Application of small heat shock protein AtHsp18.5 in improvement of drought resistance and heavy metal resistance of crops

Abstract

The invention discloses application of a small heat shock protein AtHsp18.5 to improvement of drought resistance and heavy metal resistance of crops, and belongs to the field of molecular biology and biotechnology. The small heat shock protein AtHsp18.5 is coded by a gene of which the nucleotide sequence is shown as SEQ ID NO. 1. An expression vector is constructed by virtue of a genetic engineering means, and an AtHsp18.5 transgenic arabidopsis plant is obtained by virtue of a transgenic technology. Through comparative analysis of growth phenotypes and physiological and biochemical indexes of transgenic plants and wild plants, it is proved that the tolerance of the plants to drought and heavy metal stress can be remarkably improved by transferring the AtHsp18.5 gene. The invention provides a new gene resource and technical scheme for cultivating drought-resistant and heavy metal stress-resistant crop varieties by utilizing a genetic engineering means.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a small heat shock protein. AtHsp18.5 Applications in improving crop drought resistance and heavy metal tolerance. Background Technology

[0002] Drought and heavy metal pollution are key environmental stresses limiting crop growth and development, posing a serious threat to food security. Under drought and lead stress, plants often suffer physiological damage such as abnormal protein degradation, excessive accumulation of reactive oxygen species, and cellular homeostasis imbalance, which inhibits plant growth and can even lead to death. In recent years, with increased greenhouse gas emissions and intensified global warming, the frequency and intensity of droughts have continued to rise. At the same time, soil lead pollution is becoming increasingly serious. Industrial emissions, the use of lead-containing pesticides, and wastewater irrigation have led to the continuous accumulation of lead in farmland, seriously affecting crop production and agricultural product safety. Therefore, breeding crop varieties with both drought resistance and lead tolerance has become an important and economical approach to utilizing agricultural stress resources. Genetic engineering breeding is a key means to achieve this goal, the core of which lies in discovering and utilizing genetic resources with clear drought resistance and lead tolerance functions. Summary of the Invention

[0003] To address the aforementioned shortcomings of the prior art, this invention provides a small heat shock protein. AtHsp18.5 Applications of this small heat shock protein in improving crop drought resistance and heavy metal tolerance AtHsp18.5 It can significantly improve the drought resistance and heavy metal tolerance of crops, enhance the growth status of plants in adverse environments, and reduce the impact of drought and heavy metal factors on crops.

[0004] To achieve the above objectives, the technical solution adopted by the present invention to solve its technical problem is as follows: A small heat shock protein gene AtHsp18.5 Its nucleotide sequence is shown in SEQ ID NO:1, and the specific sequence is as follows: ATGTCGATGATTCCGATCAGCAATCGCCGGAGACTATCTCCCGGCGATAGAATCTGGGAACCATTTGAACTCATGAACACCTTTCTTGATTTCCCATCACCAGCTTCTCTTTCTTTCTCACCACTTTCCCTCACTTTCTCGAGAAATATTCCCACAAACTTCATCATCCACCGTCAATACGCAGCTCAATTGGACCGAGACTCCGACGGCTCACGTTTTCAAAGCGTATCTTCCGGGAGTGGATCA AGACGAAGTGATTGCGTTCGTAGATGAAGAAGGATATCTTCAGATCTGTACTGGCGACAACAAGTTCATGAGCAGATTTAAGCTTCCTAACAACGCCTTGACGGATCAGGTCACGGCGTGGATGGAGGACGAGTTTCTTGTCGTGTTCGTTGAGAAAGATGCTTCTTCGTCGCCGCCACAGCTGCCGGAGATTGAGGAGAATCGTAACGTGAGAGTTGTGGAAATCACCGGCGATGATGATTAA.

[0005] Furthermore, the aforementioned small heat shock protein gene AtHsp18.5 Applications in crop variety improvement or germplasm resource creation.

[0006] Furthermore, the aforementioned small heat shock protein gene AtHsp18.5 Application in the development of transgenic crops with drought resistance and heavy metal tolerance.

