Visual material for rice arbuscular mycorrhiza as well as preparation method and application of visual material

By expressing mycorrhizal fungi-specific induced red betaine biosynthesis pathway enzymes in rice plants, a visual material of rice arbuscular mycorrhizae was constructed, solving the destructive problem of existing detection methods and realizing non-destructive in-situ dynamic observation and efficient screening, providing an important tool for mycorrhizal symbiosis research.

CN121874244APending Publication Date: 2026-04-17SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI
Filing Date
2026-01-13
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

Existing methods for detecting rice arbuscular mycorrhizal fungi rely on destructive chemical staining, which cannot be used for non-destructive, in-situ, and real-time observation, making it difficult to track key events in the early stages of symbiosis establishment and dynamic changes in infection structures.

Method used

By using a promoter specifically induced by rice mycorrhizal fungi to drive key enzymes in the biosynthesis pathway of red betaine, and expressing them in rice plants through transgenic technology, the formation of red betaine is visualized, thus constructing a visualization material of rice arbuscular mycorrhizae.

Benefits of technology

It enables non-destructive, in-situ dynamic observation of mycorrhizal infection processes, simplifies the detection process, improves observation efficiency, and supports the screening of mycorrhizal symbiosis-related mutants and the assessment of the impact of environmental factors on symbiosis efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121874244A_ABST
    Figure CN121874244A_ABST
Patent Text Reader

Abstract

The invention provides a rice arbuscular mycorrhiza visual material and a preparation method and application thereof, and belongs to the technical field of agricultural bioengineering. According to the visual material for the arbuscular mycorrhiza of the rice, the colonization condition of mycorrhizal fungi can be directly and rapidly judged through naked eyes under the conditions that root systems are not damaged and chemical dyeing is not needed, the detection process is greatly simplified, and the observation efficiency is improved. The material supports in-situ and continuous dynamic monitoring of the whole mycorrhizal infection process, and an unprecedented convenient tool is provided for in-depth study on the dynamic law of symbiosis establishment and development. Meanwhile, the material can be used for rapidly screening mycorrhizal symbiosis related mutants and visually evaluating the influence of environmental factors on symbiosis efficiency, and important material basis and technical support are provided for rice mycorrhizal symbiosis research, genetic improvement and agricultural application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of agricultural bioengineering technology, and in particular to a visual material for rice arbuscular mycorrhizal fungi, its preparation method, and its application. Background Technology

[0002] Arbuscular mycorrhizae are one of the most common plant-microbe mutualistic symbiotic relationships in nature, formed by arbuscular mycorrhizal fungi in the soil infecting plant roots. This symbiotic relationship plays a crucial role in plant nutrient absorption (especially phosphorus), drought resistance, disease resistance, and the health of the soil ecosystem. In important food crops such as rice, studying the establishment efficiency, developmental dynamics, and responses to environmental factors of arbuscular mycorrhizae is of great significance for tapping their yield-increasing potential and promoting the development of green agriculture.

[0003] Effective observation and quantitative analysis of arbuscular mycorrhizae are fundamental to the aforementioned research. Currently, conventional mycorrhizal detection techniques primarily rely on chemical staining of root samples, such as using trypan blue, ink-acetic acid solutions, or fluorescent dyes to label fungal structures, followed by observation and statistical analysis of infection rates under optical or fluorescence microscopes. While these methods are relatively mature, they are essentially endpoint detection methods, requiring root segment cutting and in vitro treatment—a cumbersome and destructive process. This makes it impossible to continuously and in situ track the process of the root system of the same plant, hindering the capture of key events in the early stages of symbiosis establishment and the dynamic changes in infection structures. Furthermore, the staining process can introduce human error and is unsuitable for high-throughput live screening.

