Efficient screening method and application of fusarium venanii

Abstract

The invention discloses an efficient screening method and application of fusarium venanii, and belongs to the technical field of microorganisms and food. According to the invention, a fusarium venanii specific area is excavated based on whole genome sequence scanning, a species specific amplification primer is designed, and the fusarium venanii is separated and identified from soil based on the species specific primer and a bacterial colony color on a specific culture medium, so that an efficient screening method for the fusarium venanii is established. The method has important practical significance for promoting the development of the edible protein industry in China.

Description

Technical Field

[0001] This invention relates to the fields of microbiology and food technology, and specifically to a highly efficient screening method for Fusarium venenatum. Background Technology

[0002] Protein is an indispensable building block of life and crucial to human health. However, under the dual pressures of continuous global population growth and environmental pollution, protein resource shortages are gradually becoming an increasingly severe global challenge. Traditional agriculture and animal husbandry face numerous limitations in terms of land and water resources, production cycles, and environmental carrying capacity, making it difficult to meet the world's growing protein demand. Against this backdrop, exploring new alternative protein sources has become a key issue concerning global food security and the future of humanity.

[0003] Microorganisms are characterized by rapid reproduction and high energy conversion efficiency. Microbial proteins obtained through fermentation are ideal alternatives to traditional protein sources due to their high safety and balanced nutrition. Among them, mycelial protein produced by the filamentous fungus *Fusarium* not only possesses a meat-like texture and a high protein digestibility-corrected amino acid score, but also has potential value in improving various health problems, making it one of the most promising alternative food proteins. This mycelial protein has obtained GRAS certification and is already available in more than ten countries, used in over 79 products, including whole meat imitators, minced meat substitutes, and seafood-style substitutes. Therefore, a sustainable supply of high-quality mycelial protein is crucial for promoting the development of the alternative protein industry.

[0004] Microbial strains, as the core foundation and original innovation basis of synthetic biology, are key strategic resources driving the innovation and sustainable development of the biomanufacturing industry. However, the number of reported Fusarium venetum strains is still relatively small, and the intellectual property rights of these strains are mainly held by European and American countries. Furthermore, there is currently a lack of efficient screening methods for this fungus. Therefore, establishing an efficient screening system for Fusarium venetum and obtaining high-performance strains with independent intellectual property rights based on this system is of significant practical importance for promoting the development of my country's edible protein industry. Summary of the Invention

[0005] The technical problem to be solved by this invention is: how to establish an efficient screening method for Fusarium vesicae.

[0006] The technical solution of this invention is: a highly efficient screening method for Fusarium vesicatoria, comprising the following steps:

[0007] (1) Soil samples were serially diluted with water and then spread onto PSA solid medium for screening culture;

[0008] (2) Select red colonies and purify them on new PSA solid medium;

[0009] (3) Use the Venetian Fusarium-specific primer set to perform PCR amplification on the purified cultured strains, and select strains that can obtain the target amplification product;

[0010] (4) The selected strains were further confirmed by amplification and sequencing using ITS primers;

[0011] The *Fusarium vesicae*-specific primer set consists of primer pairs shown in SEQ ID No. 1 to SEQ ID No. 2 and primer pairs shown in SEQ ID No. 3 to SEQ ID No. 4. The amplification product of primer pairs shown in SEQ ID No. 1 to SEQ ID No. 2 has a length of 552 bp, and the amplification product of primer pairs shown in SEQ ID No. 3 to SEQ ID No. 4 has a length of 465 bp.

[0012] Furthermore, the PSA solid culture medium consists of: 200 g of potato filtrate filtered through gauze after boiling, 20 g of sucrose, 20 g of agar powder, and deionized water to a final volume of 1 L.

[0013] Further, in step (1), the screening culture conditions are: culture at 28℃ for 3-5 days; in step (2), the purification culture conditions are: culture at 28℃ for 3 days.

[0014] Further, in step (4), the nucleotide sequence of the ITS primer is shown in SEQ ID No. 5 and SEQ ID No. 6.