[0007] A small heat shock protein AtHsp18.5 The above-mentioned small heat shock proteins AtHsp18.5 It is encoded by a gene whose nucleotide sequence is shown in SEQ ID NO:1.

[0008] Furthermore, the aforementioned small heat shock proteins AtHsp18.5 Applications in improving crop drought resistance and heavy metal tolerance.

[0009] An engineered bacterium containing the aforementioned genes.

[0010] A plasmid containing the aforementioned genes.

[0011] A recombinant expression vector containing the aforementioned genes.

[0012] A biological agent for improving crop drought resistance and heavy metal tolerance, containing small heat shock proteins. AtHsp18.5It may be able to promote small heat shock proteins AtHsp18.5 Active components of gene expression.

[0013] Furthermore, the small heat shock protein gene AtHsp18.5 From Arabidopsis thaliana.

[0014] The beneficial effects of this invention are as follows: This invention utilizes genetic engineering to construct and obtain transgenic Arabidopsis plants. Comparative analysis of their growth performance and biochemical indicators with wild-type plants under drought and lead stress conditions confirms that the transgenic plants possess significantly enhanced drought resistance and heavy metal tolerance. This provides new candidate genes and experimental evidence for cultivating stress-resistant crops using genetic engineering technology. Attached Figure Description

[0015] Figure 1 For recombinant plasmid pCambia2301- AtHsp18.5 plasmid map; Figure 2 for AtHsp18.5 Agarose gel electrophoresis image of PCR products for screening and identification of transgenic Arabidopsis thaliana; Figure 3 for AtHsp18.5 Statistical graph of relative expression levels in transgenic Arabidopsis thaliana; Figure 4 Wild type and AtHSP18.5 Biochemical parameters of transgenic Arabidopsis thaliana under drought and lead stress for 2 weeks are statistically analyzed; where A is SOD activity; B is POD activity; C is CAT activity; D is proline content; E is H2O2 content; F is MDA content; G is ABA content; and H is glucose content. Figure 5 Wild type and AtHSP18.5 Phenotypic analysis diagram of transgenic plants; where A represents transgenic plants under normal conditions. AtHSP18.5 Comparison of traits with wild-type Arabidopsis thaliana; B. Under normal conditions AtHSP18.5 Phenotypes of transgenic plants and wild plants; C. Transgenic plants under drought stress AtHSP18.5 Comparison of traits with wild-type Arabidopsis thaliana; D. Under drought stress AtHSP18.5 Phenotypes of transgenic plants and wild plants; E. Transgenic plants under lead stress AtHSP18.5 Comparison of traits with wild-type Arabidopsis thaliana; F, under lead stress AtHSP18.5 Phenotypes of transgenic plants and wild plants. Detailed Implementation

[0016] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are only for explaining the invention and are not intended to limit the invention; that is, the described embodiments are merely some embodiments of the invention, and not all embodiments.

[0017] Therefore, the following detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0018] It should be noted that relational terms such as "first" and "second" are used merely to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus. Unless otherwise specified, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes the element.

[0019] The features and performance of the present invention will be further described in detail below with reference to the embodiments and accompanying drawings.

[0020] Example 1: Arabidopsis thaliana Hsp18.5 (AtHsp18.5) Acquisition of genes.

[0021] Cloning AtHsp18.5 The gene sequence (SEQ ID NO.1) was amplified by PCR using the provided vector as a template and a high-fidelity polymerase.

[0022] Table 1 AtHSP18.5 Gene PCR primers Table 2 AtHSP18.5 Gene PCR reaction system Table 3 Amplification AtHSP18.5 PCR reaction conditions for genes Example 2: Construction of Recombinant Vector 1. The vector pCambia2301 was selected and linearized by KpnI single enzyme digestion. The enzyme digestion reaction system is shown in Table 4. After adding each component, the mixture was gently mixed and then briefly centrifuged. The reaction was carried out at 37℃ for 15 min.

