Application of OsSirB gene in resistance of rice blast and bacterial blight of rice

By regulating the expression level of the OsSirB gene in rice and using overexpression and RNA silencing techniques, transgenic rice varieties resistant to rice blast and bacterial blight were bred, solving the problem of insufficient disease resistance in rice under existing technologies and realizing the application potential of genetic engineering in improving crop disease resistance.

CN121874253APending Publication Date: 2026-04-17FUJIAN AGRI & FORESTRY UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
FUJIAN AGRI & FORESTRY UNIV
Filing Date
2026-03-02
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

There is a lack of effective genetic engineering methods in the current technology to improve the resistance of rice to rice blast and bacterial blight, and traditional chemical control has the risks of environmental pollution and drug resistance.

Method used

By regulating the expression level of the rice OsSirB gene through overexpression and RNA silencing technologies, and utilizing the nucleotide sequence (SEQ ID NO: 1) and amino acid sequence (SEQ ID NO: 2) of the OsSirB gene, the OsSirB gene was silenced in rice to enhance resistance or overexpressed to reduce resistance, thus breeding transgenic rice varieties resistant to rice blast and bacterial blight.

Benefits of technology

Rice mutants with RNA interference in the OsSirB gene showed enhanced resistance to rice blast fungus and bacterial blight fungus. Overexpression of the OsSirB gene increased susceptibility to disease, realizing the potential of improving crop disease resistance by regulating the expression level of the OsSirB gene through genetic engineering.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121874253A_ABST
    Figure CN121874253A_ABST
Patent Text Reader

Abstract

The invention discloses application of an OsSirB gene in resistance of rice blast and bacterial blight of rice, a nucleotide sequence of the OsSirB gene is shown as SEQ ID NO: 1, and an amino acid sequence of a protein coded by the OsSirB gene is shown as SEQ ID NO: 2. Experimental results show that overexpression of the OsSirB gene reduces the resistance of rice to rice blast and / or bacterial blight, and silence of the OsSirB gene improves the resistance of rice to rice blast and / or bacterial blight. In conclusion, the gene engineering technology is utilized to regulate the expression level of the OsSirB gene, so that the gene can be applied to crop molecular breeding, and the gene has good application potential in improvement of crop disease resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of rice genetic engineering, specifically involving OsSirB Application of genes in rice resistance to rice blast and bacterial blight. Background Technology

[0002] As one of the world's most important food crops, the stable development of the rice industry is closely related to global food security. Statistics show that more than half of the world's population relies on rice as their staple food. Rice blast, a devastating disease in rice production, can cause 30-50% yield loss, and in extreme cases, even total crop failure. Due to the environmental pollution risks and resistance issues associated with traditional chemical control methods, developing new disease-resistant varieties has become a crucial strategy for ensuring food security. The development of modern molecular biology techniques has provided innovative pathways for exploring rice disease-resistant genetic resources. Through gene editing, molecular marker-assisted breeding, and other technologies, the efficiency of breeding disease-resistant varieties can be significantly improved.

[0003] SirB, a key enzyme in the biosynthesis of sirohydrochlorin ferrochelatase, plays a crucial role in the tetrapyrrole biosynthesis pathway in organisms, and its unique structure is closely related to its function. It can function independently as a monomeric enzyme or enhance its catalytic efficiency by forming homodimers, and its catalytic process does not require ATP energy. This enzyme exists as a fusion gene in *Escherichia coli* and *Saccharomyces cerevisiae*, while the SirB gene (encoding a single sirohydrochlorin ferrochelatase) cloned from *Bacillus megaterium* shares sequence homology with the anaerobic cobalt chelate CbiX.