[0015] The Fusarium vesicae-specific primer set consists of primer pairs shown in SEQ ID No. 1~SEQ ID No. 2 and primer pairs shown in SEQ ID No. 3~SEQ ID No. 4.

[0016] A kit containing the specific primer set described above.

[0017] The application of the aforementioned specific primer sets or kits in the identification of Fusarium venetum.

[0018] Fusarium venenatum Ts001 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42556.

[0019] The aforementioned application of Fusarium venenatum Ts001 in microbial protein production.

[0020] This invention establishes a highly efficient screening method for Fusarium venetum by mining specific regions of Fusarium venetum through whole-genome sequence scanning and designing species-specific amplification primers. Based on the species-specific primers and the colony color on specific culture media, Fusarium venetum is isolated and identified from soil.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] This invention successfully established a highly efficient screening method for Fusarium venenatum, and based on this method, screened a strain of Fusarium venenatum Ts001 that can utilize different carbon source substrates, which has important practical significance for promoting the development of my country's edible protein industry.

[0023] Preservation information:

[0024] Fusarium venenatum Ts001 was deposited on January 15, 2026, at the China General Microbiological Culture Collection Center (address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing), with accession number CGMCC No. 42556. Attached Figure Description

[0025] Figure 1 Phylogenetic analysis of Fusarium ITS sequences.

[0026] Figure 2 The genomes of *Fusarium venetum* are compared with those of its close relatives, *Fusarium xanthosporum* and *Fusarium elderii*.

[0027] Figure 3 Design and validation of specific primers for *Fusarium vesicae*. In the figure, M: marker 2000; C: control water; 1-15 represent *Fusarium vesicae*, *Fusarium xanthosporum*, *Fusarium septum*, *Fusarium graminearum*, *Verticillium dahliae*, *Cynodon dactylon*, *Beauveria bassiana*, *Metarhizium anisopliae*, *Saccharomyces cerevisiae*, *Pichia pastoris*, *Escherichia coli*, *Agrobacterium*, *Staphylococcus aureus*, and *Bacillus*, respectively.

[0028] Figure 4 Screening and identification of Fusarium venenatum TS strain. (A) Schematic diagram of the screening and identification process for Fusarium venenatum from soil. (B) Colony color and specific primer amplification results of the screened Fusarium venenatum on PSA plates. (C) Blast alignment results of the ITS amplified sequence.

[0029] Figure 5Biomass of Fusarium venenatum TS in fermentation media with different carbon sources (1-5 are glucose, xylose, fructose, sodium acetate, and glycerol, respectively). Detailed Implementation

[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from commercial sources.

[0031] Example 1: Identification of Fusarium strains closely related to Fusarium venetum based on ITS sequence evolutionary analysis

[0032] ITS sequences of *Talaromyces purpureogenus* CEF642 were downloaded from the NCBI database and phylogenetic analysis was performed using MEGA software (Li, P., Wei, F., Feng, H., Zhao, L., Zhang, Y., Zhou, J., Feng, Z., Zhu, H. (2025)). N As a promising biocontrol agent for cotton disease control. Journal of Agricultural and Food Chemistry, 73(5), 2760-2772.), which identified the Fusarium strain most closely related to Fusarium venetum.

[0033] The results are as follows Figure 1 As shown, through ITS sequence analysis of the Fusarium genus, it was confirmed that Fusarium culmorum and Fusarium sambucinum are most closely related to Fusarium venenatum, which can be used for subsequent mining of Fusarium venenatum-specific region sequences based on whole genome sequence alignment.

[0034] Example 2: Mining specific regions of Fusarium venetum based on whole-genome sequence scanning and designing species-specific amplification primers

[0035] The whole genome sequences of *Fusarium venenatum* (GCA_900007375.1), *Fusarium culmorum* (GCA_016952355.1), and *Fusarium sambucinum* (GCA_050947815.1) were compared using Mauve online software to identify *Fusarium venenatum*-specific sequence regions.

[0036] The results are as follows Figure 2 As shown, compared with the genomes of closely related *Fusarium oxysporum* and *Fusarium elderberry*, the genome of *Fusarium venetum* has a specific sequence region (as shown in the figure). (The area shown).

