Application of CCT6A inhibitor in preparation of medicine for treating colorectal cancer

Abstract

The invention belongs to the technical field of biological medicines, and discloses application of a CCT6A inhibitor in preparation of a medicine for treating colorectal cancer. CCT6A is determined to be a key cancer promoting gene of colorectal cancer for the first time, the CCT6A is remarkably and highly expressed in colorectal cancer tissues and cell lines, and high expression indicates poor prognosis of patients, so that a brand-new specific target is provided for targeted therapy of colorectal cancer. The invention discloses the cancer promoting effect of the compound in colorectal cancer and the association with 5FU drug resistance for the first time, enriches the development of colorectal cancer and the molecular mechanism research of chemotherapy drug resistance, and provides a new theoretical basis and research direction for the fundamental research in the field. Experiments prove that the inhibitor can significantly reduce the mRNA level of CCT6A in colorectal cancer cells so as to strongly inhibit tumor cell proliferation and increase the sensitivity of the colorectal cancer cells to 5-FU, and a novel therapeutic drug with high specificity and high curative effect is provided for treatment of colorectal cancer.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of CCT6A inhibitors in the preparation of drugs for treating colorectal cancer. Background Technology

[0002] Colorectal cancer (CRC), one of the most common malignant tumors worldwide, primarily occurs in the epithelial cells of the colon and rectum. Its incidence is influenced by multiple factors, including genetics, environmental pollution, unhealthy diet, and lifestyle. The development of colorectal cancer is a complex process involving multiple genes and multiple steps. Genetic susceptibility, gut microbiota imbalance, long-term chronic inflammation, high-fat, low-fiber diets, smoking, and excessive alcohol consumption all interact to promote the transformation of normal colorectal epithelial cells into adenomas and adenocarcinomas.

[0003] With the development of screening technologies, the early diagnosis rate of colorectal cancer has improved, but its treatment still faces significant challenges, especially for patients with advanced and metastatic colorectal cancer. Currently, the treatment of colorectal cancer still revolves around surgical resection, supplemented by chemotherapy, targeted therapy, immunotherapy, and other comprehensive approaches. For patients with resectable early-stage colorectal cancer, the 5-year survival rate after radical surgical resection can reach over 90%, but for patients with locally advanced or metastatic cancer, the treatment effect is often less than ideal. Chemotherapy is the basic treatment for advanced colorectal cancer, with 5-fluorouracil (5FU) and its derivatives being the most widely used first-line chemotherapy drugs in clinical practice, exerting their killing effect by interfering with cancer cell DNA synthesis. However, in clinical practice, 5FU resistance has become a key bottleneck restricting treatment efficacy. Approximately 50% of patients are insensitive to 5FU at the beginning of treatment, and another 30% to 40% of patients gradually develop acquired resistance during treatment, leading to tumor recurrence, progression, and ultimately treatment failure.

[0004] The molecular mechanisms of 5-FU resistance are extremely complex, involving multiple levels such as drug metabolism, DNA damage repair, cell cycle regulation, apoptosis signaling pathways, and the tumor microenvironment. For example, upregulation of the expression of the drug-metabolizing enzyme thymidine synthase (TS) and abnormal activity of dihydropyrimidine dehydrogenase (DPD) can affect the metabolic efficiency of 5-FU; activation of DNA repair genes such as ERCC1 and BRCA1 can enhance the ability of cancer cells to repair DNA damage induced by 5-FU; increased expression of efflux pumps such as P-glycoprotein encoded by the multidrug resistance gene (MDR1) can accelerate drug efflux; and the infiltration of tumor-associated fibroblasts and immunosuppressive cells and the imbalance of cytokine networks in the tumor microenvironment can also enhance drug resistance by regulating the survival signaling pathways of cancer cells. Due to the diversity and complexity of resistance mechanisms, there is currently a lack of effective treatment strategies to reverse 5-FU resistance in clinical practice, and there is an urgent need to develop new therapeutic targets and treatment regimens to overcome this treatment dilemma.

[0005] CCT6A (chaperonin containing TCP1 subunit 6A) is one of the eight subunits of the CCT / TRiC molecular chaperone complex. This complex has a double-ring barrel structure, with each ring composed of eight different subunits (CCT1–CCT8). CCT6A itself belongs to the ATP-dependent molecular chaperone protein family and has a typical three-domain structure: a bottom equatorial domain, a middle intermediate domain for coordinating conformational changes, and an apical domain responsible for recognizing and binding substrate proteins. Its core function is to participate in the correct folding of newly generated intracellular proteins, the repair or degradation of misfolded proteins, and to maintain intracellular protein homeostasis, thereby regulating various physiological processes such as cell proliferation, differentiation, and apoptosis. As a member of the complex, CCT6A works synergistically with other subunits to complete the folding of substrate proteins, and the specific structural differences between its subunits give it a certain functional specificity in recognizing different substrate proteins.