[0023] Table 4. Linearization reaction system of the carrier 2. The PCR product and linear vector from Example 1 were subjected to a recombination reaction. After adding the sample according to the reaction system in Table 5, the mixture was gently aspirated and mixed. After a short centrifugation, the mixture was placed in a 37°C water bath for 30 min and then immediately placed on ice to cool.

[0024] Table 5 AtHSP18.5 Gene recombination reaction system 3. Thaw 100 μL of *E. coli* DH5α competent cells on ice, slowly add 10 μL of recombinant product, and incubate on ice for 30 min. Heat shock at 42℃ for 90 s in a metal bath, then incubate on ice for 2 min. Add 700 μL of LB liquid medium and culture on a shaker at 37℃ for 60 min. Centrifuge at 5000 rpm for 3 min, discard 700 μL of supernatant, and spread the remaining bacterial culture onto 50 μg / mL kanamycin-resistant LB solid medium. Incubate overnight at 37℃ inverted position.

[0025] 4. Antibiotic colonies were selected for PCR positive detection. The PCR primers are shown in Table 6, which are primers for inserting the upstream promoter fragment of the target gene and primers for amplifying the downstream target gene, respectively. The PCR reaction system and conditions are shown in Tables 7 and 8. Subsequently, the positive transformants were cultured in a shaking culture and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The plasmid map is shown below. Figure 1 .

[0026] Table 6 AtHSP18.5 PCR primers for gene-positive transformants Table 7 AtHSP18.5 PCR reaction system for gene-positive transformants Table 8 AtHSP18.5 PCR reaction conditions for gene-positive transformants Example 3: Obtaining transgenic Arabidopsis plants 1. Transform Agrobacterium GV3101 competent cells with the recombinant plasmid using the heat shock method. Thaw 100 μL of Agrobacterium GV3101 competent cells on ice, slowly add 5 μL of recombinant plasmid, and incubate on ice for 5 min; flash freeze in liquid nitrogen for 5 min, incubate in a 37℃ metal bath for 5 min, then quickly incubate on ice for 5 min; add 800 μL of YEB liquid medium, and culture in a shaker at 28℃ and 200 rpm for 4 h; centrifuge at 5000 rpm for 5 min, discard the supernatant, resuspend the precipitated bacterial cells, and evenly spread them onto YEB solid medium (containing 50 μg / mL kanamycin and 50 μg / mL rifampin), and incubate upside down in a 28℃ incubator for 2 days; pick single colonies from the plates for colony PCR verification to screen for positive clones, and store the positive recombinant Agrobacterium in 20% glycerol at -80℃.

[0027] 2. Genetic transformation in Arabidopsis thaliana Wild-type Arabidopsis seeds were placed in EP tubes, sterilized with anhydrous ethanol for 30 s, then sterilized with 10% sodium hypochlorite for 4 min, and washed three times with sterile ddH2O. The treated seeds were then placed on 1 / 2 MS solid medium and cultured in the dark at 4℃ for 3 days, followed by alternating light (16 h, 25℃) and dark (8 h, 16℃) for 2 weeks. The culture was then transferred to nutrient soil and allowed to develop inflorescences. Positive Agrobacterium tumefaciens bacteria were cultured in LB liquid medium (containing 50 μg / mL kanamycin and 50 μg / mL rifampin) at 28℃ and 180 rpm for 24 h. After centrifugation at 5000 rpm for 15 min, the supernatant was discarded, and the bacteria were resuspended in 10 mL of osmotic buffer containing 10% sucrose and 0.025% Silwet L-77. The developed pods of Arabidopsis were removed, and the inflorescences were immersed in the bacterial solution for 30 minutes. During this period, slight shaking was performed. The infected Arabidopsis thaliana was wrapped in plastic wrap to maintain humidity and cultured in the dark for 1 day. Then, it was restored to normal culture conditions. After 2-3 days, the plastic wrap was removed and cultured until the plants matured and were harvested.