[0004] SirB plays a crucial biological role in plant physiological processes, and related research has been conducted in Arabidopsis thaliana and maize. It is a key enzyme in the synthesis of siroheme, which, as a cofactor for nitrite reductase (NiR) and sulfite reductase (SiR), plays a central role in the plant's nitrogen and sulfur assimilation metabolic pathways. Its functional integrity has a decisive impact on the Earth's biochemical cycle system. Studies have found that SirB can catalyze the chelation of ferrous ions with sirochlorothiazide to form siroheme, ensuring the normal function of SiR. Without sirochlorothiazide ferric chelate chelate, siroheme cannot be synthesized, SiR cannot function properly, sulfate reduction is hindered, affecting not only the plant's own protein synthesis but also causing animals to be affected by insufficient sulfur-containing amino acids from plant-based foods. In the process of plant nitrogen (N) assimilation, plants mainly take up nitrate ions (NO3-) from the soil solution through their roots. - These inorganic nitrogen sources must undergo a reduction reaction to generate ammonium nitrogen (NH4) before being assimilated into nitrogen-containing organic matter. +This reduction process is a key step in plant nitrogen metabolism, directly affecting the synthesis efficiency of nitrogen-containing compounds such as amino acids and proteins. The second step of the nitrate reduction reaction is regulated by nitrite reductase (NiR), which also relies on siroheme as a cofactor to exert its catalytic activity.

[0005] SirB participates in the synthesis of sirheme, which is crucial for the function of NiR (Nitrogen Reductase). SirB ensures the smooth reduction of nitrate to ammonium, providing plants with a usable nitrogen source and promoting their growth and development. Abnormal sirheme function hinders nitrogen assimilation, affecting plant growth and reproduction, and subsequently triggering a chain reaction on the material cycle and energy flow of the entire ecosystem. Studies on the gene function of SirB in Arabidopsis thaliana have revealed that this gene is a key enzyme in the synthesis of heme, which in turn acts as a cofactor for nitrate reductase (NR) and nitrite reductase (NiR), participating in the absorption and utilization of N and S by plants. Overexpression plants exhibit higher biomass, richer chlorophyll and protein content, and stronger photosynthetic capacity during growth. Conversely, antisense expression plants show significant growth inhibition, including leaf yellowing, decreased protein content, and reduced photosynthetic efficiency. These results indicate that SirB plays a vital role in plant N and S metabolism. Another study found that SirB insertion mutants cause stunted growth in Arabidopsis seedlings after germination. All this evidence suggests that SirB influences physiological processes in plants.

[0006] Currently, there are no reports on the application of the rice OsSirB gene in rice blast resistance. However, altering the expression level of OsSirB in rice using genetic engineering techniques to improve disease resistance has significant practical value. Therefore, crop genetic improvement can be carried out by methods such as interfering with the expression of this gene, to cultivate transgenic rice resistant to rice blast. Summary of the Invention

[0007] The purpose of this invention is to provide OsSirB Application of genes in rice resistance to rice blast and bacterial blight.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: OsSirB The application of genes in regulating plant resistance to rice blast and / or bacterial blight, the aforementioned OsSirB The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0009] Furthermore, the aforementioned OsSirB The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 2.

[0010] Furthermore, the plant in question is rice.

[0011] Furthermore, overexpression OsSirB Genes that reduce plant resistance to rice blast and / or bacterial blight, silencing... OsSirB Genes enhance plant resistance to rice blast and / or bacterial blight.

[0012] Furthermore, the silence OsSirB The gene-based approach is RNAi interference. OsSirB Gene.

[0013] OsSirB The application of genes in breeding disease-resistant plant varieties, the aforementioned OsSirB The nucleotide sequence of the gene is shown in SEQ ID NO: 1, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO: 2.

[0014] Furthermore, overexpression in plants using genetic engineering methods OsSirB Genes are used to obtain plant varieties with reduced disease resistance; genetic engineering methods are used to modify genes in plants to obtain plant varieties with reduced disease resistance. OsSirB Gene silencing is used to obtain plant varieties with enhanced disease resistance.

[0015] Furthermore, the disease resistance refers to resistance to rice blast and / or bacterial blight.

[0016] Furthermore, the plant in question is rice.