[0006] In recent years, an increasing number of studies have shown that CCT6A is abnormally highly expressed in various malignant tumors, such as breast cancer, liver cancer, and colorectal cancer, and its high expression is closely related to the malignancy, invasiveness, metastasis, and poor prognosis of the tumor. Existing technology CN 202210107524.5 discloses a set of exosome markers for diagnosing lymph node metastasis in invasive breast cancer and their applications. The exosome markers include upregulated and downregulated proteins; the upregulated proteins include any one or more combinations of PEPD, NCL, PARP1, ACTA2, ACTG2, TBCA, MATR3, KRT16, and CCT6A; the downregulated proteins include any one or more combinations of TTYH3, KPNB1, and RANBP2. The exosome biomarker combination provided by this invention has high accuracy in differentiating between invasive breast cancer with lymph node metastasis and invasive breast cancer in situ. It is highly efficient, practical, and non-invasive, and can be used in the preparation of diagnostic reagents or kits for diagnosing lymph node metastasis in invasive breast cancer. It is easy to promote clinically in medical institutions and can avoid excessive tissue biopsies. This technology is used for the diagnosis of lymph node metastasis in breast cancer. Existing technology CN 202110665341.0 discloses a sorafenib resistance biomarker and its application, which is CCT6A. Research on this biomarker has found that, on the one hand, in-depth research can identify the relationship between the CCT6A / B55γ pathway regulating autophagy and sorafenib resistance in liver cancer cells, providing a scientific basis for new approaches to targeting this pathway in liver cancer treatment. On the other hand, it can also provide clues for sorafenib-resistant individuals, playing a role in personalized and precise treatment in liver cancer or cancer treatment in general. This technology is based on the oncogenic effect of CCT6A and its application and verification in the treatment of liver cancer.

[0007] Existing technology CN202411133999.7 discloses the application of the combined CCT6A and p53 genes in the preparation of gene therapy drugs for colorectal cancer. This technology belongs to the field of gene therapy, and the gene therapy drug simultaneously regulates the CCT6A gene and the wild-type p53 gene. The colorectal cancer in question is characterized by abnormally high expression of the CCT6A gene and a mutation in the p53 gene. This invention provides a treatment strategy for tumors with high CCT6A expression and p53 mutations, improving the precision of tumor treatment. This technology offers a mechanism-complementary approach for colorectal cancer treatment, namely, dual-gene regulation versus single-gene regulation combined with chemotherapy. This technology is based on dual targets (downregulation of CCT6A + upregulation of wild-type p53); it depends on the p53 mutation state and does not involve any chemotherapy resistance (focusing only on tumor proliferation).

[0008] Existing technology CN202210338764.6 discloses the application of the CCT6A gene and its expression products in the diagnosis and treatment of colorectal cancer, belonging to the biomedical field. This invention is the first to discover the correlation between differential expression of the CCT6A gene and colorectal cancer, and verifies through large-sample studies that the CCT6A gene can be used as a detection target for the auxiliary diagnosis of colorectal cancer. This invention is the first to experimentally demonstrate that silencing the CCT6A gene with shRNA can inhibit the proliferation of colorectal cancer cells, suggesting that the CCT6A gene can be used as a drug target for the treatment of colorectal cancer. This invention solves the problems that current colorectal cancer molecular markers are not precise enough, insufficient, and targeted therapy is prone to drug resistance, leading to the ineffectiveness of drugs targeting the original target. It has the effect of timely and sensitive diagnosis of colorectal cancer. This technology discloses a single-target colorectal cancer diagnosis and treatment process based on CCT6A. This technology does not involve any chemotherapy drug resistance, is a single-target treatment (inhibiting only CCT6A), does not involve combination drugs / genes, and does not specify the sample (focusing on tissue / cells); there is no verification of detection efficacy; it is suitable for all colorectal cancer patients with high CCT6A expression, but cannot cover colorectal cancer patients with high CCT6A expression resistant to 5FU (clinical pain point population), does not provide a combination chemotherapy regimen, cannot address the drug resistance problem of advanced patients, and has limited clinical applicability.

