Soybean genome editing system based on CRISPR-Cas12a variant and application thereof

Abstract

The invention belongs to the technical field of gene editing, and particularly relates to a soybean genome editing system based on CRISPR-Cas12a variants and application of the soybean genome editing system. The technical problem to be solved by the invention is that the editing efficiency of the existing CRISPR-Cas12a editing system needs to be improved. According to the technical scheme, the soybean genome editing expression framework is based on a CRISPR-Cas12a variant, and the structure of the soybean genome editing expression framework is BP NLS-CRISPR-Cas12a-BP NLS; the CRISPR-Cas12a is an LbCas12a variant, and the mutation sites of the CRISPR-Cas12a are D156R and E795L. The soybean gene editing system based on the expression framework can effectively improve the gene editing efficiency of different gene loci, especially low-efficiency loci.

Description

Technical Field

[0001] This invention belongs to the field of gene editing technology, specifically relating to a soybean genome editing system based on the CRISPR-Cas12a variant and its applications. Background Technology

[0002] Important agronomic traits of crops, such as yield formation, plant architecture, stress resistance, and nutrient use efficiency, are typically determined by the synergistic action of multiple functional genes and their regulatory networks, exhibiting significant complexity. For important grain and oil crops like soybean, the complex genomic background further increases the technical challenge of precise multi-site regulation. As modern molecular breeding advances towards intelligent design and system integration, traditional single-gene editing techniques are no longer sufficient to meet the practical needs of precisely creating complex traits. Constructing an integrated genome editing system with multi-site synergistic regulatory capabilities has become a key technological foundation supporting the precision improvement of crops, including soybean.

[0003] CRISPR-Cas genome editing technology is widely used in the construction of multi-gene regulatory systems due to its high programmability and flexible design. Among them, the CRISPR-Cas12a system has technical advantages such as small protein molecular weight, recognition of T-rich sequences, and the ability to generate sticky end breaks, showing great application potential in the construction of multi-target, modular gene editing systems. However, in complex genome crops such as soybean, existing Cas12a systems generally suffer from insufficient nuclear localization efficiency, significant differences in editing efficiency among different target sites, and limited cutting ability of low-activity sites, making it difficult to meet the system engineering requirements of simultaneous, highly consistent multi-site editing.

[0004] To improve the editing efficiency of the CRISPR-Cas12a system at genome target sites, a common approach in the field is to increase the expression level or activity of the Cas12a protein. Based on the fundamental molecular mechanisms of protein expression, it is known that enhancing transcription and translation can increase protein expression levels. Therefore, those skilled in the art have previously reported various methods to increase the expression level and activity of the Cas12a protein in cells. These reported methods mainly include three aspects: first, optimizing the structure of the Cas12a protein through directed evolution and structural rational analysis to screen for highly active proteins; second, using suitable strong promoters in the expression system to increase the expression level of the Cas12a gene. While these improved methods have increased the expression level and activity of the Cas12a protein to some extent and affected its gene editing efficiency, their effects on some low-activity sites are not significant, making it difficult to achieve efficient, stable, and targeted gene editing without discrimination within the genome. Summary of the Invention

[0005] The technical problem this invention aims to solve is that the editing efficiency of existing CRISPR-Cas12a editing systems needs to be improved.

[0006] The technical solution of the present invention is a soybean genome editing expression framework based on the CRISPR-Cas12a variant, the structure of which is BP NLS-CRISPR-Cas12a-BP NLS; wherein the CRISPR-Cas12a is the LbCas12a variant, and the mutation sites are D156R and E795L.

[0007] Specifically, the encoding sequence of CRISPR-Cas12a is shown as bits 1565 to 5245 of Seq ID No. 1.

[0008] Specifically, the encoding sequence of the 5' BP NLS of CRISPR-Cas12a is shown as bits 1508-1564 of Seq ID No. 1, and the encoding sequence of the 3' BP NLS of CRISPR-Cas12a is shown as bits 5246-5299 of Seq ID No. 1; or, the encoding sequence of the 3' BP NLS of CRISPR-Cas12a is shown as bits 1508-1564 of Seq ID No. 1, and the encoding sequence of the 5' BP NLS of CRISPR-Cas12a is shown as bits 5246-5299 of Seq ID No. 1.

[0009] The present invention also provides a soybean genome editing system based on a CRISPR-Cas12a variant, comprising a Cas12a nuclease expression unit; wherein the CRISPR-Cas12a is an LbCas12a variant with mutation sites D156R and E795L; and wherein the N-terminus and C-terminus of the CRISPR-Cas12a are fused with BP NLS.

[0010] Specifically, the encoding sequence of CRISPR-Cas12a is shown as bits 1565 to 5245 of Seq ID No. 1.

[0011] Specifically, the encoding sequence of the 5' BP NLS of CRISPR-Cas12a is shown as bits 1508-1564 of Seq ID No. 1, and the encoding sequence of the 3' BP NLS of CRISPR-Cas12a is shown as bits 5246-5299 of Seq ID No. 1; or, the encoding sequence of the 3' BP NLS of CRISPR-Cas12a is shown as bits 1508-1564 of Seq ID No. 1, and the encoding sequence of the 5' BP NLS of CRISPR-Cas12a is shown as bits 5246-5299 of Seq ID No. 1.

[0012] Furthermore, the structure of the Cas12a nuclease expression unit is promoter-BP NLS-CRISPR-Cas12a-BP NLS-terminator.

[0013] Specifically, the editing system also includes a crRNA transcription expression unit.

[0014] Furthermore, the structure of the crRNA transcriptional expression unit is promoter-Cas12a crRNA scaffold-terminator.

[0015] Specifically, the crRNA transcriptional expression unit also includes a hammerhead ribozyme and / or an HDV ribozyme.

[0016] The crRNA transcriptional expression unit further includes the lacZα element.

[0017] Specifically, the structure of the crRNA transcriptional expression unit is promoter-hammerhead ribozyme-Cas12a crRNAscaffold-lacZα element-HDV ribozyme-terminator.

[0018] Furthermore, the editing system also includes a reporter gene expression unit, the structure of which is promoter-coding gene-terminator.

[0019] Specifically, the promoter is the soybean M4 promoter, the soybean Ubi3 promoter, or the soybean SAMS4 promoter.

[0020] The terminator is pinII, AtHSP, NOS, poly T, or T35S.

[0021] Preferably, the editing system has a nucleotide sequence as shown in Seq ID No. 1.

[0022] The present invention also provides a vector or host cell containing the editing system described above.

[0023] The present invention also provides the application of the expression framework, the editing system, the vector or host cell in soybean genome editing.

[0024] The present invention also provides a method for gene editing of the soybean genome, comprising the following steps: designing sgRNA according to the target site, constructing the sgRNA into a vector containing the editing system, and transforming soybean.