[0017] One method to improve rice resistance to rice blast and / or bacterial blight is to silence the rice... OsSirB Genes were developed to enhance rice's resistance to rice blast.

[0018] The advantages of this invention are: This invention utilizes overexpression and RNA silencing technologies to... OsSirB Gene overexpression and RNA interference were performed, and it was found that... OsSirB Negative gene regulation of rice resistance to rice blast and bacterial blight. RNA interference. OsSirB Rice mutants of the gene showed enhanced resistance to rice blast fungus and bacterial blight fungus; while overexpression OsSirB Genetic modification enhances the susceptibility of rice to disease. In summary, the use of genetic engineering techniques to regulate... OsSirB The gene expression level can be applied to crop molecular breeding to cultivate rice varieties resistant to rice blast and / or bacterial blight. This gene has good application potential in improving crop disease resistance. Attached Figure Description

[0019] Figure 1 Rice OsSirB Gene overexpression and RNA silencing mutant identification in Nipponbare rice (NPB) background. 'a' represents overexpression. OsSirBDetection of OsSirB transcriptional levels in plants; b indicates overexpression. OsSirB Protein level detection of OsSirB in plants; c represents RNA silencing. OsSirB Transcriptional levels of OsSirB in plants were detected (**: P < 0.01, Student's t-test).

[0020] Figure 2 : OsSirB Identification of resistance to rice blast in mutants. 'a' represents wild-type NPB and... OsSirB Overexpressing plants were inoculated with blast fungus R88002 through perforation; b shows the lesion length measurement of leaves in a; c shows the blast fungus biomass detection of leaves in a; d shows the blast fungus R88002 inoculation of wild-type NPB and OsSirB RNA silencing mutants through perforation; e shows the lesion length measurement of leaves in d; f shows the blast fungus biomass detection of leaves in d (**: P<0.01, Student t-test).

[0021] Figure 3 : Identification of resistance of OsSirB mutant to rice bacterial blight. a shows the disease incidence results of wild-type NPB and OsSirB overexpression mutants inoculated with rice bacterial blight PXO99; b shows the statistical analysis of leaf lesion length in a; c shows the disease incidence results of wild-type NPB and OsSirB overexpression mutants in rice bacterial blight PXO99. OsSirB Disease incidence of gene-silenced plants inoculated with rice bacterial blight PXO99; d represents the statistical analysis of leaf lesion length in c (**: P<0.01, Student t-test).

[0022] Figure 4 Chitin and flg22 treatment caused OsSirB ROS accumulation in overexpressing plants. a represents wild-type NPB and... OsSirB ROS accumulation in overexpressing plants after chitin and water treatment; b represents wild-type NPB and OsSirB ROS accumulation in overexpressing plants after flg22 and water treatment was detected; c and d represent wild-type NPB and... OsSirB Transcriptional level of PR gene in overexpressing plants was detected (**: P < 0.01, Student's t-test).

[0023] Figure 5 Chitin and flg22 treatment caused OsSirB ROS accumulation in gene-silenced plants. a represents wild-type NPB and... OsSirB ROS accumulation in gene-silenced plants after chitin and water treatment; b represents wild-type NPB and OsSirB ROS accumulation in gene-silenced plants after flg22 and water treatment was detected; c and d represent wild-type NPB and OsSirB In gene-silenced plants PRGene transcription level detection (**: P<0.01, Student t-test). Detailed Implementation

[0024] The present invention will be further described below with reference to the embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally carried out in accordance with known means in the art.

[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0026] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0027] The rice blast fungus race R88002 and rice bacterial blight strain PXO99 used in the following examples are available to the public from Fujian Agriculture and Forestry University.

[0028] Example 1 OsSirB Obtaining overexpression and silencing mutant plants Obtained from the Rice Genome Annotation Project database (http: / / rice.uga.edu / ) OsSirB The coding sequence and protein sequence of (LOC_Os02g19440) OsSirB The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO.2. Furthermore, the coding sequence of OsSirB-3×flag is shown in SEQ ID NO.3, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO.4.