[0037] For specific regions of Fusarium vesicatoria, Primer pair 1 and Primer pair 2 with amplification products of approximately 500 bp were designed using Primer-BLAST from NCBI.

[0038] Primer pair 1:

[0039] Primer pair 1-FCCTTTGTTGAAGTCAACGCC (SEQ ID No.1)

[0040] Primer pair 1-RTATAATCTCCTGACTATTTC (SEQ ID No.2)

[0041] Primer pair 2:

[0042] Primer pair 2-FCATTGTCTTTCGACCCGACA (SEQ ID No.3)

[0043] Primer pair 2-RTCGCCCTCGCCATGACCAAC (SEQ ID No.4)

[0044] Amplification was performed using primer pairs 1 and 2 in various microorganisms, including *Fusarium vesicae*, *Fusarium xanthosporum*, *Fusarium elderberry*, *Fusarium oxysporum*, *Fusarium graminearum*, *Verticillium dahliae*, *Cyanobacterium*, *Beauveria bassiana*, *Metarhizium anisopliae*, *Saccharomyces cerevisiae*, *Pichia pastoris*, *Escherichia coli*, *Agrobacterium tumefaciens*, *Staphylococcus aureus*, and *Bacillus*. The amplification program was: 95℃ for 3 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min (TaqMix, Vazyme). Species specificity of the primers was detected by electrophoresis.

[0045] The results are as follows Figure 3 As shown, the two primer pairs designed in this region, Primer pair 1 and Primer pair 2, were confirmed by PCR amplification results in different microbial strains to amplify bands of the target size only in Fusarium vesicae (Primer pair 1 amplification product was 552bp, and Primer pair 2 amplification product was 465bp), indicating the specificity of the primers for Fusarium vesicae.

[0046] Example 3: Isolation and identification of Fusarium venetum from soil based on species-specific primers and colony color on specific culture media.

[0047] Take 10 g of soil sample and add it to a shake flask containing 90 ml of sterile water. Mix well and then perform 10⁻ 5After serial dilution, the mixture was spread onto PSA agar plates (200 g potato filtrate filtered through gauze after boiling, 20 g sucrose, 20 g agar powder, and deionized water to a final volume of 1 L) to produce a red color in *Fusarium venenatum* colonies (Tong, S., An, K., Chen, W., Zhou, W., Sun, Y., Wang, Q., Li, D. (2022b). Evasion of Cas9 toxicity to develop an efficient genome editing system and its application to increase ethanol yield in *Fusarium venenatum* TB01. *Applied Microbiology and Biotechnology*, 106, 6583-6593), and incubated at 28°C for 3-5 days. The red colonies were then transferred to new PSA plates and incubated at 28°C for another 3 days. Subsequently, specific primers were used to screen these colonies by PCR using Primer pair 1 and Primer pair 2 (95℃ 3 min; 95℃ 15 s, 60℃ 15 s, 72℃ 30 s, 35 cycles; 72℃ 5 min. Taq Mix, Vazyme). Strains with amplified products of approximately 500 bp were selected and amplified using ITS primers (TCCGTAGGTGAACCTGCGG, TCCCCGCTTATTGATATGC) (95℃ 3 min; 95℃ 15 s, 60℃ 15 s, 72℃ 30 s, 35 cycles; 72℃ 5 min. Taq Mix, Vazyme) and sequenced for further confirmation.

[0048] Based on the specific primers for *Fusarium vesicae* designed in Implementation Case 2 and the fact that *Fusarium vesicae* colonies can appear red on PSA plates, a formula was developed... Figure 4 The procedure for isolating *Fusarium venetum* from soil is shown in Figure A. Based on this procedure, strains that appear red on PSA plates and whose target bands can be amplified using *Fusarium venetum*-specific primers were selected. Figure 4 (B); Further PCR amplification of the strain using ITS and sequencing comparison results confirmed that the screened strain was *Fusarium venetum* (Venetiana). Figure 4 The strain, named Fusarium venenatum Ts001, was deposited on January 15, 2026, at the China General Microbiological Culture Collection Center (address: No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing), with accession number CGMCC No. 42556.