[0004] Therefore, developing a technology that enables non-destructive, in-situ, real-time visualization of arbuscular mycorrhizae, especially suitable for materials in model crops or important crops such as rice, has become an urgent need and an important direction for technological development in this research field. Summary of the Invention

[0005] The purpose of this invention is to provide a visualization material for rice arbuscular mycorrhizae, its preparation method and application, which solves the technical problem that existing methods for detecting rice arbuscular mycorrhizae rely on destructive staining and cannot perform non-destructive in-situ dynamic observation.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a rice arbuscular mycorrhizal visualization vector construct comprising a rice mycorrhizal fungus-specifically induced promoter, a nucleotide sequence encoding a CYP76AD cytochrome P450 enzyme, a nucleotide sequence encoding a DODA enzyme, and a nucleotide sequence encoding a cDOPA5GT enzyme.

[0007] Preferably, the promoter specifically induced by rice mycorrhizal fungi is the OsPT11 gene promoter.

[0008] Preferably, the OsPT11 gene promoter sequence is shown in SEQ ID NO.1; The nucleotide sequence encoding the CYP76AD cytochrome P450 enzyme is shown in SEQ ID NO.2; The nucleotide sequence encoding the DODA enzyme is shown in SEQ ID NO.3; The nucleotide sequence encoding the cDOPA5GT enzyme is shown in SEQ ID NO.4.

[0009] The present invention also provides a rice arbuscular mycorrhizal visualization material, the material comprising an exogenously introduced expression cassette containing a rice mycorrhizal fungus-specifically induced promoter, a nucleotide sequence encoding a CYP76AD cytochrome P450 enzyme, a nucleotide sequence encoding a DODA enzyme, and a nucleotide sequence encoding a cDOPA5GT enzyme.

[0010] Preferably, the promoter specifically induced by rice mycorrhizal fungi is the OsPT11 gene promoter.

[0011] Preferably, the OsPT11 gene promoter sequence is shown in SEQ ID NO.1; The nucleotide sequence encoding the CYP76AD cytochrome P450 enzyme is shown in SEQ ID NO.2; The nucleotide sequence encoding the DODA enzyme is shown in SEQ ID NO.3; The nucleotide sequence encoding the cDOPA5GT enzyme is shown in SEQ ID NO.4.

[0012] Preferably, the expression cassette further includes a reporter gene for screening transgenic plants.

[0013] This invention also provides a method for preparing the above-mentioned rice arbuscular mycorrhizal visualization material, comprising the following steps: A recombinant expression vector containing the expression cassette was constructed, the recombinant expression vector was transformed into Agrobacterium tumefaciens, and the Agrobacterium tumefaciens was used to infect rice callus tissue. After screening and regeneration culture, transgenic rice plants were obtained. The recombinant expression vector is a pCAMBIA 1300 series vector.

[0014] This invention also provides a non-destructive, in-situ, dynamic observation method for the process of rice arbuscular mycorrhizal infection, comprising the following steps: Provide the above-mentioned rice arbuscular mycorrhizal visualization materials as the observation object for cultivation; The plants under observation were planted in transparent containers and inoculated with arbuscular mycorrhizal fungi. The mycorrhizal infection process was dynamically observed based on the changes in the red color of the roots.

[0015] This invention also provides the application of the above-mentioned rice arbuscular mycorrhizal visualization carrier construction, rice arbuscular mycorrhizal visualization material, or non-destructive in-situ dynamic observation method for the rice arbuscular mycorrhizal infection process in recording the mycorrhizal infection process, screening mycorrhizal symbiosis-related mutants, or verifying the effect of phosphorus on mycorrhizal symbiosis.

[0016] The beneficial effects of this invention are: The rice arbuscular mycorrhizal visualization material provided by this invention enables direct and rapid visual assessment of mycorrhizal fungal colonization without damaging the root system or requiring chemical staining, greatly simplifying the detection process and improving observation efficiency. This material supports in-situ, continuous, and dynamic monitoring of the entire mycorrhizal infection process, providing an unprecedentedly convenient tool for in-depth research into the dynamic laws governing the establishment and development of symbiosis. Simultaneously, this material can be used for rapid screening of mycorrhizal symbiosis-related mutants and for intuitively assessing the impact of environmental factors (such as phosphorus levels) on symbiosis efficiency, providing an important material foundation and technical support for rice mycorrhizal symbiosis research, genetic improvement, and agricultural applications. Attached Figure Description