[0009] However, the biological function, expression regulation mechanism, and association with chemotherapy resistance of CCT6A in colorectal cancer remain unclear. Current research indicates that CCT6A is primarily involved in protein folding, cell cycle regulation, and maintaining cellular protein homeostasis. Although studies have suggested that CCT6A is upregulated in various tumors and associated with tumor cell proliferation and migration, its biological function and specific molecular function in colorectal cancer remain ambiguous.

[0010] Therefore, in-depth research into the role and mechanism of CCT6A in colorectal cancer and the development of CCT6A-targeted therapeutic drugs are of great clinical significance and application value for improving the treatment outcomes of colorectal cancer patients. Summary of the Invention

[0011] To address the aforementioned technical problems, the purpose of this invention is to provide the application of CCT6A inhibitors in the preparation of drugs for treating colorectal cancer. This invention is the first to clearly identify CCT6A as a key oncogene in colorectal cancer, which is significantly overexpressed in colorectal cancer tissues and cell lines, and high expression predicts a poor prognosis, providing a novel specific target for targeted therapy of colorectal cancer. Oligonucleotide molecules such as siRNA and shRNA designed based on the CCT6A gene sequence can accurately recognize and bind to CCT6A mRNA, specifically silencing CCT6A gene expression through RNA interference, avoiding unnecessary damage to normal cells. Experimental data confirm that the CCT6A inhibitors of this invention can significantly downregulate the mRNA level of CCT6A in colorectal cancer cells, thereby strongly inhibiting tumor cell proliferation, providing a novel, highly specific, and effective therapeutic drug for colorectal cancer treatment, especially suitable for patients insensitive to traditional chemotherapy or with recurrent or metastatic cancer.

[0012] To achieve the above objectives, the present invention adopts the following technical solution: The application of CCT6A inhibitors in the preparation of drugs for treating colorectal cancer, wherein the CCT6A inhibitors are molecular inhibitors that inhibit CCT6A and are prepared with human CCT6A gene as the target. The molecular inhibitor is any one of oligonucleotide molecules, targeting short peptides, or antibodies; The drugs include CCT6A inhibitors used alone or in combination with 5-fluorouracil.

[0013] Preferably, the combination of the CCT6A inhibitor and 5-fluorouracil can enhance the sensitivity of the CCT6A inhibitor to 5-fluorouracil.

[0014] Preferably, the molecular inhibitor is an oligonucleotide molecule; The oligonucleotide molecule is a small interfering RNA or a short hairpin structure RNA; The target sequences of the positive strand of the small interfering RNA are shown in SEQ ID NO.1-2, and their antisense strands are complementary to the positive strands. The target sequences of the small interfering RNA encoded by the short hairpin structure RNA are shown in SEQ ID NO.1-2, respectively.

[0015] Preferably, the product form of the CCT6A inhibitor is selected from any of the following: 1) An interfering expression vector containing the CCT6A oligonucleotide molecule; 2) Host cells carrying the CCT6A oligonucleotide molecule or the interference expression vector; 3) A reagent containing the CCT6A oligonucleotide molecule, or the interference expression vector, or the host cell; 4) A pharmaceutical composition containing the CCT6A inhibitor.

[0016] Preferably, the interference expression vector for expressing the CCT6A oligonucleotide molecule is a retroviral vector.

[0017] Preferably, the CCT6A inhibitor achieves colorectal cancer treatment in the following manner: 1) Reduce the mRNA and protein expression levels of CCT6A; 2) Inhibits the proliferation / migration of colorectal cancer cells; 3) Suppresses tumors when used alone; When used in combination with 5-fluorouracil, it enhances the efficacy of chemotherapy by downregulating the tolerance of colorectal cancer cells to 5-fluorouracil.

[0018] Preferably, the drug comprises the CCT6A inhibitor and a pharmaceutically acceptable carrier or excipient.

[0019] The application of reagents for detecting CCT6A gene expression levels in the preparation of a kit for treating colorectal cancer, wherein the detection reagents in the kit include primer pairs for detecting CCT6A gene expression levels, the nucleotide sequences of which are shown in SEQ ID NO. 3-4 and SEQ ID NO. 5-6.

[0020] A pharmaceutical composition for treating colorectal cancer, the pharmaceutical composition comprising any one of the following: the CCT6A inhibitor, a vector containing a CCT6A oligonucleotide molecule, a retrovirus containing a CCT6A oligonucleotide molecule vector, a host cell, or a reagent; or, It includes pharmaceutically acceptable carriers for use in combination with 5-fluorouracil.

[0021] Compared with the prior art, the present invention has at least the following technical effects: This invention provides the application of CCT6A inhibitors in the preparation of drugs for treating colorectal cancer.

