mucus barrier, resulting in low delivery efficiency and poor therapeutic effects in the lungs. This underscores the necessity of optimizing LNP formulations to meet the delivery requirements of pulmonary nucleic acid drugs (including ASOs).
[0007] Although some progress has been made in related research in recent years, and some lung-targeted delivery can be achieved through specially designed LNP formulations, the delivery efficacy of such lung-targeted LNPs still needs to be improved, and their wide applicability still needs further research and verification. They cannot meet the clinical needs for efficient delivery of NAT10-targeted ASOs to lung lesions. Summary of the Invention
[0008] The purpose of this invention is to provide an application of oligonucleotides based on the NAT10 gene in the preparation of drugs that reverse platinum resistance in non-small cell lung cancer.
[0009] To achieve the above and other related objectives, the technical solution provided by this invention is: the application of oligonucleotides based on the NAT10 gene in the preparation of drugs that reverse platinum resistance in non-small cell lung cancer.
[0010] 2. The application of the oligonucleotide based on the NAT10 gene according to claim 1 in the preparation of a drug to reverse platinum resistance in non-small cell lung cancer, characterized in that the preferred technical solution is that the sequence of the oligonucleotide is: 5 ’ AAATAGCTTCACAACTTTGC - 3 ’ .
[0011] Due to the application of the above technical solution, the advantages of this invention compared with the prior art are:
[0012] 1. This invention has the advantages of strong targeting and high specificity: The antisense oligonucleotides provided by this invention can specifically bind to NAT10 gene mRNA through the base complementary pairing principle, accurately inhibit the transcription and translation of NAT10 gene, downregulate NAT10 protein expression, have low off-target effects, can specifically target platinum-resistant non-small cell lung cancer cells, reduce damage to normal cells, and have good safety.
[0013] 2. Significant effect in reversing drug resistance: The antisense oligonucleotide of this invention can effectively reverse the drug resistance of non-small cell lung cancer cells to platinum-based drugs, and significantly reduce the IC50 of platinum-based drugs on drug-resistant cells. 50 This study enhances the killing effect of platinum-based drugs on tumor cells, providing an effective solution to the problem of poor treatment efficacy due to drug resistance when platinum-based drugs reverse non-small cell lung cancer in clinical practice.
[0014] 3. Outstanding synergistic anti-tumor effect: When the antisense oligonucleotide of the present invention is used in combination with platinum-based drugs, it has a significant synergistic effect, which can not only enhance the anti-tumor activity of platinum-based drugs, but also reduce the dosage of platinum-based drugs, reduce the toxic side effects of platinum-based drugs, and improve the safety and tolerability of clinical treatment.
[0015] 4. In addition to reversing platinum-based drug resistance, the antisense oligonucleotides of this invention can also inhibit the proliferation of drug-resistant non-small cell lung cancer cells. Cell proliferation experiments have confirmed that treatment inhibits the proliferation of chemotherapy-resistant cells. It also regulates abnormal lipid metabolism in tumor cells. Lipid droplet staining has confirmed that the number of lipid droplets in cells is significantly reduced after treatment. In animal experiments, it can significantly inhibit tumor growth, reduce the expression of NAT10 in tumor tissue, inhibit the malignant progression and metastasis of tumors, and exert anti-tumor effects. Attached Figure Description
[0016] Figure 1 To evaluate the growth inhibition of chemotherapy-resistant non-small cell lung cancer cells after the addition of ASO-NC or ASO-NAT10. Cell viability was measured using the CellTiter-Glo method, and IC50 was determined from the S-type dose-response curve. 50 value.
[0017] Figure 2 LDs red fluorescence detection measured the accumulation of LDs in non-small cell lung cancer cells after specified treatment.
[0018] Figure 3 EdU assay was used to assess the proliferation of drug-resistant non-small cell lung cancer cells after specified treatments.
[0019] Figure 4 Bioluminescence imaging revealed luciferase signaling in mice and its distribution in in vitro organs after intravenous injection of engineered lipid nanoparticles loaded with firefly luciferase mRNA.