[0017] Figure 1 This document presents a schematic diagram of the construction of a rice mycorrhizal visualization carrier and the results of its material effectiveness evaluation. A: The biosynthesis process of red betaine and the key rate-limiting enzymes required. B: Schematic diagram of the construction of the rice mycorrhizal visualization carrier. C: Verification of the effectiveness of the rice visualization material. Figure 2 This image shows longitudinal sections of rice mycorrhizal visualization materials inoculated with or inoculated with inactivated mycorrhizal fungi, where: NM: inoculated with inactivated arbuscular mycorrhizal fungi; AM: inoculated with arbuscular mycorrhizal fungi. Figure 3 To visualize the efficiency of mycorrhizal symbiosis in rice, the following methods were used: A: Infection rates were statistically analyzed for red and uncolored root segments, showing that red root segments indicated almost 100% infection efficiency, while uncolored root segments had an infection rate of approximately 20%. B: The proportions of red root segment length to total root length and red root segment weight to total root weight. C: The calculation method for mycorrhizal symbiosis efficiency: the proportion of red root segment length to total root length multiplied by the infection rate. Figure 4 To visualize the mycorrhizal symbiosis process in rice using visual materials, where: dpi: day postinoculation; Figure 5To validate the phosphorus sensitivity of rice mycorrhizal visualization materials, the following data were used: A: Root scan results of rice mycorrhizal visualization materials treated with low (LP: 30 μM), medium (MP: 200 μM), and high (HP: 400 μM) phosphorus concentrations after 6 weeks of inoculation with AM fungi. BC: Percentage of red root segments and root infection rate under different phosphorus concentrations. NM: Inoculation with inactivated arbuscular mycorrhizal fungi. AM: Inoculation with arbuscular mycorrhizal fungi. Detailed Implementation

[0018] This invention provides a rice arbuscular mycorrhizal visualization vector construct. The vector construct is a recombinant DNA molecule used to introduce and express exogenous genes into plant cells. In this invention, the vector construct comprises at least the following functional elements: a rice mycorrhizal fungus-specifically induced promoter; and multiple polynucleotide sequences operably linked to the promoter, encoding key enzymes in the red betaine biosynthesis pathway. Specifically, these polynucleotide sequences include nucleotide sequences encoding CYP76AD cytochrome P450 enzymes, nucleotide sequences encoding DODA enzymes, and nucleotide sequences encoding cDOPA5GT enzymes. The term "operably linked" is a conventional technical term in the art, referring to the connection between the promoter and the coding sequence in a manner that allows the coding sequence to be expressed under the transcriptional regulation of the promoter. Further, in the expression cassette, the nucleotide sequence encoding the cDOPA5GT enzyme is fused to a reporter gene (such as the GUS gene) and is jointly driven by the OsPT11 gene promoter or another constitutive promoter.

[0019] Furthermore, the promoter specifically induced by the rice mycorrhizal fungi is the OsPT11 gene promoter. The OsPT11 gene is a known phosphorus transporter gene in rice, and its promoter region can be specifically activated in response to infection by arbuscular mycorrhizal fungi, thereby driving the expression of downstream genes in mycorrhizal symbiotic sites (such as arbuscular structures). Utilizing this tissue-specific / inducible promoter allows for the precise expression of reporter genes or target genes at the symbiotic interface, a common strategy in plant molecular biology and agricultural bioengineering.