[0022] This CCT6A inhibitor has the following advantages: 1) Precise Targeted Therapy with Significant Efficacy and High Specificity: This invention is the first to clearly identify CCT6A as a key oncogene in colorectal cancer. It is significantly overexpressed in colorectal cancer tissues and cell lines, and high expression predicts a poor prognosis, providing a novel specific target for targeted therapy of colorectal cancer. Oligonucleotide molecules such as siRNA and shRNA designed based on the CCT6A gene sequence can precisely recognize and bind to CCT6A mRNA, specifically silencing CCT6A gene expression through RNA interference, avoiding unnecessary damage to normal cells. Experimental data confirm that the CCT6A inhibitor of this invention can significantly downregulate the mRNA level of CCT6A in colorectal cancer cells, thereby strongly inhibiting tumor cell proliferation. This provides a novel therapeutic drug with high specificity and efficacy for the treatment of colorectal cancer, especially suitable for patients who are insensitive to traditional chemotherapy or have recurrent metastases.

[0023] 2) Effectively Reversing 5FU Resistance and Enhancing Chemotherapy Efficacy: Addressing the prominent clinical problem of 5FU resistance, the CCT6A inhibitor of this invention significantly reduces the tolerance of colorectal cancer cells to 5FU by downregulating CCT6A expression. IC50 experiments confirmed that cancer cells treated with the inhibitor showed a significant increase in sensitivity to 5FU. When used in combination with 5FU, it significantly enhances the killing effect of 5FU on colorectal cancer cells, effectively reversing the 5FU resistance phenotype. This advantage allows this invention to provide a new treatment option for patients with 5FU-resistant colorectal cancer, and it can also be used in newly diagnosed patients to improve chemotherapy success rates and prolong patient survival, providing a practical solution to the clinical challenge of chemotherapy resistance in colorectal cancer.

[0024] 3) Good safety profile and low toxicity: Because the inhibitor of this invention has high target specificity, it only acts on colorectal cancer cells that abnormally overexpress CCT6A, with minimal impact on normal colorectal epithelial cells and other tissue cells. Compared to traditional chemotherapy drugs, it significantly reduces damage to normal physiological functions and is expected to reduce the occurrence of serious toxic side effects such as hair loss, bone marrow suppression, and gastrointestinal reactions. Furthermore, the retroviral vector, pharmaceutically acceptable vector, and excipients used have all been clinically validated, ensuring safety and further enhancing the clinical feasibility and patient tolerability of this invention.

[0025] 4) Driving Technological Innovation in Colorectal Cancer Treatment: This invention reveals for the first time the pro-cancer effect of CCT6A in colorectal cancer and its association with 5FU resistance, enriching the research on the molecular mechanisms of colorectal cancer development and chemotherapy resistance, and providing new theoretical basis and research directions for basic research in this field. Simultaneously, this invention combines gene therapy technology with targeted therapy to develop a novel inhibitor against CCT6A, breaking through the limitations of traditional chemotherapy drugs and providing a completely new technical pathway for colorectal cancer treatment. It is expected to promote the leap from traditional chemotherapy to precision targeted therapy and gene therapy in colorectal cancer treatment, possessing significant scientific value and clinical revolutionary significance. Attached Figure Description

[0026] Figure 1 This is a schematic diagram illustrating the analysis of transcriptomics data in the TCGA colorectal cancer dataset (COAD). Figure 2 A schematic diagram illustrating the prognosis of colorectal cancer patients with high CCT6A expression. Figure 3 This is a schematic diagram showing the expression level of CCT6A in colorectal cancer cell lines. Figure 4 A schematic diagram illustrating the effect of CCT6A inhibitor treatment on the mRNA level of CCT6A in colorectal cancer cell lines; Figure 5 A schematic diagram illustrating the changes in cell proliferation capacity after treatment with CCT6A inhibitor; Figure 6 A schematic diagram illustrating the changes in tolerance to 5-FU after treatment with CCT6A inhibitors; Figure 7 This diagram illustrates the changes in cell proliferation capacity after combined treatment with CCT6A inhibitor and 5-FU. Detailed Implementation

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the present invention will be briefly introduced below in conjunction with the accompanying drawings and descriptions of the embodiments or the prior art. Obviously, the following description of the structure of the accompanying drawings is only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. It should be noted that the description of these embodiments is for the purpose of helping to understand the present invention, but does not constitute a limitation of the present invention.

[0028] One specific embodiment of the present invention is as follows: This invention provides a gene therapy drug targeting the human CCT6A gene, which is suitable for the treatment of colorectal cancer and can also be used in combination with the chemotherapy drug 5-FU to improve the treatment effect.