[0028] 3. AtHSP18.5 Screening and identification of transgenic positive seedlings Seeds were sown in 1 / 2 MS (sucrose-free) medium containing 40 μg / mL kanamycin and cultured. After one week, healthy positive seedlings were selected and transferred to nutrient soil for further culture. Plant genomic DNA was extracted after three weeks. (Note: The last sentence appears to be incomplete and possibly refers to a different plant, possibly related to Arabidopsis thaliana.) AtHSP18.5 Since the upstream sequence of the gene does not contain a 35S promoter, primers containing the upstream sequence of the 35S promoter are used. AtHSP18.5 PCR verification was performed using downstream primers; successful amplification indicated a positive plant. Primer sequences, reaction components, and amplification conditions are as shown in Tables 6-8. Results are shown below. Figure 2 Among them, band M: Marker; 1-9: amplification products of transgenic Arabidopsis thaliana; 10: amplification products of wild-type Arabidopsis thaliana.

[0029] 4. AtHSP18.5 Identification of expression levels in transgenic positive seedlings RNA was extracted and analyzed by qRT-PCR from five-week-old plants. Total RNA was extracted using the RNApure FastPlant kit (Cwbio, Beijing, China). Subsequently, RNA was reverse transcribed into cDNA using the SweScript All-in-One RT SuperMix for subsequent quantitative PCR. Real-time quantitative PCR reactions were performed using SuperStar Blue UniversalSYBR Master Mix (Cwbio, Beijing, China) on Arabidopsis thaliana plants. 18S Genes were used as internal controls. Primer sequences used are shown in Table 9, and results are shown below. Figure 3 Due to the OE8 and OE11 strains AtHSP18.5 The expression level of this strain far exceeded that of other strains; therefore, these two strains were selected for subsequent experiments.

[0030] Table 9 AtHSP18.5 Primers for identifying plant expression levels Example 4: Detection of Arabidopsis growth and development under drought and heavy metal stress Combine wild type and AtHSP18.5 Transgenic Arabidopsis seeds were cultured in 1 / 2 MS standard medium. After one week, seedlings with similar growth were transferred to nutrient soil, four seedlings per pot. Each type was divided into three groups: no treatment, drought stress group, and lead stress group. The no-stress group was cultured normally, the drought stress group was allowed to dry naturally without watering, and the lead stress group had their pots immersed in 0.5 mM lead acetate solution for 30 min every week. The differences in growth rate between wild-type Arabidopsis and wild-type Arabidopsis were statistically analyzed after 3 weeks of age and 2 weeks of drought and lead stress. AtHsp18.5 The data on growth indicators of transgenic Arabidopsis thaliana, including fresh weight, plant height, number of leaves, leaf length, and leaf width, as well as biochemical indicators such as H2O2, MDA, POD, SOD, proline, CAT, ABA, and glucose, are as follows: (1) Determination of hydrogen peroxide (H2O2) content Take 2 g of fresh Arabidopsis leaf tissue from each group, cut it into small pieces, add 2 mL of pre-cooled acetone, and quickly grind into a homogenate under ice bath conditions. Centrifuge the homogenate at 11,000 rpm for 20 min at 4℃, and collect the supernatant for later use.

[0031] Hydrogen peroxide (H2O2) was detected using a kit (titanium sulfate colorimetric method) manufactured by Yuanye Biotechnology Co., Ltd. The detection principle is as follows: Under alkaline conditions, H2O2 in the sample reacts with titanium sulfate to form a yellow peroxide-titanium complex precipitate; after the precipitate is dissolved in a strong acid, a stable yellow solution is formed, and the absorbance is measured at a wavelength of 412 nm. The absorbance value is directly proportional to the H2O2 concentration, and the H2O2 content in the sample is calculated by comparing it with a standard curve.

[0032] (2) Determination of malondialdehyde (MDA) content Weigh 0.2 g of fresh Arabidopsis leaves from each group, add 2 mL of tissue homogenate and homogenize thoroughly. Centrifuge at 4000 g for 10 min and collect the supernatant for later use.