[0020] In a more specific and preferred embodiment, the OsPT11 gene promoter sequence has the nucleotide sequence shown in SEQ ID NO. 1; the nucleotide sequence encoding the CYP76AD cytochrome P450 enzyme has the nucleotide sequence shown in SEQ ID NO. 2; the nucleotide sequence encoding the DODA enzyme has the nucleotide sequence shown in SEQ ID NO. 3; and the nucleotide sequence encoding the cDOPA5GT enzyme has the nucleotide sequence shown in SEQ ID NO. 4. Those skilled in the art will understand that, due to the degeneracy of the genetic code, different nucleotide sequences encoding the same amino acid sequence should also be included within the scope of this invention. Furthermore, sequence variants that have high homology (e.g., greater than 90%, greater than 95%, greater than 98%, or greater than 99%) with the sequences shown in SEQ ID NO. 1-4 and retain the corresponding function, such as sequences generated through site-directed mutagenesis, homologous recombination, or natural variation, are also applicable to this invention.

[0021] This invention further provides a visualization material for rice arbuscular mycorrhizal fungi. The material is a transgenic rice plant or a portion thereof (e.g., roots, leaves, seeds, etc.) containing the aforementioned exogenously introduced expression cassette. The core feature of this material is that when a rice plant successfully establishes a symbiotic relationship with arbuscular mycorrhizal fungi, the arbuscular structures formed within the root cortex cells at the fungal infection sites accumulate red betaine due to the expression of the red betaine synthase gene driven by the OsPT11 promoter, resulting in a visible red phenotype and thus visualizing the mycorrhizal symbiosis.

[0022] As previously mentioned, the promoter specifically induced by rice mycorrhizal fungi is preferably the OsPT11 gene promoter. Its sequence can be as shown in SEQ ID NO.1. The nucleotide sequences encoding the key enzyme can be as shown in SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively. These sequences together constitute the complete metabolic pathway for the biosynthesis of red betaine.

[0023] In a preferred embodiment, the expression cassette further comprises a reporter gene for screening transgenic plants. Reporter genes are common tools in the art for the rapid identification and screening of transformants. For example, the reporter gene may be a β-glucuronidase (GUS) gene, a green fluorescent protein (GFP) gene, a luciferase (LUC) gene, or a selection marker gene providing antibiotic / herbicide resistance (such as the hygromycin phosphotransferase gene hptII). The reporter gene is preferably expressed by a constitutively strong promoter to facilitate rapid identification of positive plants during the transformation and screening stages.

[0024] This invention also provides a method for preparing the aforementioned rice arbuscular mycorrhizal visualization material. The method includes the following conventional plant genetic transformation steps: First, a recombinant expression vector containing the expression cassette is constructed. The plant expression vector is a plasmid or viral vector carrying genetic elements capable of functioning in plant cells. Then, the recombinant expression vector is transferred into *Agrobacterium tumefaciens* using conventional methods such as chemical methods or electroporation to obtain an engineered strain. Next, the engineered *Agrobacterium* is used to infect rice callus. Rice callus can be obtained by inducing mature or immature embryos on a medium containing hormones (such as 2,4-D), which is a commonly used explant for rice genetic transformation. After co-culture, the callus is transferred to a medium containing an appropriate selector (such as hygromycin) for screening to kill non-transformed cells and retain transformed cells. Finally, the resistant callus is sequentially transferred to differentiation medium and rooting medium for plant regeneration, thereby obtaining complete transgenic rice plants. In a specific embodiment of this invention, the recombinant expression vector is constructed based on the pCAMBIA 1300 series vector backbone. pCAMBIA series vectors are binary vectors widely used in plant transformation, containing T-DNA boundary sequences, E. coli and Agrobacterium replication origins, and various selection markers.

[0025] Furthermore, this invention provides a non-destructive, in-situ, dynamic observation method for the arbuscular mycorrhizal infection process in rice. This method utilizes the visualization material of this invention to achieve live, continuous observation of the symbiotic process. Specific steps include: cultivating rice arbuscular mycorrhizal visualization material as the observation target plant; planting the observation target plant in a container with a transparent bottom or sides (such as a specially designed transparent plastic box, glass container, or petri dish); the transparent container allows direct observation of root growth from the outside; then, inoculating the plant roots with spores or inoculum of arbuscular mycorrhizal fungi. During the symbiotic culture, images of the root system within the container are periodically acquired (e.g., weekly, every 3 days, or more frequently as needed for the experiment) using a scanner, digital camera, or microscopic imaging system. By analyzing the appearance, expansion, intensity changes, and even disappearance of the red-colored areas in the root system in images at different time points, the complete process of initial infection, arbuscular development, maturation, and even degradation of the mycorrhizal fungi can be dynamically observed. This method requires no destruction of the root system or complex chemical staining treatments.