[0029] An oligonucleotide molecule is provided that can reduce the expression level of CCT6A in colorectal cancer cells. This nucleic acid molecule is a small interfering RNA (siRNA) or a short hairpin RNA (shRNA).

[0030] The specific target sequences of the positive strand of the double-stranded RNA or shRNA are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0031] SEQ ID NO.1:GAACAUCUCUUCGUACUAAAG SEQ ID NO.2:CAUCUCUUCGUACUAAAGUUC The small interfering RNA (siRNA) comprises two strands: the first strand is an interfering sequence designed according to the sequences shown in SEQ ID NO:1 and SEQ ID NO:2, targeting the human CCT6A gene; the second strand is complementary to the first strand. The siRNA can specifically silence the expression of endogenous CCT6A in colorectal cancer. Furthermore, the short hairpin RNA (shRNA) consists of a sense strand and an antisense strand connected by a stem-loop structure; the sense and antisense strand sequences are complementary, and the sense strand sequence is consistent with the target sequence of the CCT6A gene, thereby achieving efficient silencing of the CCT6A gene.

[0032] It also provides an interference expression vector targeting the CCT6A gene, which can express shRNA specifically targeting CCT6A in cells or in vivo, thereby silencing the gene.

[0033] Furthermore, this invention provides a method for preparing retroviruses from the aforementioned interference expression vector, comprising the following steps: (1) Linearize the retroviral vector; (2) Annealing of paired single-stranded primers to form insert fragments; (3) The inserted fragment was ligated to a linearized retroviral vector and then transformed into Escherichia coli; (4) The interference expression vector was obtained by colony identification and sequencing verification.

[0034] Furthermore, a retrovirus targeting the CCT6A gene was provided, which was obtained by packaging the aforementioned interfering nucleic acid construct with the aid of a retroviral helper plasmid and viral packaging cells.

[0035] The aforementioned uses of nucleic acid molecules, interference expression vectors, or retroviruses include: preparing drugs for the treatment of colorectal cancer, or preparing kits for detecting the expression level of the CCT6A gene in colorectal cancer cells.

[0036] A composition for the prevention or treatment of colorectal cancer, the active ingredient comprising: the aforementioned oligonucleotide; and / or the aforementioned CCT6A gene interference expression vector; and / or the aforementioned CCT6A-targeting retrovirus, and may further comprise a pharmaceutically acceptable vector or excipient.

[0037] In summary, the CCT6A inhibitor of this invention has significant advantages in the preparation of colorectal cancer treatment products. By designing a reasonable RNAi target sequence targeting the target gene, a retroviral vector plasmid containing the target sequence was successfully constructed, and a retrovirus capable of efficiently silencing CCT6A was obtained. This retrovirus can significantly reduce the mRNA expression level of CCT6A, with a prominent knockdown effect, and significantly inhibits the proliferation and migration of colorectal cancer cells. Therefore, this invention has important application value in the treatment of colorectal cancer and possesses high-throughput operability and good reproducibility.

[0038] Implementation procedure: 1. This invention provides two retroviruses for the treatment of colorectal cancer, whose RNAi target fragment coding sequences are as follows: SEQ ID NO.1:GAACAUCUCUUCGUACUAAAG SEQ ID NO.2: CAUCUCUUCGUACUAAAGUUC For the above target sequences, corresponding shRNA sequences were designed and cloned into retroviral vectors.

[0039] The steps for constructing retroviral vector plasmids include: first, selecting psiREN as the tool vector, and then synthesizing the corresponding single-stranded primers according to the target gene sequence.

[0040] Regarding SEQ ID NO.1: Upstream primer (SEQ ID NO.3): GATCCGAACATCTCTTCGTACTAAAGTTCAAGAGACTTTAGTACGAAGAGATGTTCTTTTTTGCTAGCG Downstream primer (SEQ ID NO.4): AATTCGCTAGCAAAAAAGAACATCTCTTCGTACTAAAGTCTCTTGAACTTTAGTACGAAGAGATGTTCG Regarding SEQ ID NO.2: Upstream primer (SEQ ID NO.5): GATCCCATCTCTTCGTACTAAAGTTCTTCAAGAGAGAACTTTAGTACGAAGAGATGTTTTTTGCTAGCG Downstream primer (SEQ ID NO.6): AATTCGCTAGCAAAAAACATCTCTTCGTACTAAAGTTCTCTCTTGAAGAACTTTAGTACGAAGAGATGG The complementary primers described above are annealed to form double-stranded oligonucleotides (oligo DNA).