[0049] Example 4: Fermentation evaluation of the screened Fusarium venenatum Ts001 with different substrates as carbon sources.

[0050] 1. Culture medium

[0051] GYA solid culture medium: 30g glucose, 8g yeast extract, 15g agar powder, and deionized water to a final volume of 1L.

[0052] Fermentation liquid culture medium: 40 g different carbon sources, 1 g yeast extract, 5 g ammonium sulfate, 1.5 g magnesium sulfate, 0.8 g potassium chloride, 0.5 g sodium sulfate, 2 g potassium dihydrogen phosphate, 0.02 g zinc sulfate, 0.5 g calcium carbonate, and bring the volume to 1 L.

[0053] 2. Experimental Methods

[0054] The selected *Fusarium vesicae* strain Ts001 was inoculated onto GYA solid medium and cultured for 10 days, followed by preparation of 5 × 10⁻⁶ samples. 6 A spore suspension with a concentration of conidia / mL was prepared. 200 μL of the above spore suspension was inoculated into 50 mL of GYB liquid medium with different carbon sources (glucose, xylose, fructose, sodium acetate, glycerol) and cultured at 28°C and 200 rpm on a shaker for 1 day. Then, the culture was transferred to a 2L shake flask containing 400 mL of fermentation medium and cultured at 28°C and 200 rpm on a shaker for 3 days. After fermentation, 100 mL of the fermentation sample was collected by vacuum filtration to harvest the cells. The cells were then dried to constant weight using an oven, and their biomass (g / L) was calculated.

[0055] 3. Results

[0056] The results are as follows Figure 5 As shown, *Fusarium venenatum* Ts001 can grow on various selected carbon sources, with the highest biomass found in fermentation media using glucose (9.6 g / L) and fructose (10.2 g / L) as carbon sources, followed by glycerol (7.8 g / L) and xylose (7.4 g / L), while sodium acetate showed the worst biomass (5.7 g / L). It can be used for the production of microbial proteins.

Claims

1. A highly efficient screening method for Fusarium vesicae, characterized in that, Includes the following steps: (1) Soil samples were serially diluted with water and then spread onto PSA solid medium for screening culture; (2) Select red colonies and purify them on new PSA solid medium; (3) Use the Venetian Fusarium-specific primer set to perform PCR amplification on the purified cultured strains, and select strains that can obtain the target amplification product; (4) The selected strains were further confirmed by amplification and sequencing using ITS primers; The *Fusarium vesicae*-specific primer set consists of primer pairs shown in SEQ ID No. 1 to SEQ ID No. 2 and primer pairs shown in SEQ ID No. 3 to SEQ ID No.

4. The amplification product of primer pairs shown in SEQ ID No. 1 to SEQ ID No. 2 has a length of 552 bp, and the amplification product of primer pairs shown in SEQ ID No. 3 to SEQ ID No. 4 has a length of 465 bp.

2. The high throughput screening method of claim 1, wherein, The PSA solid culture medium consists of: 200g of potato filtrate filtered through gauze after boiling, 20g of sucrose, 20g of agar powder, and deionized water to a final volume of 1L.

3. The high throughput screening method of claim 1, wherein, In step (1), the screening culture conditions are: culture at 28℃ for 3-5 days; in step (2), the purification culture conditions are: culture at 28℃ for 3 days.

4. The efficient screening method according to claim 1, characterized in that, In step (4), the nucleotide sequences of the ITS primers are shown in SEQ ID No. 5 and SEQ ID No.

6.

5. A set of primers specific for Fusarium venenatum, characterized in that, It consists of primer pairs shown in SEQ ID No. 1 to SEQ ID No. 2 and primer pairs shown in SEQ ID No. 3 to SEQ ID No.

4.

6. A kit containing the specific primer set as described in claim 5.

7. The application of the specific primer set of claim 5 or the kit of claim 6 in the identification of Fusarium venetum.

8. Fusarium venenatum Ts001, deposited at the China General Microbiological Culture Collection Center, accession number CGMCC No. 42556.

9. The application of Fusarium venenatum Ts001 as described in claim 8 in the production of microbial protein.

Images