[0025] The beneficial effects of this invention are as follows: This invention provides a soybean gene editing expression framework based on CRISPR-Cas12a variants, which fuses the NLS (double-BP NLS) with the most efficient nuclear localization NLS with the Cas12a variants (D156R, E795L) with the highest mutation efficiency. Furthermore, it provides a soybean gene editing system that can effectively improve gene editing efficiency at different gene loci, especially low-efficiency loci. This editing system can perform simple, rapid, and efficient genome-directed editing of soybean miRNAs and promoters, and has good application prospects. Attached Figure Description

[0026] Figure 1 Schematic diagrams of different variants of LbCas12a and different NLS carrier structures in this invention.

[0027] Figure 2 A schematic diagram of the editing vector structure for editing multiple miRNA sites in soybean.

[0028] Figure 3 Steps for the transformation of soybean hairy roots.

[0029] Figure 4 High-throughput sequencing results of miRNA editing in the LbCas12a system based on transient transformation of soybean hairy roots.

[0030] Figure 5 Sanger sequencing results of miRNA editing in the LbCas12a system based on transient transformation of soybean hairy roots. Detailed Implementation

[0031] CRISPR-Cas12a can generate larger deletion fragments than Cas9, offering a significant advantage in obtaining loss-of-function mutants by knocking out miRNA genes. To develop a CRISPR-Cas12a editing system with high editing efficiency in soybean, the applicant constructed expression vectors combining different Cas12a (Cas12a and its variants ttLbCas12a and ttLbCas12a Ultra) with different NLSs (BP NLS, SV40NLS, NLP, mycNLS, etc.). These expression vectors were used to construct soybean miRNA knockout vectors, and the editing efficiency was verified in soybean hairy roots. Ultimately, the combination of dual BP NLS with ttLbCas12a Ultra, i.e., BP NLS-ttLbCas12a Ultra-BP NLS, was determined to have the highest editing efficiency.

[0032] Based on the aforementioned experimental results, the various technical solutions of this invention were obtained.

[0033] The technical solution of the present invention is a soybean genome editing expression framework based on the CRISPR-Cas12a variant, the structure of which is BP NLS-CRISPR-Cas12a-BP NLS; wherein the CRISPR-Cas12a is the LbCas12a variant, and the mutation sites are D156R and E795L.

[0034] Specifically, the encoding sequence of CRISPR-Cas12a is shown as bits 1565 to 5245 of Seq ID No. 1.

[0035] Specifically, the encoding sequence of the 5' BP NLS of CRISPR-Cas12a is shown as bits 1508-1564 of Seq ID No. 1, and the encoding sequence of the 3' BP NLS of CRISPR-Cas12a is shown as bits 5246-5299 of Seq ID No. 1; or, the encoding sequence of the 3' BP NLS of CRISPR-Cas12a is shown as bits 1508-1564 of Seq ID No. 1, and the encoding sequence of the 5' BP NLS of CRISPR-Cas12a is shown as bits 5246-5299 of Seq ID No. 1.

[0036] The present invention also provides a soybean genome editing system based on a CRISPR-Cas12a variant, comprising a Cas12a nuclease expression unit; wherein the CRISPR-Cas12a is an LbCas12a variant with mutation sites D156R and E795L; and wherein the N-terminus and C-terminus of the CRISPR-Cas12a are fused with BP NLS.

[0037] Specifically, the encoding sequence of CRISPR-Cas12a is shown as bits 1565 to 5245 of Seq ID No. 1.

[0038] Specifically, the encoding sequence of the 5' BP NLS of CRISPR-Cas12a is shown as bits 1508-1564 of Seq ID No. 1, and the encoding sequence of the 3' BP NLS of CRISPR-Cas12a is shown as bits 5246-5299 of Seq ID No. 1; or, the encoding sequence of the 3' BP NLS of CRISPR-Cas12a is shown as bits 1508-1564 of Seq ID No. 1, and the encoding sequence of the 5' BP NLS of CRISPR-Cas12a is shown as bits 5246-5299 of Seq ID No. 1.

[0039] Furthermore, the structure of the Cas12a nuclease expression unit is promoter-BP NLS-CRISPR-Cas12a-BP NLS-terminator.

[0040] Specifically, the editing system also includes a crRNA transcription expression unit.

[0041] Furthermore, the structure of the crRNA transcriptional expression unit is promoter-Cas12a crRNA scaffold-terminator.

[0042] Specifically, the crRNA transcriptional expression unit also includes a hammerhead ribozyme and / or an HDV ribozyme.

[0043] The crRNA transcriptional expression unit further includes the lacZα element.

[0044] Specifically, the structure of the crRNA transcriptional expression unit is promoter-hammerhead ribozyme-Cas12a crRNAscaffold-lacZα element-HDV ribozyme-terminator.

[0045] Furthermore, the editing system also includes a reporter gene expression unit, the structure of which is promoter-coding gene-terminator.

[0046] Specifically, the promoter is the soybean M4 promoter, the soybean Ubi3 promoter, or the soybean SAMS4 promoter.

[0047] The terminator is pinII, AtHSP, NOS, poly T, or T35S.

[0048] Preferably, the editing system has a nucleotide sequence as shown in Seq ID No. 1.

[0049] The present invention also provides a vector or host cell containing the editing system described above.

[0050] The present invention also provides the application of the expression framework, the editing system, the vector or host cell in soybean genome editing.

[0051] The present invention also provides a method for gene editing of the soybean genome, comprising the following steps: designing sgRNA according to the target site, constructing the sgRNA into a vector containing the editing system, and transforming soybean.

[0052] The present invention will be further described below with reference to the embodiments. The following embodiments are intended to illustrate the present invention and not to further limit the present invention, and should not be used to limit the scope of protection of the present invention.

[0053] Example 1: Construction of editing vectors for different variants of LbCas12a

[0054] (1) Obtaining different variant sequences of LbCas12a

[0055] In 2020, Schindele et al. reported in the *Plant Biotechnology Journal* (Schindele, *Engineering CRISPR / LbCas12a for highly efficient, temperature-tolerant plantgene editing*) the ttLbCas12a variant, in which the aspartic acid at position 156 of Cas12a was mutated to arginine (D156R). This variant showed significantly higher editing efficiency in *Arabidopsis thaliana* than LbCas12a. Subsequently, in 2024, Xin et al. reported in the journal *aBIOTECH* (Xin, *Enhanced editing efficiency in Arabidopsis with a LbCas12a variant harboring D156R and E795L mutations) a variant, ttLbCas12a Ultra, which showed further improved editing efficiency in *Arabidopsis thaliana* compared to ttLbCas12a. In addition to the D156R mutation, this variant also showed a mutation at position 795, where glutamic acid was replaced with lysine (E795L).