[0026] Finally, the present invention also claims protection for the use of the rice arbuscular mycorrhizal visualization carrier structure, the rice arbuscular mycorrhizal visualization material, or the non-destructive in-situ dynamic observation method in the following applications: 1) Used to record, monitor or study the infection and development dynamics of rice arbuscular mycorrhizal fungi; 2) Used for screening, identifying or creating rice mutant materials with mycorrhizal symbiotic phenotypic variations (such as enhanced symbiosis, defective symbiosis); 3) Used to verify, evaluate, or screen the effects of different environmental factors (especially phosphorus levels in soil or nutrient solution) on the efficiency of rice-arbuscular mycorrhizal symbiosis. For example, in applications verifying the effects of phosphorus, the visualization material can be cultured and inoculated with fungi under different phosphorus concentrations (e.g., low phosphorus: 1-50 μM, preferably 10-30 μM, more preferably 30 μM; medium phosphorus: 50-300 μM, preferably 150-250 μM, more preferably 200 μM; high phosphorus: 300-600 μM, preferably 300-500 μM, more preferably 400 μM). The promoting or inhibiting effects of different phosphorus levels on the establishment of symbiosis can be assessed intuitively and rapidly by comparing the degree or range of red color development.

[0027] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0028] Key sequences in the embodiments: OsPT11 promoter sequence (as shown in SEQ ID NO.1): CYP76AD nucleotide sequence (as shown in SEQ ID NO.2): DODA nucleotide sequence (as shown in SEQ ID NO.3): ATGAAGATGATGAACGGCGAGGACGCCAACGACCAGATGATCAAAGAGTCCTTCTTCATCACCCACGGCAACCCGATCCTCACCGTCGAGGATACACATCCGCTCAGGCCGTTCTTCGAGACATGGCGCGAGAAGATTTTCTCCAAGAAGCCGAAGGCCATCCTCATCATCTCCGGCCACTGGGAGACAGTGAAGCCAACCGTGAACGCCGTGCACATCAACGACACCATCCACGACTTCGACGACTACCCAGCCGCCATGTACCAGTTCAAGTACCCAGCTCCAGGCGAGCCAGAGCTTGCGAGAAAGGTGGAAGAGATCCTCAAGAAGTCCGGGTTCGAGACAGCCGAGACAGACCAAAAGAGGGGCCTTGATCACGGCGCCTGGGTTCCACTCATGCTCATGTATCCAGAGGCGGACATCCCGGTGTGCCAGCTCTCAGTTCAGCCACATCTCGACGGCACCTACCACTACAATCTCGGCAGAGCCCTCGCGCCGCTCAAGAATGATGGCGTGCTCATTATTGGCTCCGGCAGCGCCACACATCCACTCGATGAGACACCGCACTACTTCGATGGTGTTGCCCCTTGGGCCGCTGCCTTCGATTCTTGGCTTAGGAAGGCCCTCATCAACGGCCGCTTCGAGGAAGTGAACATCTACGAGAGCAAGGCCCCGAACTGGAAGCTCGCCCATCCATTTCCAGAGCACTTCTACCCGCTCCACGTTGTGCTCGGCGCTGCTGGTGAAAAGTGGAAGGCCGAGCTGATCCACTCCTCCTGGGATCATGGCACACTTTGCCACGGCTCCTACAAGTTCACCTCCGCCTGA cDOPA5GT nucleotide sequence (as shown in SEQ ID NO.4):