[0041] 2. The annealing system is as follows: Upstream primer 2.5 μL (10 μmol / L) Downstream primer 2.5 μL (10 μmol / L) Annealing buffer 5 μL 10 μL of ultrapure water After mixing, anneal the mixture in a PCR instrument as follows: Heat at 95 ℃ for 5 min; Then, the temperature was decreased by 1 °C per cycle and held for 30 seconds, for a total of 90 cycles; Finally, store at 4 ℃.

[0042] 3. Plasmid construction: The oligonucleotides (oligo DNA) were ligated into a linearized tool vector and then transformed. The specific steps are as follows: 3.1 Vector digestion pSIREN-RetroQ was selected as the vector, and double digestion with EcoRI and XhoI was performed. The digestion reaction system was as follows: 16μL of ultrapure water 10×CutSmart Buffer 4 μL pSIREN-RetroQ plasmid DNA (1 μg / μL) 12 μL Xho I (10 U / μL) 1 μL EcoRI (10 U / μL) 1 μL The reaction was carried out at 37°C for 1 h, and the target fragment was separated and recovered by agarose gel electrophoresis.

[0043] 3.2 Connection Reaction The enzyme-digested vector was reacted with oligonucleotides at 22 °C for 1 h. The reaction system was as follows: Enzyme digestion vector 50 ng oligo DNA (100 ng / μL) 2 μL 10 × T4 DNA ligase Buffer 2 μL T4 DNA ligase 0.5 μL Make up to 20 μL of ultrapure water. 4. Transformation and Cloning Screening After thawing DH5α competent cells on ice, 10 μL of ligation product was added, and the cells were incubated on ice for 3 min. The cells were then heat-shocked at 42℃ for 90 s, followed by another 3 min on ice. Subsequently, 200 μL of antibiotic-free LB broth was added, and the cells were incubated at 37℃ with shaking at 200 rpm for 1 h. 150 μL of the bacterial culture was then spread onto LB agar plates containing ampicillin (Amp) and incubated at 37℃ for 14 h.

[0044] 5. Colony identification and plasmid extraction Transformants were selected and inoculated into LB broth containing Amp, and cultured at 37°C for 14 h. Single clones were selected for sequencing. Clones with correct sequencing results were inoculated into 150 mL LB broth (containing Amp) and cultured overnight at 37°C with shaking. Plasmids were extracted using the Tiangen endotoxin-free plasmid extraction kit, following these steps: Bacterial cell enrichment: Take 10 mL of bacterial solution and centrifuge at 8000 rpm for 4 min; Lysis: Resuspend the bacterial cells in 1 mL GP1 Buffer and transfer to a 2.0 mL EP tube; Cycle termination: Add 0.5 mL GP2 Buffer, gently invert to mix, let stand for 1 min, and centrifuge at 12000 rpm for 1 min; Adsorption: Take 0.7 mL of the supernatant and add it to the activated GP adsorption column. Centrifuge at 13000 rpm for 1 min and discard the waste liquid. Washing: Add 0.5 mL GPW Buffer and centrifuge at 12000 rpm for 1 min; Recovery: Replace the collection tube, add 0.2 mL GP3 Buffer, let stand for 1 min, centrifuge at 12000 rpm for 1 min to obtain the purified plasmid.

[0045] (2) Retroviral packaging Cell preparation: 24 h before transfection, HEK293T cells were seeded in 6 cm culture dishes to achieve a cell density of 40% to 50% at the time of transfection.

[0046] 6. Calcium phosphate transfection method Change the culture medium 1 h before transfection. Add the plasmid to be transfected to a 1.5 mL EP tube, add water to a final volume of 182.75 μL and mix well. Add 21.5 μL of 10×HBS (0.2 M HEPES-KOH, pH 7.2; 1.37 M NaCl; 50 mM KCl; 7 mM Na2HPO4; 60 mM Glucose), vortex to mix. Slowly add 10.75 μL of 2 M CaCl2, vortex gently for 10 s. After allowing the mixture to stand at room temperature for 15 min, add it dropwise to the cell culture medium, gently shaking to mix. Incubate at 37℃ for 8–12 h, then replace with fresh culture medium.

[0047] The transfection system consisted of 5 μg of pSIREN-shRNA plasmid and 5 μg of pHelper retroviral packaging plasmid.

[0048] 7. Virus Collection Forty-eight hours post-transfection, the virus-containing culture medium was collected once and stored temporarily at 4°C; 4 mL of fresh culture medium was added for further incubation. Seventy-two hours post-transfection, the virus-containing culture medium was collected a second time, and the supernatants from both collections were combined to approximately 8 mL. 40 μL of Polybrene (4 mg / mL) and 40 μL of HEPES (20 mM, pH 7.2) were added, mixed well, and then filtered through a 0.22 μm filter to remove cell debris. The resulting filtrate was the retroviral solution.