[0056] (2) Construction of different variant editing systems for LbCas12a

[0057] To obtain the SV40NLS-LbCas12a-NLP gene sequence, the Cas12a gene fragment from the pGEL032 vector (Tang, X., Ren, Q., Yang, L., Bao, Y., Zhong, Z., He, Y., Liu, S., Qi, C., Liu, B., Wang, Y., et al. (2019). Single transcript unit CRISPR 2.0 systems for robust Cas9 and Cas12a mediated plant genome editing. Plant Biotechnol J 17:1431-1445.10.1111 / pbi.13068.) was used as a template, and two pairs of primers were used for independent PCR amplification. The first pair of primers were TX697-F (Seq ID No. 16, 5'-gaggaagcggaagagcgccGGTCTCgAATGGCTCCTAAG AAGAAGCGGA-3') and TX511-B (Seq ID No. 17, 5'-GGTGTCCCGTGGCTCTTA-3'); the second pair of primers were TX511-C (Seq ID No. 18, 5'- GCGATAAGAGCCACGGGACA-3') and TX768-R (Seq ID No. 19, 5'- GACCCTAAGGCTTTTCATCAGGTCTCGAAGCTCACTTCTTTTTCTTAGCCTGTCCGGCC-3'). Two independent KOD-Plus-Neo PCR amplification reaction systems were established using these two primer sets. Each reaction system consisted of the following (50 μL): 10×KOD-Plus-Neo buffer, 5 μL; dNTPs (2 mM), 5 μL. μL; MgSO4 (25mM), 3 μL; forward primer, 1 μL; reverse primer, 1 μL; KOD-Plus-Neo high-fidelity enzyme, 1 μL; pGEL032 plasmid DNA, 1 μL; ddH2O, 33 μL. The KOD-Plus-Neo PCR reaction program was as follows: 94℃, 2 min; (94℃, 30 s; 56℃, 30 s; 68℃, 30 s / Kb) × 35 cycles; 68℃, 5 min; 12℃, 5 min. The PCR product was purified by 1% agarose gel electrophoresis to obtain two component fragments of SV40NLS-LbCas12a-NLP.

[0058] To obtain the SV40NLS-ttLbCas12a-NLP gene sequence, the Cas12a gene fragment of the pGEL032 vector was used as a template, and two pairs of primers were used for independent PCR amplification. The first pair of primers were TX697-F (5'-gaggaagcggaagagcgccGGTCTCgAATGGCTCCTAAG AAGAAGCGGA-3') and TX775-B (Seq ID No. 20, 5'-CATATTTTCCCGATTCCTAAAG AAGCCTGTGAATGCTGTTGTGA-3'); the second pair of primers were TX775-C (Seq ID No. 21, 5'- CACAGGCTTCTTTAGGAATCGGGAAAATATGTTCTCTGA-3') and TX768-R (5'- GACCCTAAGGCTTTTCATCAGGTCTCGAAGCTCACTTCTTTTTCTTAGCCTGTCCGGCC-3'). Two independent KOD-Plus-Neo PCR amplification reaction systems were established using these two primer sets. Each reaction system consisted of the following (50 μL): 10×KOD-Plus-Neo buffer, 5... μL; dNTPs (2mM), 5 μL; MgSO4 (25mM), 3 μL; upstream primer, 1 μL; downstream primer, 1 μL; KOD-Plus-Neo high-fidelity enzyme, 1 μL; pGEL032 plasmid DNA, 1 μL; ddH2O, 33 μL. The KOD-Plus-Neo PCR reaction program was as follows: 94℃, 2 min; (94℃, 30 s; 56℃, 30 s; 68℃, 30 s / Kb) × 35 cycles; 68℃, 5 min; 12℃, 5 min. The PCR product was purified by 1% agarose gel electrophoresis to obtain two component fragments of SV40NLS-ttLbCas12a-NLP.

[0059] To obtain the SV40NLS-ttLbCas12a Ultra-NLP gene sequence, the ttLbCas12a Ultra gene fragment of the pBG-ttLbUV2 vector (Xin,C., Qiao, D., Wang, J., Sun, W., Cao, Z., Lu, Y., Jiang, Y., Chai, Y., Wang,XC, and Chen, QJ (2024). Enhanced editing efficiency in Arabidopsis with a LbCas12a variant harboring D156R and E795L mutations. aBIOTECH 5:117-126.10.1007 / s42994-024-00144-w.) was used as a template, and two pairs of primers were used for independent PCR amplification. The first pair of primers were TX1440-D (Seq ID No. 22, 5'-gaggaagcggaagagcgccGGTCTCgAATGGC TCCTAAGAAGAAGCGGAA GGTTGGT ATTCACG GGGTGCCTGCGGCTTCAAAGCTCGAGAAGTTCA-3') and TX719-B (Seq ID No. 23, 5'-CTTCTGGATGTCCTCGCTTGGGTT-3'); the second pair of primers were TX1440-B (Seq ID No. 24, 5'-CTACTACAACCCAAGCGAGGACATCCAGAA-3') and TX1440-E (Seq ID No. 25, 5'- (GACCCTAAGGCTTTTCATCAGGTCTCGAAGCTCACTTCTTTTTCTTAGCCTGTCCGGCCTTTTTGGTGGCAGCAGGACGCTTGTGCTTCACAGATGTCTGA-3') Two sets of primers were used to establish two independent KOD-Plus-Neo PCR amplification reaction systems. The composition of each reaction system was as follows (50 μL system): 10×KOD-Plus-Neo buffer, 5 μL; dNTPs (2mM), 5 μL; MgSO4 (25mM), 3 μL; upstream primer, 1 μL; downstream primer, 1 μL; KOD-Plus-Neo high-fidelity Taq enzyme, 1 μL; pBG-ttLbUV2 plasmid DNA, 1 μL; ddH2O, 33 μL.The KOD-Plus-Neo PCR reaction program was as follows: 94℃, 2 min; (94℃, 30 s; 56℃, 30 s; 68℃, 30 s / Kb) × 35 cycles; 68℃, 5 min; 12℃, 5 min. The PCR products were purified by 1% agarose gel electrophoresis to obtain two component fragments of SV40NLS-ttLbCas12aUltra-NLP.

[0060] The system's skeletal carrier is constructed in three steps:

[0061] Step 1: Using the pUSP-empty vector as the basic backbone, which contains the ccdB lethal gene and BsaI restriction sites, the pUSP-empty vector was digested with BsaI restriction endonuclease. The digestion system was as follows: 10×Fastdigest Green Buffer, 3 μL; BsaI, 1 μL; pUSP-empty plasmid DNA (2 μg), 1 μL; ddH2O, 25 μL; 37℃, 1h~2h. The digested fragments were approximately 2011 bp and 637 bp in size. The approximately 2011 bp fragment was recovered using the AxyPrep DNA gel extraction kit. This fragment contains the replication origin site, selection markers, and two BsaI recognition sites required for subsequent cloning.