[0029] Example Phosphate transporter gene specifically induced by rice mycorrhizal fungi OsPT11 The promoters drive three rate-limiting enzymes encoding the red betaine biosynthesis pathway: CYP76AD cytochrome P450 enzyme, DODA enzyme, and cDOPA5GT enzyme, respectively, and are ligated into the pCAMBIA 1300 expression vector via homologous recombination technology. Figure 1 (A, B) To facilitate the identification of transgenic materials in the later stages, a reporter gene for driving GUS, 35S, was fused after the cDOPA5GT sequence via homologous recombination (see vector construction flowchart). Figure 1 B). The constructed recombinant expression vector was transformed into Agrobacterium tumefaciens strain EHA105 via electroporation. The transformed Agrobacterium was then used to infect callus tissue of Nipponbare rice. Transgenic rice seedlings were obtained through co-culture (3 days), screening (20 days in 80 mg / L hygromycin selection medium), differentiation, and rooting. In this invention, a small amount of transgenic rice roots were placed in a 200 μl PCR tube, and a small amount of GUS staining solution was added. The staining was observed at 37°C for half an hour; seedlings that stained blue were considered positive. Approximately 10 transgenic positive lines were successfully obtained and named sequentially from Agrobacterium Red-1 to Agrobacterium Red-10.

[0030] In this invention, two strains, Junhong-1 and Junhong-3, were randomly selected for visual colorimetric verification. Before the experiment, sand was sterilized by autoclaving at 121 degrees Celsius and then placed in approximately 2-liter pots. Four rice seedlings that had germinated and grown for two weeks were planted in each pot, and approximately 200 spores were inoculated around the roots of each seedling. R. irregularis Inoculant or inactivated inoculant (as a control). Planted in an artificial climate chamber with 16 hours of light (28°C) and 8 hours of darkness (22°C), and treated weekly with rice IRRI nutrient solution (phosphorus concentration reduced to 30 μM) for six weeks, the roots were placed on 23cm*23cm plastic plates and scanned using a root scanner. Results showed that no red coloration was observed in the control roots, but some root segments in the mycorrhizal fungi-inoculated roots showed red coloration. Figure 1 C) indicates that betaine can be successfully synthesized in the root.

[0031] Identification and Indication Efficiency of Rice Mycorrhizal Visualization Materials The control root segments stained red as described above and the root segments that showed red after inoculation were embedded in 5% agarose, longitudinally sectioned using a vibrating microtome, and photographed under a regular optical microscope. The results showed that the cells in the uninoculated root segments were completely white, while the red root segments inoculated with mycorrhizae showed individual red cells, i.e., arbuscular cells and vesicle structures. The cells in the adjacent, non-arbuscular segments did not show red color. Figure 2This indicates that the material can be used to indicate mycorrhizal symbiosis. To further evaluate the efficiency of this material in indicating mycorrhizal symbiosis, the roots were placed on a 23cm*23cm plastic plate and scanned using a root scanner. The length of red root segments and the total root length were counted using ImageJ software. The root segments were then cut into approximately 1cm pieces, and boiled in a 95°C water bath with a 10% sodium hydroxide solution for 1 hour. After discarding the sodium hydroxide, 2% hydrochloric acid was added for neutralization at room temperature for 5 minutes, followed by staining with 0.05% tribenzyl blue at 95°C for 30 minutes. The total infection rate and arbuscular abundance were counted using the cross-point method. The invention provides the following calculation method to evaluate the indicator efficiency: the indicator efficiency of the total infection rate = the proportion of red root segment length to the total root length multiplied by the total infection rate; the indicator efficiency of arbuscular abundance = the proportion of red root segment length to the total root length multiplied by the arbuscular abundance (8 biological replicates). Calculations show that the mycorrhizal visualization material of this invention can indicate a total infection rate of approximately 61.7-64.8% (Mycorrhizal Red-1 = 64.81% ± 5.68%, Mycorrhizal Red-3 = 64.7% ± 9.79%) and an arbuscular abundance of 67.8-71.7% (Mycorrhizal Red-1 = 71.7% ± 5.09%, Mycorrhizal Red-3 = 68.8% ± 8.9%). Figure 3 ).