[0020] Figure 5 Representative HE-stained images of major organs in a mouse model of orthotopic non-small cell lung cancer.
[0021] Figure 6 Representative IHC images of key proteins in in situ tumors.
[0022] Figure 7 Representative HE-stained images of major organs in a mouse model of metastatic non-small cell lung cancer.
[0023] Figure 8 Representative IHC images of key proteins in metastatic non-small cell lung cancer tumors. Detailed Implementation
[0024] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in these embodiments.
[0025] Please see Figure 1-8It should be noted that the structures, proportions, sizes, etc., illustrated in the accompanying drawings are merely for illustrative purposes and to aid those skilled in the art in understanding and reading the invention. They are not intended to limit the scope of the invention and therefore have no substantial technical significance. Any modifications to the structure, changes in proportions, or adjustments to the size are not permitted. The following embodiments are provided to better understand the invention, but are not intended to limit it. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores.
[0026] Unless otherwise specified, all reagents or materials described in the following examples are commercially available.
[0027] Example 1: Effect of antisense oligonucleotides targeting the NAT10 gene on the sensitivity of non-small cell lung cancer cells to platinum-based drugs (IC50). 50 (Detection)
[0028] (1) Induction method of A549R / PC9R cells: A549 and PC9 cells were induced to develop drug resistance by continuous exposure with gradually increasing cisplatin concentration. The obtained drug-resistant cells (named A549R and PC9R, respectively) were cultured in a medium containing 600 nM cisplatin to maintain selective pressure. Drug resistance was detected by MTT assay every 3 months and compared with parental cells for verification.
[0029] Cell grouping and treatment: A549R / PC9R cells in logarithmic growth phase were seeded into 96-well plates at a density of 1 × 10⁶ cells per well. 4 Cells were cultured for 24 hours and then divided into three groups: ASO-NC group (transfected with antisense oligonucleotides targeting NAT10), ASO-1 group (transfected with antisense oligonucleotides targeting NAT10), and ASO-2 group (transfected with antisense oligonucleotides targeting NAT10). The sequence of the antisense oligonucleotide ASO-NC targeting NAT10 is: AACAAGATGAAGAGCACCAA; the sequence of the antisense oligonucleotide ASO-1 targeting NAT10 is: AAATAGCTTCACAACTTTGC; and the sequence of the antisense oligonucleotide ASO-2 targeting NAT10 is: AATTTTCAAGACAGCTTTGGC.
[0030] Culture methods and materials used for ASO-NC, ASO-1, and ASO-2 groups: Following the instructions for use of the SweTransRNA transfection reagent, 24 hours after transfection, the IC50 of each group to cisplatin was detected using the MTT assay. 50 .
[0031] (2) CCK-8 assay for cell viability: 10 μL of CCK-8 reagent was added to each well and cultured for 4 h. The absorbance (OD value) of each well was measured at 450 nm using an ELISA reader. Cell viability was calculated as follows: Cell viability (%) = (OD value of experimental group - OD value of blank well) / (OD value of control group - OD value of blank well) × 100%.
[0032] (3) IC 50 Value calculation: Cell viability was measured using the CellTiter-Glo method, and IC50 was determined from the S-type dose-response curve. 50 value.
[0033] (4) Experimental results: The experimental results show that the IC of each group 50 as follows:
[0034] A549R:ASO-NC group: 24.25μM;
[0035] ASO-1 group: 6.60μM;
[0036] ASO-2 group: 4.05 μM;
[0037] PC9R: ASO-NC group: 22.12μM;
[0038] ASO-1 group: 7.62 μM;
[0039] ASO-2 group: 5.13 μM.
[0040] The above results indicate that the antisense oligonucleotides targeting the NAT10 gene of the present invention can increase the chemosensitivity of NSCLC cells.