[0062] The pUSP-empty digestion product was combined with two component fragments of SV40NLS-LbCas12a-NLP, SV40NLS-ttLbCas12a-NLP, and SV40NLS-ttLbCas12a Ultra-NLP recovered after PCR amplification, respectively, using the Gibson assembly method. The reaction system was as follows: Gibson Assemble Mix, 15 μL; pUSP-empty digestion fragment, 2 μL (50 ng); two component fragments of SV40NLS-LbCas12a-NLP, two component fragments of SV40NLS-ttLbCas12a-NLP, or two component fragments of SV40NLS-ttLbCas12a Ultra-NLP, 3 μL (molar amount 10 times that of the vector); 50℃, 1 h. After the reaction was completed, 6 μL of Gibson assembly product was used to transform Escherichia coli strain Dh5a competent cells, which were then plated on LB agar plates containing Amp (100 mg / L) antibiotic and incubated at 37°C for 18–22 h.

[0063] Single colonies from the plate were picked and diluted in 50 μL of sterile deionized water. 5 μL of the bacterial solution was used as a template. oCS433 (Seq ID No. 26, 5'-gctcacatgttctttcctgcg-3') and TX706 (Seq ID No. 27, 5'-CAATGGA CGTGTATTTCGTCTTCA-3') were used as upstream and downstream primers for colony PCR. Positive clones were selected for plasmid extraction, restriction enzyme digestion, and sequencing verification, thereby constructing the SV40NLS-LbCas12a-NLP-step01, SV40NLS-ttLbCas12a-NLP-step01, and SV40NLS-ttLbCas12a Ultra-NLP-step01 gene fragments.

[0064] Step 2: Using the pTSWA vector as the basic backbone, which contains the ccdB lethal gene and the BsaI and AarI restriction sites required for Golden Gate cloning, pTSWA was cloned with the GmM4 promoter, SV40NLS-LbCas12a-NLP-step1 / SV40NLS-ttLbCas12a-NLP-step01 / SV40NLS-ttLbCas12a Ultra-NLP-step01, and AtHSP terminator for Golden Gate cloning. The Golden Gate reaction system is as follows: 10×T4 ligase buffer, 2 μL; BsaⅠ, 1 μL; T4 DNA ligase, 1 μL; pTSWA, 1 μL; GmM4 promoter, 1 μL; SV40NLS-LbCas12a-NLP-step1 / SV40NLS-ttLbCas12a-NLP-step01 / SV40NLS-ttLbCas12a Ultra-NLP-step01, 1 μL; AtHSP terminator, 1 μL; ddH2O, 12 μL. The reaction program is as follows: (37℃, 5 min; 16℃, 10 min) × 40 cycles; 37℃, 10 min; 80℃, 10 min, to obtain the ligation product of gene fragment and backbone vector.

[0065] The constructed recombinant vector was transformed into E. coli DH5α competent cells. Single clones were selected and colony PCR was performed using TX627 (Seq ID No. 28, 5'-ATCTTTTACTATGTATGCGACCA-3') and TX706 (5'-CAATGGACGTGTAT TTCGTCTTCA-3') as upstream and downstream primers. Positive clones were selected for plasmid extraction. After enzyme digestion verification, the plasmids were sent to Qingke Biotechnology Co., Ltd. for Sanger sequencing verification, yielding soybean SV40NLS-LbCas12a-NLP-step02 / SV40NLS-ttLbCas12a-NLP-step02 / SV40NLS-ttLbCas12a Ultra-NLP-step02.

[0066] Step 3: Using pTRANS_230d (Cermak, T., Curtin, SJ, Gil-Humanes, J., Cegan, R., Kono, TJY, Konecna, E., Belanto, JJ, Starker, CG, Mathre, JW, Greenstein, RL, and Voytas, DF (2017). A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants. Plant Cell 29:1196-1217. 10.1105 / tpc.16.00922.) as the basic framework, and SV40NLS-LbCas12a-NLP-step02 / SV40NLS-ttLbCas12a-NLP-step02 / SV40NLS-ttLbCas12a) as the vector, Ultra-NLP-step02, pTX2326 (a crRNA expression unit vector driven by the GmUbi3 promoter), pMOD_C'0000a (which provides a DNA linker sequence that allows these expression units to be linked together), and pTX2304 (a DsRed expression unit vector driven by the GmSAMS4 promoter) were used for Golden Gate cloning. The Golden Gate reaction system was as follows: pTRANS_230d, 1 μL; SV40NLS-LbCas12a-NLP-step02 / SV40NLS-ttLbCas12a-NLP-step02 / SV40NLS-ttLbCas12a; Ultra-NLP-step02, 1 μL; pTX2326, 1 μL; pMOD_C'0000a, 1 μL; pTX2304, 1 μL; AarI, 0.6 μL; 50×AarI Oligo, 0.4 μL; T4 DNA ligase, 1 μL; buffer, 2 μL; ddH2O to a final volume of 20 μL. The Golden Gate cloning reaction program was: (37℃, 5 min; 16℃, 10 min) × 40 cycles; 37℃, 10 min; 80℃, 10 min, to obtain the ligation product of the gene fragment and the backbone vector.The information for pMOD_C'0000a comes from the literature "Cermak, T., Curtin, SJ, Gil-Humanes, J., Cegan, R., Kono, TJY, Konecna, E., Belanto, JJ, Starker, CG, Mathre, JW, Greenstein, RL, and Voytas, DF (2017). A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants. Plant Cell 29:1196-1217. 10.1105 / tpc.16.00922.)".

[0067] The constructed recombinant vector was transformed into *E. coli* DH5α competent cells. Single clones were selected and PCR was performed using TX678 (Seq ID No. 29, 5'-TTAAATGAATGTAAGATCACA-3') and TX1139 (Seq ID No. 30, 5'-TTGGTGCCTATGACACGGGTA-3') as upstream and downstream primers. The positive amplification product was approximately 838 bp in length. After enzyme digestion verification, the plasmid was sent to Qingke Biotechnology Co., Ltd. for Sanger sequencing verification, yielding soybean SV40NLS-LbCas12a-NLP, SV40NLS-ttLbCas12a-NLP, and SV40NLS-ttLbCas12a Ultra-NLP backbone vectors (vector structures are shown in [link to documentation]). Figure 1 The SV40 NLS-LbCas12a-NLP coding gene sequence in the aforementioned vectors is shown in Seq ID No. 2, the SV40NLS-ttLbCas12a-NLP coding gene sequence is shown in Seq ID No. 3, and the SV40NLS-ttLbCas12a Ultra-NLP coding gene sequence is shown in Seq ID No. 4. Replacing the BP-ttLbCas12a Ultra-BP coding region (positions 1508-5302) in Seq ID No. 1 with the sequences described in Seq ID No. 2, Seq ID No. 3, or Seq ID No. 4 yields the core expression element regions of the aforementioned three backbone vectors; these core expression element regions contain nuclease expression units, crRNA expression units, and DsRed expression units.