[0032] Rice mycorrhizal visualization materials allow for in-situ dynamic observation of the mycorrhizal symbiosis process. In situ dynamic observation of mycorrhizae was conducted using the aforementioned Junhong-1 strain. Before the experiment, sand was sterilized by autoclaving at 121 degrees Celsius and then placed in 10cm*10cm transparent plastic boxes. Four germinated rice seedlings of Junhong-1, which had grown for two weeks, were planted in each box, and approximately 200 spores were inoculated around the roots of each seedling. R. irregularis Inoculant. The plants were grown in an artificial climate chamber with 16 hours of light (28°C) and 8 hours of darkness (22°C), and were watered weekly with rice IRRI nutrient solution (phosphorus concentration reduced to 30 μM). Starting from approximately the second week, the plastic boxes were placed directly on a root scanner weekly (the top was covered with a homemade black dark box to prevent external light from affecting exposure), and the root system at the bottom was scanned and photographed. Results showed that the number of red root segments increased progressively with the extension of infection time. The red color of the initially formed red root segments gradually disappeared as the clumps degraded. Figure 4 This indicates that the formation of red betaine is closely related to the life cycle of the arbuscular herb.

[0033] Verification of phosphorus sensitivity using rice mycorrhizal visualization materials To further investigate the sensitivity of the invented material to different phosphorus concentrations, this invention conducted AM inoculation experiments using the aforementioned Junhong-1 strain at low (30 μM), medium (200 μM), and high (400 μM) phosphorus concentrations. Before the experiments, sand was autoclaved at 121 degrees Celsius and then placed in 10cm x 10cm transparent plastic boxes. Four germinated Junhong-1 rice seedlings, two weeks old, were planted in each box, with approximately 200 spores inoculated around the roots of each seedling. R. irregularis Inoculant. Rice was grown in an artificial climate chamber with 16 hours of light (28°C) and 8 hours of darkness (22°C), and irrigated weekly with rice IRRI nutrient solutions containing low (30 μM), medium (200 μM), and high (400 μM) phosphorus concentrations. Previous studies have shown that the formation of mycorrhizal symbiosis requires low phosphorus stimulation, while high phosphorus concentrations significantly inhibit its formation. The mycorrhizal visualization material of this invention also exhibits the same results. Under low phosphorus (30 μM) conditions, the proportion of red root segments reached as high as 37.5%, while under medium phosphorus conditions, the proportion of red root segments decreased to 20.5%, and under high phosphorus conditions, the proportion of red root segments was only 0.8%. Figure 5 Then, the root segments were cut into small pieces about 1 cm in length, and boiled in a 95°C water bath with a 10% sodium hydroxide solution for 1 hour. After discarding the sodium hydroxide, 2% hydrochloric acid was added to neutralize at room temperature for 5 minutes, followed by staining with 0.05% tribenzyl blue at 95°C for 30 minutes. The total infection rate and arbuscular abundance were calculated using the cross-point method. The corresponding mycorrhizal infection rate results were also negatively correlated with phosphorus concentration. Figure 5 ).

[0034] The above results confirm that the rice mycorrhizal visualization material provided by this invention can be used to indicate approximately 70% of the rice mycorrhizal symbiotic efficiency. More importantly, it allows for in-situ observation of the entire dynamic infection process of mycorrhizal symbiosis without damaging the root system. Furthermore, it can be used to screen mutant materials that still exhibit high symbiotic efficiency under high phosphorus conditions, providing genetic material for mycorrhizal symbiotic function in high-phosphorus soils.

[0035] As shown in the above embodiments, this invention provides a method for preparing a visualized transgenic material of rice arbuscular mycorrhizal fungi and its application. The obtained material can specifically synthesize red betaine at the site where rice roots are successfully infected by arbuscular mycorrhizal fungi, producing a visible red marker. This marker is closely related to the formation of the fungal infection structure (arbuscular), and its color development process can dynamically reflect the progress of infection and structural changes. Using this material, not only can the overall efficiency of mycorrhizal symbiosis be conveniently and non-destructively assessed, but also in-situ, continuous, and dynamic observation of the infection process can be achieved. Further experiments confirmed that the colorimetric phenotype of this material is sensitive to changes in soil phosphorus concentration, providing a direct basis for rapidly screening genetic materials with different phosphorus response characteristics or assessing the impact of environmental phosphorus levels on symbiosis.