[0041] Example 2: Effect of antisense oligonucleotides targeting the NAT10 gene on lipid droplets in drug-resistant non-small cell lung cancer cells (detection of red fluorescence in lipid droplets).
[0042] (1) Cell grouping and treatment: A549R / PC9R cells in logarithmic growth phase were seeded into 24-well plates at a density of 5 × 10⁶ cells per plate. 4 Cells were cultured for 24 hours and then divided into three groups: negative control group (transfected with NC-ASO), ASO experimental group (transfected with antisense oligonucleotides targeting NAT10), and antisense oligonucleotides at a concentration of 20 nM. Cells were cultured for another 48 hours after transfection.
[0043] (2) Fluorescence microscopy detection: Follow the instructions of the lipid droplet red fluorescence detection kit (Bejotem, C2050S, China):
[0044] Fixation: Remove the cells to be tested, wash twice with PBS, remove the PBS, add 4% paraformaldehyde fixative (P0099) and fix at room temperature for 10-15 minutes.
[0045] Staining: Remove the cells to be tested and wash with PBS 1-2 times; remove the PBS, add an appropriate volume of Staining Solution, add 250 μL to each well of a 24-well plate, and incubate at room temperature in the dark for 10-20 minutes; wash with PBS twice.
[0046] Detection: When observing with a fluorescence microscope (Leica, DM4B, Germany), excitation was selected at approximately 537 nm, and red fluorescence was observed. The LD540 concentration in the staining solution was adjusted according to the staining effect on the fixed cells.
[0047] (3) Experimental results: The results of this experiment show that the antisense oligonucleotides targeting the NAT10 gene of the present invention can regulate the abnormal lipid metabolism of drug-resistant non-small cell lung cancer cells and reduce lipid droplet accumulation by inhibiting the expression of the NAT10 gene.
[0048] Example 3: Effect of antisense oligonucleotides targeting the NAT10 gene on the proliferation of drug-resistant non-small cell lung cancer cells (EdU assay)
[0049] (1) Cell grouping and treatment: A549R / PC9R cells in logarithmic growth phase were seeded into 24-well plates at a density of 5 × 10⁶ cells per well. 4 Cells were cultured for 24 hours and then divided into three groups: negative control group (transfected with NC-ASO), ASO experimental group (transfected with antisense oligonucleotides targeting NAT10), and antisense oligonucleotides at a concentration of 20 nM. Cells were cultured for another 48 hours after transfection.
[0050] (2) EdU staining: Follow the instructions for EdU cell proliferation kit (Beyobio Biotechnology, CO071S, China):
[0051] EdU Marking, Washing and Clearing:
[0052] Prepare 2x Edu working solution; continue incubation for 2 hours; remove culture medium, fix cells in 250 μL fixative per well at room temperature for 15 min; remove fixative, wash cells 3 times with 250 μL washing buffer per well for 3-5 min each time; remove washing buffer, incubate 10-15 min at room temperature with 250 mL permeabilizer per well; remove permeabilizer, wash cells 1-2 times with 250 μL washing buffer per well for 3-5 min each time; prepare Click reaction solution; remove washing buffer from the previous step; add 250 μL Click reaction solution to each well and gently shake the culture plate to ensure the reaction mixture evenly covers the sample; incubate at room temperature in the dark for 30 min; remove Click reaction solution and wash 3 times with washing buffer for 3-5 min each time;
[0053] Nuclear staining:
[0054] Preparation of 1xhoechst33342 solution: Dilute hoechst33342 (1000x) with PBS at a ratio of 1:1000; after removing the washing buffer, add 250 μL of 1xhoechst33342 solution to each well and incubate at room temperature in the dark for 10 min; remove the 1xhoechst33342 solution; wash 3 times with washing buffer, 3-5 min each time; 1xhoechst33342 is detected by fluorescence and shows blue fluorescence with a maximum excitation wavelength of 346 nm and a maximum emission wavelength of 460 nm.