[0068] Seq ID No. 2: nucleotide sequence of the SV40 NLS-LbCas12a-NLP coding gene; where positions 7-27 are the 5' end SV40 NLS coding sequence, positions 52-3732 are the LbCas12a coding sequence, and positions 3733-3780 are the 3' end NLP coding sequence;

[0069]

[0070] Seq ID No. 3: nucleotide sequence of the SV40 NLS-ttLbCas12a-NLP coding gene; wherein, positions 7-27 are the 5' end SV40 NLS coding sequence, positions 52-3732 are the ttLbCas12a coding sequence, and positions 3733-3780 are the 3' end NLP coding sequence;

[0071]

[0072] Seq ID No. 4: nucleotide sequence of the SV40 NLS-ttLbCas12a Ultra-NLP coding gene; wherein, positions 7 to 27 are the 5' end SV40 NLS coding sequence, positions 52 to 3732 are the ttLbCas12a Ultra coding sequence, and positions 3733 to 3780 are the 3' end NLP coding sequence;

[0073]

[0074] Example 2: Construction of an editing system integrating ttLbCas12a Ultra with different NLS

[0075] (1) Construction of soybean BP NLS-ttLbCas12a Ultra-BP NLS,c-myc NLS framework vector

[0076] To obtain the BP NLS-ttLbCas12a Ultra-BP NLS,c-myc NLS gene fragment, the ttLbCas12a Ultra gene fragment of the pBG-ttLbUV2 vector (publicly published, Xin, C., Qiao, D., Wang, J., Sun, W., Cao, Z., Lu, Y., Jiang, Y., Chai, Y., Wang, XC, and Chen, QJ (2024). Enhanced editing efficiency in Arabidopsis with a LbCas12a variant harboring D156R and E795L mutations. aBIOTECH 5:117-126. 10.1007 / s42994-024-00144-w.) was used as a template, and primer TX1440-A (Seq ID) was employed. A KOD-Plus-Neo PCR amplification reaction system was established using No. 31, 5'-gaggaagcggaagagcgccGGTCTCgAATGAAGCGTACCGCTGATGGCA-3' and TX1440-C (Seq ID No. 32, 5'-ccctaaggcttttcatcaGGTCTCgAAGCTCAGTCGAGCTTGACTCTCTTAGCA-3'). The reaction system composition (50 μL system) was as follows: 10×KOD-Plus-Neo buffer, 5 μL; dNTPs (2mM), 5 μL; MgSO4 (25mM), 3 μL; upstream primer, 1 μL; downstream primer, 1 μL; KOD-Plus-Neo high-fidelity Taq enzyme, 1 μL; pBG-ttLbUV2 plasmid DNA, 1 μL; ddH2O, 33 μL. The KOD-Plus-Neo PCR reaction program was as follows: 94℃, 2 min; (94℃, 30 s; 56℃, 30 s; 68℃, 30 s / Kb) × 35 cycles; 68℃, 5 min; 12℃, 5 min. The PCR products were purified by 1% agarose gel electrophoresis.

[0077] The system's skeletal carrier is constructed in two steps:

[0078] Step 1: Using the pTSWA vector as the basic backbone, Golden Gate cloning was performed with the GmM4 promoter, the BP NLS-ttLbCas12a Ultra-BP NLS,c-myc NLS gene fragment, and the AtHSP terminator. The Golden Gate reaction system was as follows: 10×T4 ligase buffer, 2 μL; BsaⅠ, 1 μL; T4 DNA ligase, 1 μL; pTSWA, 1 μL; GmM4 promoter, 1 μL; BP NLS-ttLbCas12a Ultra-BP NLS,c-myc NLS gene fragment, 1 μL; AtHSP terminator, 1 μL; ddH2O, 12 μL. The reaction was carried out at (37℃, 10 min → 16℃, 5 min)×40 → 37℃, 15 min → 65℃, 10 min to obtain the ligation product of the gene fragment and the backbone vector.

[0079] The constructed recombinant vector was transformed into E. coli DH5α competent cells. Single clones were selected and colony PCR was performed using TX627 (5'-ATCTTTTACTATGTATGCGACCA-3') and TX706 (5'-CAATGGACGTGTATTTCGTCTTCA-3') as upstream and downstream primers. Positive clones were selected for plasmid extraction. After enzyme digestion verification, the plasmid was sent to Qingke Biotechnology Co., Ltd. for Sanger sequencing verification, and soybean BP NLS-ttLbCas12a Ultra-BP NLS,c-mycNLS-step01 was obtained.

[0080] Step 2: Using the pTRANS_230d vector as the basic backbone, Golden Gate cloning was performed with BP NLS-ttLbCas12a Ultra-BP NLS,c-myc NLS-step01, pTX2326, pMOD_C'0000a, and pTX2304. The Golden Gate reaction system was as follows: pTRANS_230d, 1 μL; BP NLS-ttLbCas12a Ultra-BP NLS,c-myc NLS-step01, 1 μL; pTX2326, 1 μL; pMOD_C'0000a, 1 μL; pTX2304, 1 μL; AarI, 0.6 μL; 50× AarI Oligo, 0.4 μL; T4 DNA ligase, 1 μL; buffer, 2 μL; ddH2O to a final volume of 20 μL. The Golden Gate cloning reaction program was as follows: (37℃, 5 min; 16℃, 10 min) × 40 cycles; 37℃, 10 min; 80℃, 10 min. This yielded the product of ligation of the gene fragment with the backbone vector.

[0081] The constructed recombinant vector was transformed into *E. coli* DH5α competent cells. Single clones were selected and PCR was performed using TX678 (5'-TTAAATGAATGTAAGATCACA-3') and TX1139 (5'-TTGGTGCCTATGACACGGGTA-3') as upstream and downstream primers. The positive amplification product was approximately 838 bp in length. After enzyme digestion verification, the plasmid was sent to Qingke Biotechnology Co., Ltd. for Sanger sequencing verification, yielding the soybean BP NLS-ttLbCas12a Ultra-BP NLS,c-myc NLS backbone vector pGEL777 (vector structure shown in [link to vector structure]). Figure 1 The gene encoding the vector P NLS-ttLbCas12a Ultra-BP NLS,c-myc NLS is shown in Seq ID No. 5. Replacing the BP-ttLbCas12a Ultra-BP coding region (positions 1508-5302) in Seq ID No. 1 with the sequence described in Seq ID No. 5 yields the core expression element region of the aforementioned backbone vector; this core expression element region contains a nuclease expression unit, a crRNA expression unit, and a DsRed expression unit.