[0036] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A visualization carrier structure for rice arbuscular mycorrhizae, characterized in that, It contains a rice mycorrhizal fungus-specific induced promoter, a nucleotide sequence encoding the CYP76AD cytochrome P450 enzyme, a nucleotide sequence encoding the DODA enzyme, and a nucleotide sequence encoding the cDOPA5GT enzyme.

2. The rice arbuscular mycorrhizal visualization carrier construct according to claim 1, characterized in that, The promoter specifically induced by rice mycorrhizal fungi is the OsPT11 gene promoter.

3. The rice arbuscular mycorrhizal visualization carrier construct according to claim 2, characterized in that, The OsPT11 gene promoter sequence is shown in SEQ ID NO.1; The nucleotide sequence encoding the CYP76AD cytochrome P450 enzyme is shown in SEQ ID NO.2; The nucleotide sequence encoding the DODA enzyme is shown in SEQ ID NO.3; The nucleotide sequence encoding the cDOPA5GT enzyme is shown in SEQ ID NO.

4.

4. A visual material for rice arbuscular mycorrhizal infections, characterized in that, The material comprises an exogenously introduced expression cassette containing a rice mycorrhizal fungus-specifically induced promoter, a nucleotide sequence encoding a CYP76AD cytochrome P450 enzyme, a nucleotide sequence encoding a DODA enzyme, and a nucleotide sequence encoding a cDOPA5GT enzyme.

5. The rice arbuscular mycorrhizal visualization material according to claim 4, characterized in that, The promoter specifically induced by rice mycorrhizal fungi is the OsPT11 gene promoter.

6. The rice arbuscular mycorrhizal visualization material according to claim 4, characterized in that, The OsPT11 gene promoter sequence is shown in SEQ ID NO.1; The nucleotide sequence encoding the CYP76AD cytochrome P450 enzyme is shown in SEQ ID NO.2; The nucleotide sequence encoding the DODA enzyme is shown in SEQ ID NO.3; The nucleotide sequence encoding the cDOPA5GT enzyme is shown in SEQ ID NO.

4.

7. The rice arbuscular mycorrhizal visualization material according to any one of claims 4 to 6, characterized in that, The expression cassette also contains a reporter gene for screening transgenic plants.

8. The method for preparing the rice arbuscular mycorrhizal visualization material according to any one of claims 4 to 7, characterized in that, Includes the following steps: A recombinant expression vector containing the expression cassette was constructed, and the recombinant expression vector was transformed into Agrobacterium tumefaciens. The Agrobacterium tumefaciens was used to infect rice callus tissue, and transgenic rice plants were obtained after screening and regeneration culture. The recombinant expression vector is a pCAMBIA 1300 series vector.

9. A method for non-destructive in-situ dynamic observation of the rice arbuscular mycorrhizal infection process, characterized in that, Includes the following steps: Provide a rice arbuscular mycorrhizal visualization material as described in any one of claims 4 to 7, and cultivate it as an observation object plant; The plants under observation were planted in transparent containers and inoculated with arbuscular mycorrhizal fungi. The mycorrhizal infection process was dynamically observed based on the changes in the red color of the roots.

10. The application of the rice arbuscular mycorrhizal visualization carrier construct according to any one of claims 1 to 3, the rice arbuscular mycorrhizal visualization material according to any one of claims 4 to 7, or the non-destructive in-situ dynamic observation method for rice arbuscular mycorrhizal infection process according to claim 9 in recording the mycorrhizal infection process, screening mycorrhizal symbiosis-related mutants, or verifying the effect of phosphorus on mycorrhizal symbiosis.