[0029] (1) Construction of overexpression vector by OsSirB Using the coding sequence (SEQ ID NO.1) as a template, primers were designed to obtain the forward primer pCXUN-OsSirB-F:5'-cttctgcagcccgggggatccATGCATACTATCTCAATCCCCTTCC-3' and the reverse primer pCXUN-OsSirB-3flag-R:5'-cgatcggggaaattcggatccTTACTTGTCATCGTCGTCCTTGTAGTCCTTGTCATCGTCGTCCTTGTAGTCCATAGGGTACAGTTGGCATTTTCCA-3'. Using wild-type Nipponbare cDNA as a template, amplification was performed using the pCXUN-OsSirB-F / pCXUN-OsSirB-3flag-R primer pair with a high-fidelity enzyme from Novizan. OsSirB- 3xflagThe DNA sequence (as shown in SEQ ID NO.3, and the amino acid sequence of the protein it encodes as shown in SEQ ID NO.4) was extracted and recycled using a gel. The pCXUN-HA vector was linearized with the restriction endonuclease BamHI, extracted, and recycled using a gel. The linearized vector was then ligated with... (The sentence is incomplete and requires further context to translate accurately.) OsSirB The recovered fragments were ligated and transformed into competent E. coli cells. The cells were plated on LB agar plates (containing 50 mg / L Kan) and incubated upside down at 37°C for 16 h to form single colonies. Positive clones were screened by colony PCR. After sequencing confirmed, the bacterial culture was mixed with 15% glycerol and stored at -80°C.

[0030] (2) Construction of RNAi vector The coding sequence used in the OsSirB-RNAi vector is shown in SEQ ID NO.5, as follows: GGAGCTAGCTGAGCCTACTATTAAAGATGCATTTGGAAAATGTGTGCAACAAGGAGCGTCCCGTGTTATTGTCAGTCCATATTTTCTTTCACCTGGACGACACTGGAAACAAGATATCCCTGCTTTAGCTGCGGAAGCATCT AAGGAGCACTCAAACTAACTTATGTTGTCACTGCCCCTCTTGGATTGCATGAGCTTATGGTGGATGTTATGAATGATCGCATCAAGTACTGCCTGAGACACGTTGCAGGTAATGTTGAGGAATGTACAGTATGTGCTGGA.

[0031] by OsSirB Using the coding sequence (SEQ ID NO.1) as a template, primers were designed to obtain the following primer pairs: RNAi-S-BamHI-F: 5'-CGGGATCCGGAGCTAGCTGAGCCTACTATT-3'; RNAi-S-KpnI-R: 5'-GGGGTACCTCCAGCACATACTGTACATT-3'; RNAi-AS-SacI-F: 5'-CGAGCTCGGAGCTAGCTGAGCCTACTATT-3'; RNAi-AS-SpeI-R: 5'-GACTAGTTCCAGCACATACTGTACATT-3'.