[0082] Seq ID No. 5: nucleotide sequence of the BP NLS-ttLbCas12a Ultra-BP NLS,c-myc NLS coding gene; wherein, positions 4-57 are the 5' end BP NLS coding sequence, positions 58-3738 are the ttLbCas12a Ultra coding sequence, positions 3751-3804 are the 3' end BP NLS coding sequence, and positions 3814-3840 are the 3' end c-myc NLS coding sequence;

[0083]

[0084] (2) Construction of soybean BP NLS-ttLbCas12a Ultra-BP NLS framework carrier

[0085] To obtain the BP NLS-ttLbCas12a Ultra-BP NLS gene fragment, the ttLbCas12a Ultra gene fragment of the pBG-ttLbUV2 vector (Xin, C., Qiao, D., Wang, J., Sun, W., Cao, Z., Lu, Y., Jiang, Y., Chai, Y., Wang, XC, and Chen, QJ (2024). Enhanced editing efficiency in Arabidopsis with a LbCas12a variant harboring D156R and E795L mutations. aBIOTECH 5:117-126. 10.1007 / s42994-024-00144-w.) was used as a template, and two pairs of primers were used for independent PCR amplification. The first pair of primers were TX1440-A (5'-gaggaagcggaagagcgccGGTCTCgAATGAAGCGTACCGCTGATGGCA-3') and TX719-B (5'-CTTCTGGATGTCCTCGCTTGGGTT-3'); the second pair of primers were TX1440-B (5'-CTACTACAACC CAAGCGAGGACATCCAGAA-3') and TX1440-F (5'-ccctaaggcttttcatcaGGTCTCgAA GCTCAGACTTTTCTTTTCTTCTTCTTTGGTTCAAATTCTGAGCCGTCGGCGGTGCGCTTGTGCTTCACAGATGTCTGA-3'). Two independent KOD-Plus-Neo PCR amplification reaction systems were established using these two primer sets. Each reaction system consisted of the following (50 μL): 10×KOD-Plus-Neo buffer, 5... 5 μL of dNTPs (2 mM); 3 μL of MgSO4 (25 mM); 1 μL of forward primer; 1 μL of reverse primer; 1 μL of KOD-Plus-Neo high-fidelity Taq enzyme; 1 μL of pBG-ttLbUV2 plasmid DNA; and 33 μL of ddH2O. The KOD-Plus-Neo PCR reaction program was as follows: 94℃, 2 min; (94℃, 30 s; 56℃, 30 s; 68℃, 30 s / Kb) × 35 cycles; 68℃, 5 min; and 12℃, 5 min. The PCR products were purified by 1% agarose gel electrophoresis, yielding two constituent fragments of BP NLS-ttLbCas12a Ultra-BP NLS.

[0086] The system's skeletal carrier is constructed in three steps:

[0087] Step 1: Using the pUSP-empty vector as the basic backbone, which contains the ccdB lethal gene, the pUSP-empty vector was digested with BsaI restriction endonuclease. The digestion system was as follows: 10×Fastdigest Green Buffer, 3 μL; BsaI, 1 μL; pUSP-empty plasmid DNA (2 μg), 1 μL; ddH2O, 25 °C; 37 °C, 1–2 h. The digested fragments were approximately 2011 bp and 637 bp in size. The approximately 2011 bp fragment was recovered using the AxyPrep DNA gel extraction kit.

[0088] The pUSP-empty digested product was assembled with two constituent fragments of the aforementioned BP NLS-ttLbCas12a Ultra-BP NLS using the Gibson assembly method. The reaction system was as follows: Gibson Assemble Mix, 15 μL; pUSP-empty digested fragment, 2 μL (50 ng); two constituent fragments of BP NLS-ttLbCas12a Ultra-BP NLS, 3 μL (molar amount 10 times that of the vector); 50℃, 1 h. After the reaction, 6 μL of the Gibson assembly product was transformed into Escherichia coli strain Dh5a competent cells, plated on LB agar plates containing Amp (100 mg / L) antibiotic, and incubated at 37℃ for 18–22 h.

[0089] Single colonies from the plate were picked and diluted in 50 μL of sterile deionized water. 5 μL of the bacterial solution was used as a template. oCS433 (5'-gctcacatgttctttcctgcg-3') and TX706 (5'-CAATGGACGTGTATTTCGTCTTCA-3') were used as upstream and downstream primers for colony PCR. Positive clones were selected for plasmid extraction, enzyme digestion, and sequencing verification, thus constructing CRISPR-BP NLS-ttLbCas12a Ultra-BP NLS-step01.

[0090] Step 2: Using the pTSWA vector as the basic backbone, Golden Gate cloning was performed with the GmM4 promoter, BP NLS-ttLbCas12a Ultra-BPNLS-step01 and AtHSP terminator. The ligation system was as follows: (37℃, 10 min → 16℃, 5 min) × 40 → 37℃, 15 min → 65℃, 10 min, to obtain the ligation product of gene fragment and backbone vector.

[0091] The constructed recombinant vector was transformed into Escherichia coli DH5α competent cells. Single clones were picked and colony PCR was performed using TX627 (5'-ATCTTTTACTATGTATGCGACCA-3') and TX706 (5'-CAATGGACGTGTATTTCGTCTTCA-3') as upstream and downstream primers. Positive clones were selected for plasmid extraction. After enzyme digestion verification, the plasmid was sent to Qingke Biotechnology Co., Ltd. for Sanger sequencing verification, and soybean BP NLS-ttLbCas12a Ultra-BP NLS-step02 was obtained.

[0092] Step 3: Using the pTRANS_230d vector as the basic backbone, Golden Gate cloning was performed with BP NLS-ttLbCas12a Ultra-BP NLS-step02, pTX2326, pMOD_C'0000a, and pTX2304. The ligation system was as follows: (37℃, 5 min; 16℃, 10 min) × 40 cycles; 37℃, 10 min; 80℃, 10 min, to obtain the ligation products of gene fragments and backbone vectors.

[0093] The constructed recombinant vector was transformed into *E. coli* DH5α competent cells. Single clones were selected and PCR was performed using TX678 (5'-TTAAATGAATGTAAGATCACA-3') and TX1139 (5'-TTGGTGCCTATGACACGGGTA-3') as upstream and downstream primers. The positive amplification product was approximately 838 bp in length. After enzyme digestion verification, the plasmid was sent to Qingke Biotechnology Co., Ltd. for Sanger sequencing verification, yielding the soybean BP NLS-ttLbCas12a Ultra-BP NLS backbone vector. The core expression unit sequence of this vector is shown in Seq ID No. 1.

[0094] Seq ID No. 1: nucleotide sequence of BP NLS-ttLbCas12a Ultra-BP NLS expression unit; wherein positions 1-1498 are the soybean M4 promoter, positions 1508-1564 are the 5' BP NLS coding sequence, positions 1565-5245 are the ttLbCas12a Ultra coding sequence, positions 5246-5299 are the 3' BP NLS coding sequence, positions 5314-5563 are the HSP terminator, positions 5590-7005 are the soybean Ubi3 promoter, positions 7017-7059 are the hammerhead ribozyme, and positions 7060-7080 are the LbCas12a crRNA. The scaffold contains lacZα and its associated elements at positions 7088-7605, HDV ribozyme at positions 7647-7714, pinII terminator at positions 7723-8031, soybean SAMS4 promoter at positions 8574-9876, dsRed gene at positions 9887-10564, and pinII terminator at positions 10575-10883.

[0095]

[0096] Example 3: CRISPR-Cas12a target soybean miRNA assay

[0097] To investigate the editing efficiency of vectors constructed with different nuclear localization signals and different Cas12a coding sequences in Examples 1 and 2, soybean gene loci shown in Table 1 were selected for editing experiments.