[0049] Note: This system can be scaled up proportionally when used for mass production of retroviruses.

[0050] Experimental example: Experiment 1: Analysis of transcriptomic data from the TCGA colorectal cancer dataset (COAD).

[0051] like Figure 1 The diagram shown is a schematic representation of the analysis of transcriptomics data in the TCGA colorectal cancer dataset (COAD).

[0052] Results combined Figure 1 The results showed that CCT6A expression was significantly upregulated in colorectal cancer tumor tissue compared to normal tissue.

[0053] Experiment 2: Using the TCGA colorectal cancer dataset, patients were divided into low and high CCT6A expression groups based on the median CCT6A expression level.

[0054] like Figure 2 The diagram shown illustrates how high CCT6A expression predicts the prognosis of colorectal cancer patients.

[0055] Results combined Figure 2Studies have shown that high CCT6A expression predicts a poorer prognosis in colorectal cancer patients. Survival analysis revealed that patients with high CCT6A expression had an even worse prognosis.

[0056] Experiment 3: Total RNA was extracted from the normal human colorectal epithelial cell line NCM460 and colorectal cancer cell lines HCT116, SW480, DLD-1, and HCT-8. RT-qPCR was then performed using primer pairs SEQ ID NO.7: AAGGGCACCATGAAGATGCT and SEQ ID NO.8: AGAGATCCGCCTGTTTCAGC to detect the difference in CCT6A gene expression between the normal cell line and the colorectal cancer cell line (Actin was used as an internal control).

[0057] like Figure 3 The figure shows a schematic diagram of the expression level of CCT6A in colorectal cancer cell lines.

[0058] Results combined Figure 3 The results showed that the expression level of CCT6A was significantly upregulated in colorectal cancer cell lines compared with normal colorectal epithelial cells.

[0059] Experiment 4: Using the colorectal cancer cell line HCT116, after treating cells with a CCT6A inhibitor for 72 hours, cell samples were collected and RNA was extracted. The changes in intracellular CCT6A mRNA expression levels after treatment with control cells and two CCT6A-targeting inhibitors were detected by RT-qPCR.

[0060] like Figure 4 The diagram shows the effect of CCT6A inhibitor treatment on the mRNA level of CCT6A in colorectal cancer cell lines.

[0061] Results combined Figure 4 The results showed that treatment with CCT6A inhibitors significantly reduced the mRNA level of CCT6A in colorectal cancer cell lines. Both inhibitors targeting CCT6A significantly downregulated CCT6A expression in colorectal cancer cells.

[0062] Experiment 5: Using the above cell lines, the changes in cell proliferation capacity after treatment with CCT6A inhibitor were detected by MTS cell proliferation assay.

[0063] like Figure 5 The diagram shown illustrates the changes in cell proliferation capacity after treatment with CCT6A inhibitor.

[0064] Results combined Figure 5The results showed that treatment of colorectal cancer cells with the prepared CCT6A inhibitors and inhibition of CCT6A significantly reduced the proliferation ability of colorectal cancer cells. The results also indicated that both CCT6A inhibitors could significantly inhibit the proliferation of colorectal cancer cells.

[0065] Experiment 6: Using the above cell lines, via IC 50 The experiment investigated the changes in the tolerance of rectal cancer cells to 5-FU after treatment with CCT6A inhibitors.

[0066] like Figure 6 The diagram shown illustrates the change in tolerance to 5-FU after treatment with a CCT6A inhibitor. Results combined Figure 6 The results showed that after treating colorectal cancer cells with the CCT6A inhibitor prepared above and inhibiting CCT6A, IC50 was significantly reduced. 50 Experiments have shown that colorectal cancer cells have a significantly reduced tolerance to 5-FU.

[0067] Experiment 7: Colorectal cancer cells were treated with the chemotherapy drug 5-FU in combination with the CCT6A inhibitor prepared above. NC served as the control group. KD1 was the inhibitor treatment group corresponding to SEQ ID NO.1 (Knockdown1), and KD2 was the inhibitor treatment group corresponding to SEQ ID NO.2 (knockdown2).

[0068] like Figure 7 The diagram shown illustrates the changes in cell proliferation capacity after combined treatment with CCT6A inhibitor and 5-FU.

[0069] Results combined Figure 7 The results showed that treatment of colorectal cancer cells with the chemotherapy drug 5-FU in combination with the CCT6A inhibitor prepared above significantly inhibited cell proliferation.