[0055] (3) Experimental results: Experimental results show that the antisense oligonucleotide targeting NAT10 of the present invention can significantly inhibit the proliferation of drug-resistant non-small cell lung cancer cells and reduce the number of proliferating cells.
[0056] Example 4: Expression and fluorescence signal detection of engineered lipid nanoparticles loaded with firefly luciferase mRNA in mice after intravenous injection.
[0057] (1) Experimental method: Engineered lipid nanoparticles containing firefly luciferase mRNA were administered to nude mice via tail vein injection; 6 hours later, D-luciferin potassium salt was injected intraperitoneally; mice were anesthetized by inhalation of isoflurane; the viability of vital organs (including liver, heart, lung, spleen and kidney) was measured in vivo and in vitro using an in vivo imaging system (IVIS).
[0058] (2) Experimental results: The results showed that, over time, the engineered LNPs mainly accumulated in the lungs.
[0059] Example 5: Antitumor effects of antisense oligonucleotides targeting the NAT10 gene in animals and their detection by hematoxylin-eosin (HE) and immunohistochemistry (IHC).
[0060] (1) Establishment of an orthotopic non-small cell lung cancer mouse model
[0061] A549 resistant cells in the logarithmic growth phase were digested, centrifuged, and resuspended in PBS. 100 μL of cell suspension (containing 3 million cells) was injected orally into the lungs of each nude mouse. The mice were housed in an SPF-grade animal facility to observe their condition and tumor growth. Six successfully modeled nude mice were randomly divided into three groups of two mice each: the ASO-NC group, the free ASO-NAT10 group, and the lipid nanoparticle group loaded with ASO-NAT10.
[0062] (2) Establishment of a mouse model of metastatic non-small cell lung cancer
[0063] A549 resistant cells in the logarithmic growth phase were digested, centrifuged, and resuspended in PBS. The cells were then administered via the tail vein of each nude mouse.
[0064] 12 million cells were injected and the mice were housed in an SPF-grade animal facility to observe the condition of nude mice and tumor growth. Six nude mice that successfully modeled tumors were selected and randomly divided into three groups of two mice each: the ASO-NC group, the free ASO-NAT10 group, and the lipid nanoparticle group loaded with ASO-NAT10.
[0065] (3) Drug administration: All nude mice in each group were administered the drug via tail vein injection, a total of 6 times, for 2 weeks.
[0066] (4) Specimen collection: After the administration of the drug, nude mice were euthanized by dislocation of the neck, tumor tissue was removed, and liver, heart, lung, spleen and kidney were collected.
[0067] (4) HE and IHC detection: Collected tissues were fixed in 4% sulfonated formaldehyde for 24 hours and embedded in paraffin. After sectioning (4 μm thick), HE staining and IHC treatment were performed according to the manufacturer's instructions. Images were taken using a PannoramicMIDI scanner (3DHISTECH, Hungary).
[0068] (6) Experimental results: HE evaluation showed that ASO-NAT10-loaded LNPs had minimal organ toxicity, and their tissue structure was similar to that of the control group, highlighting the safety advantage of the lung-targeted LNP delivery system. IHC analysis confirmed that after treatment with free ASO-NAT10, the expression levels of Ki67, NAT10, FASN, and RAD51 decreased, while the level of γ-H2AX increased; and ASO-NAT10 delivered via lung-targeted delivery further enhanced these effects.
[0069] The above description is merely a preferred embodiment for explaining the present invention and is not intended to limit the present invention in any way. Therefore, any modifications or changes made to the present invention under the same inventive spirit should still be included within the scope of protection intended by the present invention.
Claims
1. The use of oligonucleotide based on NAT10 gene in the preparation of drugs for reversing platinum resistance of non-small cell lung cancer.
2. The use of the oligonucleotide based on the NAT10 gene according to claim in the preparation of a drug for reversing the platinum drug resistance of non-small cell lung cancer, characterized in that, The sequence of the oligonucleotide is: 5 ’ AAATAGCTTCACAACTTTGC - 3 ’ .