[0098] Table 1 Primers and applications for constructing soybean miRNA target site targeted mutation vectors

[0099] .

[0100] The following gene editing sites were designed for soybean miRNA genes Gma-miR160i, Gma-miR166k, Gma-miR169n, Gma-miRN1312, and Gma-miRN4427: miR160i-crRNA01 (TTTA-TTTGGCATGAGGGGAGTCATGCA, with a PAM site before the short line), miR166k-crRNA02 (TTTC-ATCACTTCATGCATGGGATGAGA, with a PAM site before the short line), miR169n-crRNA03 (TTTA-CTTCTGTGCCGGCAAGTTTCTCT, with a PAM site before the short line), miRN1312-crRNA04 (TTTG-TGGATCCGTGTTTATGAGAAATA, with a PAM site before the short line), and miRN4427-crRNA05 (TTTA-CCATCACTTCCTTCAACACTGGA, with a PAM site before the short line). The construction of a Cas12a editing vector targeting soybean miRNA involves the following three steps.

[0101] Step 1: Using the artificially synthesized HDV-HH-DR gene fragment (sequence GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACCATGAAATTACTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCTAATTTCTACTAAGTGTAGAT) as a template, with GmMIR-A1, GmMIR-A2, and GmMIR-B as upstream and downstream primer pairs AB; GmMIR-C and GmMIR-D as upstream and downstream primer pairs CD; GmMIR-E and GmMIR-F as upstream and downstream primer pairs EF; GmMIR-G, GmMIR-H1, and GmMIR-H2 as upstream and downstream primer pairs GH; and GmMIR-I, the following KOD-Plus-NeoPCR reaction system was established: 10×KOD-Plus-Neo Buffer, 5 μL; dNTPs (2 mM), 5 μL; MgSO4 (25 mM), 3 μL; primers, 1 μL each; KOD-Plus-Neo high-fidelity Taq enzyme, 1 μL; HDV-HH-DR gene fragment, 1 μL; ddH2O, 33 μL. The KOD-Plus-Neo PCR reaction program was as follows: 94℃, 2 min; (94℃, 30 s; 56℃, 30 s; 68℃, 30 s / Kb) × 35 cycles; 68℃, 5 min; 12℃, 5 min. The PCR products were recovered by 1% agarose gel electrophoresis to obtain fragments AB, CD, EF, and GH.

[0102] Step 2: Using pGEL765 as the backbone, this vector contains the ccdB lethal gene with a Bsp1407I restriction site and the Amp selection marker gene. pGEL765 was cloned and ligated with the previously obtained combination one (fragment AB, fragment CD) and combination two (fragment EF and fragment GH) using the Golden Gate method. Two Golden Gate reactions were performed simultaneously. The reaction system was as follows: 1: 10×T4 ligase buffer, 2 μL; BbsI, 1 μL; Bsp1407I, 1 μL; T4 DNA ligase, 1 μL; backbone vector (100 ng), 1 μL; fragment AB, 1 μL; fragment CD, 1 μL; ddH2O, 12 μL. Reaction system 2: 10×T4 ligase buffer, 2 μL; BbsI, 1 μL; Bsp1407I, 1 μL; T4 DNA ligase, 1 μL; backbone vector (100 ng), 1 μL; fragment EF, 1 μL; fragment GH, 1 μL; ddH2O, 12 μL. The reaction program was as follows: (37℃, 5 min; 16℃, 10 min) × 40 cycles; 37℃, 10 min; 80℃, 10 min. After the program, 6 μL of the Golden Gate reaction product was added to E. coli DH5α competent cells for transformation, and plated on LB agar plates containing Amp (100 mg / L) for 18–22 h. Single colonies from the plate were picked and diluted in 50 μL of sterile deionized water. 5 μL of this bacterial solution was used as a template, and M13F (Seq ID No. 33, 5'-GTAAAACGACGGCCAGT-3') and M13R (Seq ID No. 34, 5'-CAGGAAACAGCTATGAC-3') were used as upstream and downstream primers for positive colony PCR identification. The positive amplification products were approximately 750 bp and 745 bp in length, respectively. Further enzyme digestion and sequencing were performed to verify the sequence of the obtained vectors, thus constructing intermediate vectors 1 and 2 for the Cas12a editing vector targeting soybean miRNA.

[0103] Step 3: Based on the aforementioned ( Figure 1The SV40NLS-LbCas12a-NLP vector, SV40NLS-ttLbCas12a-NLP vector, SV40NLS-ttLbCas12a Ultra-NLP vector, BP NLS-ttLbCas12a Ultra-BP NLS, c-myc NLS vector, and BP NLS-ttLbCas12a Ultra-BP NLS obtained in step 2 were used as the backbone for Golden Gate cloning and ligation with intermediate vector 1 and intermediate vector 2 obtained in step 2. The reaction system is as follows: Reaction system 1: 10×T4 ligase buffer, 2 μL; BsaⅠ, 1 μL; T4 DNA ligase, 1 μL; backbone vector (100 ng), 1 μL; intermediate vector 1, 1 μL; intermediate vector 2, 1 μL; ddH2O, 13 μL. The reaction program was as follows: (37℃, 5 min; 16℃, 10 min) × 40 cycles; 37℃, 10 min; 80℃, 10 min. After the program, 6 μL of the Golden Gate reaction product was added to E. coli DH5α competent cells for transformation, and the cells were plated on LB agar plates containing Kan (50 mg / L) and cultured for 18–22 h. Single colonies on the plates were picked and diluted in 50 μL of sterile deionized water. 5 μL of this bacterial culture was used as a template, and TX1140 (Seq ID No. 35, 5'-TTTTTCACGAGATTGCTTCAGA-3') and miRN4427-R (Seq ID No. 36, 5'-TCCAGTGTTGAAGGAAGTGATGG-3') were used as upstream and downstream primers for positive colony PCR identification. The positive amplification product was approximately 818 bp in length. Further enzyme digestion and sequencing were used to verify the sequence of the obtained vectors, thereby constructing the SV40NLS-LbCas12a-NLP editing vector, SV40NLS-ttLbCas12a-NLP editing vector, SV40NLS-ttLbCas12a Ultra-NLP editing vector, BP NLS-ttLbCas12a Ultra-BP NLS, c-myc NLS editing vector, and BP NLS-ttLbCas12a Ultra-BP NLS editing vector. Figure 2 ).

[0104] Example 4: Verification of the editing efficiency of different CRISPR-Cas12a vectors in soybean hairy roots

[0105] (1) Explant preparation

[0106] Soak soybeans in water for a few minutes, then place them in the soil with the hilum facing down and cover with a thin layer of soil to cultivate until the hypoembryonic embryo elongates (about 7 days, when the cotyledons have just unfolded).