[0033] The plant malondialdehyde (MDA) detection kit produced by Shanghai Yuanye Biotechnology Co., Ltd. was used for determination. This kit is based on the reaction of MDA with thiobarbituric acid (TBA) under high temperature and acidic conditions to form a red product, and the MDA in the sample is quantitatively analyzed by colorimetry.

[0034] (3) Peroxidase (POD) activity assay Weigh 0.5 g of leaves from the same part of Arabidopsis thaliana in each group, cut them into small pieces, add a small amount of quartz sand, place them in a homogenizer, add 3 mL of pre-cooled pH 7.0 phosphate buffer, and homogenize on ice. After transferring the homogenate to a centrifuge tube, rinse the homogenizer with 2 mL of the same buffer, and combine the extracts (total volume 5 mL). Centrifuge at 11,000 rpm for 20 min at 4℃, and collect the supernatant for POD activity detection.

[0035] The plant peroxidase (POD) assay kit (guaiacol microplate method) from Yuanye Biotechnology Co., Ltd. was used for determination. This method uses guaiacol as a substrate and, under the optimal conditions for enzymatic reaction, the amount of product generated is detected at a wavelength of 470 nm at regular intervals, and the enzyme activity is calculated based on the change in absorbance.

[0036] (4) Superoxide dismutase (SOD) activity assay Accurately weigh 0.5 g of leaves from the same part of Arabidopsis thaliana in each group, cut them into small pieces, place them in a homogenizer, add 3 mL of pre-cooled SOD extraction solution and a small amount of quartz sand, and grind on ice until homogenized. After transferring the homogenate to a centrifuge tube, rinse the homogenizer with 2 mL of the same extraction solution, and combine the extracts (total volume 5 mL). Centrifuge at 11,000 rpm for 20 min at 4℃, and collect the supernatant for SOD activity detection.

[0037] The total superoxide dismutase (SOD) assay kit from Yuanye Biotechnology Co., Ltd. was used for the determination. The detection principle is as follows: SOD can inhibit the reduction of NBT (tetrazazole blue) to formazan (blue) under light. Formazan has strong absorption at 560 nm. The activity of SOD is indirectly reflected by measuring the change in absorbance.

[0038] (5) Determination of proline (PRO) content Weigh 0.5 g of fresh plant tissue, wash, dry, and chop it. Add 5 mL of PRO lysis buffer, homogenize or grind, and then boil in a water bath for 10 min. After mixing, filter and collect the filtrate as proline extract, and store at 4℃ for later use.

[0039] The proline (PRO) assay kit (ninhydrin colorimetric method) from Shanghai Yuanye Biotechnology Co., Ltd. was used for determination. The principle is as follows: proline reacts with ninhydrin under acidic conditions to form a red product, and the absorbance is measured at a wavelength of 520 nm. The proline content in the sample is calculated using a standard curve.

[0040] (6) Assay of catalase (CAT) activity Weigh 0.5 g of fresh plant tissue, wash, dry, and chop it. Add 5 mL of CAT assay buffer working solution and homogenize or grind. Centrifuge the homogenate at 11,000 rpm for 30 min at 4℃, collect the supernatant as crude CAT enzyme solution, and store at 4℃ for later use.

[0041] The catalase (CAT) assay kit (UV colorimetric method) from Yuanye Biotechnology Co., Ltd. was used for the determination. The detection principle is as follows: H2O2 has a characteristic absorption at 240 nm, and CAT can catalyze the decomposition of H2O2, leading to a decrease in absorbance. The CAT enzyme activity was calculated by measuring the rate of change of absorbance at 240 nm over time.