[0032] Using wild-type Nipponbare cDNA as a template, PCR amplification of RNAi-S-BamHI-F and RNAi-S-KpnI-R was performed using high-fidelity enzymes and primers from Novizumi. The amplification conditions were as follows: first, pre-denaturation at 95℃ for 3 minutes to ensure complete denaturation of the template DNA; then 40 cycles, each cycle consisting of denaturation at 94℃ for 30 seconds, extension at 55–60℃ for 60 seconds to allow primer binding to the template, and extension at 72℃ for 30 seconds; after the cycles, a final extension at 72℃ for 5 minutes was performed to ensure complete amplification of all fragments. Finally, the cells were stored at 4℃, with each fragment expansion volume being 100 μl. The positive fragment shown in SEQ ID NO. 5 was obtained, excised, and recovered from the gel for later use. The pTCK303 vector was linearized using restriction endonucleases BamHI and KpnI, excised, and recovered from the gel. The linearized vector was ligated to the recovered fragment using Novizumi's single-fragment seamless ligation kit, and the resulting fragments were transformed into competent E. coli cells. The culture was spread on LB agar plates (containing 50 mg / L Kan) and incubated upside down at 37°C for 16 h to form single colonies. Positive clones were screened using colony PCR, and after successful sequencing, pTCK303-RNAi-sirb1 was obtained. The plasmid was extracted and preserved. Next, using the pTCK303-RNAi-sirb1 plasmid as a template, PCR amplification was performed using primers RNAi-AS-SacI-F and RNAi-AS-SpeI-R. The amplification conditions and system were consistent with those described above, yielding a reversed fragment as shown in SEQ ID NO. 5, which was then excised and recovered for later use. The pTCK303-RNAi-sirb1 vector was then linearized again using restriction endonucleases SacI and SpeI, excised, and recovered. This was then ligated with the second amplification product and transformed into competent *E. coli* cells. The bacteria were spread on LB agar plates (containing 50 mg / L Kan) and incubated upside down at 37°C for 16 h to form single colonies. Positive clones were screened by colony PCR. After correct sequencing, pTCK303-RNAi-sirb2 was obtained. After correct sequencing, glycerol with a final concentration of 15% was added to the bacterial culture, mixed well, and stored at -80°C.

[0033] The constructed overexpression and RNAi vectors were introduced into the embryogenic callus of rice variety NPB using Agrobacterium EHA105.

[0034] Using primers 5'-TTCCGGAAGTGCTTGACATTGGGGA-3' and 5'-ACGGTGTCGTCCATCACAGTTTGCC-3', the hygromycin resistance gene (HPH) fragment in transgenic T0 rice was detected. Plants with a PCR amplification product of 289 bp were identified as transgenic positive plants, and all obtained lines were positive transformants. RNA was extracted from rice leaves, reverse transcribed into cDNA, and the hygromycin resistance gene was detected in transgenic rice. OsSirB The transcriptional level of genes, the results are as followsFigure 1 The results showed that, compared to wild rice, the tested transgenic rice plants had higher... OsSirB All showed upregulation, with expression levels increasing by 200-800 times, indicating that... OsSirB Overexpression was obtained, and then protein analysis was performed on three rice plants with high expression levels to further confirm the results. OsSirB Overexpression was achieved; similarly, validation of RNAi plants was performed. Subsequently, overexpressing plants OE-OsSirB-25# and OE-OsSirB-27# were selected, as well as... OsSirB The gene-silencing lines RNAi-OsSirB-7# and RNAi-OsSirB-13# were used for subsequent experimental analysis.

[0035] Example 2 OsSirB Identification of disease resistance phenotypes in overexpression and silencing mutant lines (1) Determination of antipyretic phenotype of OsSirB mutant Wild-type NPB. OsSirB Overexpression lines, OsSirB Gene-silenced lines were grown in a greenhouse, and rice leaves at approximately 4-6 weeks of age were inoculated with 10 μl of spores of *Magnapordia oryzae* strain R88002 (concentration 5 x 10⁻⁶). 5 Take photos 7-9 days after vaccination. OsSirB The lesions of the overexpressing strains were all larger than those of the wild-type NPB strains. Figure 2 a); OsSirB The lesions in gene-silenced lines were all smaller than those in wild-type NPB. Figure 2 d). Extract separately Figure 2 a and Figure 2 Genomic DNA from leaves was collected, and the expression level of the rice blast fungus gene MoPot2 was used to indicate the biomass of rice blast fungus in inoculated leaves. Specifically, the transcription level of MoPot2 was detected using quantitative real-time PCR, with the rice gene OsUBQ as an internal control. Data processing employed the comparative Ct method, where Ct is the number of cycles required for the fluorescence signal in the PCR tube to reach a set threshold, ΔCt = Ct(MoPot2) - Ct(OsUBQ), with a 2-1 value. -ΔCt The value measures the level of gene transcription. The expression level of the rice blast fungus gene MoPot2 also shows... OsSirB The relative biomass of rice blast fungus in the diseased leaves of gene-silenced strains was significantly lower than that of wild-type NPB. Figure 2 c and 2f), the above results indicate that OsSirB Negative gene regulation of rice resistance to rice blast fungus.