[0107] (2) Preparation of Agrobacterium

[0108] Five μL of the correctly sequenced SV40NLS-LbCas12a-NLP editing vector, SV40NLS-ttLbCas12a-NLP editing vector, SV40NLS-ttLbCas12a Ultra-NLP editing vector, BP NLS-ttLbCas12a Ultra-BP NLS, c-mycNLS editing vector, and BP NLS-ttLbCas12a Ultra-BP NLS editing vector plasmid were transformed into Agrobacterium strain K599 and cultured at 28°C for two days. Positive identification of the colony was performed using TX1140 (5'-TTTTCACGAGATTGCTTCAGA-3') and miRN4427-R (5'-TCCAGTGTTGAAGGAAGTGATGG-3') as upstream and downstream primers. The positive amplification product was approximately 818 bp in length. Using a sterile white pipette tip, pick a single positive colony from the YEB plate and inoculate it into a test tube containing 5 mL of YEB + 50 mg / L Kan + 50 mg / L Strep liquid medium. Incubate at 28°C and 200 rpm until OD600 = 0.5. Then, transfer approximately 400 μL of the bacterial culture to YEB (50 mg / L Kan + 50 mg / L Strep) solid medium and incubate at 28°C for 1-2 days to allow the bacterial film to grow.

[0109] (3) Agrobacterium infection

[0110] The mycelium on the agar plate was scraped into a mycelial mass using a blade or pipette tip. Soybean seedlings were cut at a 45° angle about 1 cm below the hypocotyl (approximately 1 cm below the hypocotyl). The cut was then dipped into the mycelial mass to collect K599 bacteria infused with different plasmids. The soybeans dipped in K599 bacteria were then inserted into moist vermiculite and cultured at 26 ℃ under a 12 / 12h light cycle.

[0111] (4) Sampling and editing efficiency test

[0112] After the plant has developed hairy roots (estimated to be about 3 weeks), clean the hairy roots, test for positive roots, and remove negative roots (see the hairy root transformation steps). Figure 2 ).

[0113] Example 5: Editing efficiency analysis of different CRISPR-Cas12a vectors

[0114] Editing efficiencies at Gma-miR166k, Gma-miRN4427, Gma-miR160i, and Gma-miRN1312 sites were evaluated using high-throughput sequencing, while the editing efficiency at the Gma-miR169n site was evaluated using Sanger sequencing. Analysis showed that the editing efficiencies of a total of five sites (Gma-miR166k, Gma-miRN4427, Gma-miR160i, Gma-miRN1312, and Gma-miR169n) were as follows: Figure 3 and Figure 4 As shown, when both the N-terminal and C-terminal NLS are SV40NLS and NLP, SV40NLS-ttLbCas12a Ultra-NLP outperforms SV40NLS-LbCas12a-NLP and SV40NLS-ttLbCas12a-NLP. These results indicate that ttLbCas12a Ultra significantly enhances the editing activity of LbCas12a in soybean through mutations at the D156R and E795L sites and codon optimization.

[0115] Further changes in editing efficiency occurred when the NLS of ttLbCas12a Ultra was replaced with BP NLS (N-terminus), BP NLS, c-myc NLS (C-terminus), and double BP NLS. BP NLS-ttLbCas12a Ultra-BP NLS, c-myc NLS did not improve editing efficiency, while BP NLS-ttLbCas12a Ultra-BP NLS significantly improved editing efficiency, and BP NLS-ttLbCas12a Ultra-BP NLS showed higher editing efficiency at all sites than other LbCas12a editing systems. These results indicate that different NLS combinations with Cas12a significantly affect its editing efficiency. Specifically, the combination of double BP NLS with ttLbCas12aUltra significantly increased the mutation frequency.

Claims

1. A soybean genome editing expression framework based on a CRISPR-Cas12a variant, characterized by: Its structure is BPNLS-CRISPR-Cas12a-BP NLS; the CRISPR-Cas12a is an LbCas12a variant with mutation sites D156R and E795L; Preferably, the encoding sequence of CRISPR-Cas12a is shown as bits 1565 to 5245 of Seq ID No.1; Preferably, the encoding sequence of the 5' BP NLS of CRISPR-Cas12a is shown as bits 1508-1564 of Seq ID No. 1, and the encoding sequence of the 3' BP NLS of CRISPR-Cas12a is shown as bits 5246-5299 of Seq ID No. 1; or, the encoding sequence of the 3' BP NLS of CRISPR-Cas12a is shown as bits 1508-1564 of Seq ID No. 1, and the encoding sequence of the 5' BP NLS of CRISPR-Cas12a is shown as bits 5246-5299 of Seq ID No.

1.

2. A soybean genome editing system based on a CRISPR-Cas12a variant, characterized in that: It includes a Cas12a nuclease expression unit; the CRISPR-Cas12a is an LbCas12a variant with mutation sites D156R and E795L; the N-terminus and C-terminus of the CRISPR-Cas12a are also fused with BP NLS; Preferably, the encoding sequence of CRISPR-Cas12a is shown as bits 1565 to 5245 of Seq ID No.1; Preferably, the encoding sequence of the 5' BP NLS of CRISPR-Cas12a is shown as bits 1508-1564 of Seq ID No. 1, and the encoding sequence of the 3' BP NLS of CRISPR-Cas12a is shown as bits 5246-5299 of Seq ID No. 1; or, the encoding sequence of the 3' BP NLS of CRISPR-Cas12a is shown as bits 1508-1564 of Seq ID No. 1, and the encoding sequence of the 5' BP NLS of CRISPR-Cas12a is shown as bits 5246-5299 of Seq ID No.

1.

3. The editing system according to claim 2, characterized in that: The editing system further includes a crRNA transcription expression unit; or, the editing system further includes a reporter gene expression unit with a structure of promoter-coding gene-terminator.

4. The editing system according to claim 3, characterized in that: One of the following: The structure of the Cas12a nuclease expression unit is promoter-BP NLS-CRISPR-Cas12a-BP NLS-terminator; The structure of the crRNA transcriptional expression unit is promoter-Cas12a crRNA scaffold-terminator; The crRNA transcriptional expression unit further includes a hammerhead ribozyme and / or an HDV ribozyme; or, the crRNA transcriptional expression unit further includes a lacZα element.

5. The editing system according to claim 4, characterized in that: The structure of the crRNA transcriptional expression unit is promoter-hammerhead ribozyme-Cas12a crRNA scaffold-lacZα element-HDV ribozyme-terminator.

6. The editing system according to claim 5, characterized in that: The promoter is the soybean M4 promoter, soybean Ubi3 promoter, or soybean SAMS4 promoter; or the terminator is pinII, AtHSP, NOS, poly T, or T35S.

7. The editing system according to claim 6, characterized in that: The editing system has a nucleotide sequence as shown in Seq ID No.

1.

8. A carrier or host cell containing the editing system according to any one of claims 2 to 7.

9. The application of the expression framework of claim 1, the editing system of any one of claims 2 to 7, and the vector or host cell of claim 8 in soybean genome editing.

10. A method for gene editing of the soybean genome, characterized in that: The process includes the following steps: designing sgRNA based on the target site, constructing the sgRNA into a vector containing the editing system, and transforming soybeans.

Images