[0070] The oligonucleotides SEQ ID NO. 7 & SEQ ID NO. 8 used above can be used to detect the expression level of CCT6A in tissues or cells, and are suitable for diagnosis, prognosis, and disease monitoring. For example, they can be used to assess and predict tumor malignancy, drug resistance, and prognosis. The above detection can be performed in vitro or in vivo. The oligonucleotides can be used in combination with pharmaceutically acceptable excipients and can be delivered via sustained-release or controlled-release delivery systems. These delivery systems include, but are not limited to, liposome carriers, nanoparticles, porous microspheres, and microneedle arrays.

[0071] In this invention, the active ingredient that performs the above-mentioned function may be only a CCT6A inhibitor, or it may further include other molecules with similar functions. The CCT6A inhibitor may be the sole active ingredient of the product or it may be used in combination with other active ingredients. The product may be a single-component formulation or a multi-component formulation; its dosage form is not limited and may be prepared in various forms such as solid, liquid, gel, semi-fluid, and aerosol.

[0072] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of CCT6A inhibitors in the preparation of drugs for treating colorectal cancer, characterized in that, The CCT6A inhibitor is a molecular inhibitor that inhibits CCT6A and is prepared by targeting the human CCT6A gene. The molecular inhibitor is any one of oligonucleotide molecules, targeting short peptides, or antibodies; The drugs include CCT6A inhibitors used alone or in combination with 5-fluorouracil.

2. The use of the CCT6A inhibitor according to claim 1 in the preparation of a drug for treating colorectal cancer, characterized in that, When the CCT6A inhibitor is used in combination with 5-fluorouracil, the sensitivity of the CCT6A inhibitor to 5-fluorouracil can be improved.

3. The application of the CCT6A inhibitor according to claim 1 in the preparation of a drug for treating colorectal cancer, characterized in that, The molecular inhibitor is an oligonucleotide molecule; The oligonucleotide molecule is a small interfering RNA or a short hairpin structure RNA; The target sequences of the positive strand of the small interfering RNA are shown in SEQ ID NO.1-2, and their antisense strands are complementary to the positive strands. The target sequences of the small interfering RNA encoded by the short hairpin structure RNA are shown in SEQ ID NO.1-2, respectively.

4. The use of the CCT6A inhibitor according to claim 1 in the preparation of a drug for treating colorectal cancer, characterized in that, The product form of the CCT6A inhibitor is selected from any of the following: 1) An interfering expression vector containing the CCT6A oligonucleotide molecule; 2) Host cells carrying the CCT6A oligonucleotide molecule or the interference expression vector; 3) A reagent containing the CCT6A oligonucleotide molecule, or the interference expression vector, or the host cell; 4) A pharmaceutical composition containing the CCT6A inhibitor.

5. The use of the CCT6A inhibitor according to claim 4 in the preparation of a drug for treating colorectal cancer, characterized in that, The interference expression vector for expressing the CCT6A oligonucleotide molecule is a retroviral vector.

6. The use of the CCT6A inhibitor according to claim 1 in the preparation of a drug for treating colorectal cancer, characterized in that, The CCT6A inhibitor achieves colorectal cancer treatment through the following methods: 1) Reduce the mRNA and protein expression levels of CCT6A; 2) Inhibits the proliferation / migration of colorectal cancer cells; 3) Suppresses tumors when used alone; When used in combination with 5-fluorouracil, it enhances the efficacy of chemotherapy by downregulating the tolerance of colorectal cancer cells to 5-fluorouracil.

7. The use of the CCT6A inhibitor according to claim 1 in the preparation of a drug for treating colorectal cancer, characterized in that, The drug comprises the aforementioned CCT6A inhibitor and a pharmaceutically acceptable carrier or excipient.

8. The application of a reagent for detecting CCT6A gene expression levels in the preparation of a kit for treating colorectal cancer, characterized in that... The detection reagents in the kit include primer pairs for detecting the expression level of the CCT6A gene, the nucleotide sequences of which are shown in SEQ ID NO.3-4 and SEQ ID NO.5-6.

9. A pharmaceutical composition for treating colorectal cancer, characterized in that, The pharmaceutical composition comprises any one of the following: a CCT6A inhibitor as described in any one of claims 1 to 3; a vector containing a CCT6A oligonucleotide molecule; a retrovirus containing a CCT6A oligonucleotide molecule vector; a host cell; or a reagent. or, It includes pharmaceutically acceptable carriers for use in combination with 5-fluorouracil.

Images