[0036] (2) Determination of the OsSirB mutant's resistance to bacterial blight phenotype Wild-type NPB, OsSirB Overexpression lines andOsSirB Gene-silenced strains were planted in a greenhouse. On rice leaves that were approximately two months old, the concentration of *Rhizoctonia solani* PXO99 was first adjusted to OD using PBS solution. 600 =1, then use sterile scissors to immerse the rice leaves in the bacterial solution, cutting off the top 2-3 cm of the leaves at an angle, and place them in an inoculation room at 28℃ and 90% humidity. Two weeks after inoculation, the results are as follows... Figure 3 As shown, OsSirB The lesion length of the overexpressing lines was significantly larger than that of the wild-type NPB; OsSirB The lesion length of the gene-silenced lines was significantly smaller than that of the wild-type NPB. These results indicate that... OsSirB Negative gene regulation of rice resistance to bacterial blight.

[0037] Example 3 OsSirB PTI responses of overexpression and silencing mutant lines after Chitin and flg22 treatment It will grow for about 4-6 weeks. OsSirB Overexpression lines and wild-type rice leaves were perforated using a 4mm diameter punch and then soaked in sterile ddH2O overnight in the dark. Working concentrations of 80 nM Chitin or 500 nM flg22, 0.05 mm luminol, and 25 μg / ml HRP reaction solution were prepared (for the control, Chitin was replaced with ddH2O). 50 μl / well of ddH2O was added to an opaque 96-well plate, and the overnight-soaked rice leaves were carefully transferred to each well. 50 μl / well of each reaction solution was added, with at least eight biological replicates for each treatment. Chemiluminescence was detected using a microplate reader. In the pathogen-associated molecular model, treatment with Chitin and flg22 resulted in decreased ROS accumulation and downregulated expression of disease-related genes. Figure 4 );and OsSirB Gene-silenced lines treated with the pathogen-associated molecular modeling agents Chitin and flg22 showed increased ROS accumulation and upregulated expression of disease-related genes. Figure 5 The above results indicate that... OsSirB Negative regulation of PTI response by genes.

[0038] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention shall be covered by the present invention.

Claims

1. OsSirB The application of genes in regulating plant resistance to rice blast and / or bacterial blight is characterized by: The OsSirB The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that: The OsSirB The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:

2.

3. The application according to claim 1, characterized in that: The plant in question is rice.

4. The application according to claim 1, characterized in that: overexpression OsSirB Genes that reduce plant resistance to rice blast and / or bacterial blight, silencing... OsSirB Genes enhance plant resistance to rice blast and / or bacterial blight.

5. The application according to claim 4, characterized in that: The silence OsSirB The gene-based approach is RNAi interference. OsSirB Gene.

6. OsSirB The application of genes in breeding disease-resistant plant varieties is characterized by: The OsSirB The nucleotide sequence of the gene is shown in SEQ ID NO: 1, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO:

2.

7. The application according to claim 6, characterized in that: Overexpression in plants using genetic engineering methods OsSirB Genes are used to obtain plant varieties with reduced disease resistance; genetic engineering methods are used to modify genes in plants to obtain plant varieties with reduced disease resistance. OsSirB Gene silencing is used to obtain plant varieties with enhanced disease resistance.

8. The application according to claim 6, characterized in that: The disease resistance refers to resistance to rice blast and / or bacterial blight.

9. The application according to claim 6, characterized in that: The plant in question is rice.

10. A method for improving the resistance of rice to rice blast and / or bacterial blight, characterized in that: Silent in the rice OsSirB Genes were developed to enhance rice's resistance to rice blast.