[0042] (7) Determination of abscisic acid (ABA) content Accurately weigh 0.5 g of leaves from the same part of *Arabidopsis thaliana* from each group, grind them with liquid nitrogen, and extract with pre-cooled 80% methanol for 16 h. Centrifuge at 10,000 rpm for 20 min at 4 °C and collect the supernatant. Extract the precipitate again with 80% methanol for 2 h, centrifuge, and combine the supernatants. Remove methanol from the supernatant by rotary evaporation at 42 °C, extract the aqueous phase three times with ethyl acetate, and collect the organic phase. After rotary evaporation again, dissolve the residue in 0.5 mL of methanol, filter through a 0.45 μm microporous membrane, and prepare for analysis.

[0043] The ABA content was determined using an abscisic acid (ABA) kit (ELISA method) manufactured by Enzyme-Linked Biotechnology Co., Ltd.

[0044] (8) Glucose content determination Weigh 0.2 g of fresh plant tissue, wash, dry, and chop it. Add 1 mL of distilled water and grind into a homogenate. Centrifuge the homogenate at 12000 rpm at room temperature for 10 min, collect the supernatant as glucose extract, and store at 4℃ for later use.

[0045] The glucose content was determined using the glucose oxidase-peroxidase (GOPOD) method. The principle is as follows: glucose is converted to hydrogen peroxide by glucose oxidase, which then reacts with a colorimetric reagent to produce a pink product. The absorbance was measured at 520 nm, and the glucose content in the sample was calculated using a standard curve.

[0046] like Figure 4 As shown, where *: P <0.05, **: P <0.01, ***: P <0.001, ****: P <0.0001; for overexpression AtHsp18.5 Physiological and biochemical analysis of transgenic Arabidopsis plants showed that under drought and lead stress, the activities of antioxidant enzymes (SOD, POD, CAT) in the OE8 and OE11 lines were higher than those in the wild type (WT), especially under lead stress, the SOD activities of OE8 and OE11 were approximately 2.8 times and 2.9 times that of WT, respectively. Simultaneously, the transgenic lines accumulated more osmotic regulators proline (PRO) and the stress hormone abscisic acid (ABA) under stress, while the contents of oxidative damage indicators hydrogen peroxide (H2O2) and malondialdehyde (MDA) were significantly lower than those in the wild type. These results indicate that... AtHsp18.5 Overexpression of the substance can effectively enhance the antioxidant capacity of plants, reduce membrane lipid peroxidation damage, and improve osmotic regulation and stress signal response levels, thereby significantly improving the drought resistance and lead stress tolerance of Arabidopsis thaliana.

[0047] like Figure 5 As shown, where *: P <0.05, **: P <0.01, ***: P <0.001, as can be seen, AtHSP18.5 Under drought and lead stress, the transgenic genome exhibited significantly better growth indicators than the wild type, including fresh weight, plant height, and leaf length, indicating that... AtHSP18.5 Genes can effectively enhance the drought resistance and heavy metal tolerance of Arabidopsis thaliana.

[0048] Finally, it should be noted that the above specific embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to examples, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A small heat shock protein gene AtHsp18.5 Its characteristics are, Its nucleotide sequence is shown in SEQ ID NO:

1.

2. The small heat shock protein gene according to claim 1 AtHsp18.5 Applications in crop variety improvement or germplasm resource creation.

3. The small heat shock protein gene according to claim 1 AtHsp18.5 Application in the development of transgenic crops with drought resistance and heavy metal tolerance.

4. A small heat shock protein AtHsp18.5 Its characteristics are, The small heat shock protein AtHsp18.5 It is encoded by a gene whose nucleotide sequence is shown in SEQ ID NO:

1.

5. The small heat shock protein according to claim 4 AtHsp18.5 Applications in improving crop drought resistance and heavy metal tolerance.

6. An engineered bacterium, characterized in that, It contains the gene as described in claim 1.

7. A plasmid, characterized in that, It contains the gene as described in claim 1.

8. A recombinant expression vector, characterized in that, It contains the gene as described in claim 1.

9. A biological agent for improving crop drought resistance and heavy metal tolerance, characterized in that, Contains small heat shock proteins AtHsp18.5 or may be able to promote the small heat shock protein AtHsp18.5 Active components of gene expression.

Images