Construction method and application of recombinant vector based on bCoro1a gene 3 'UTR editing
By constructing a 3′UTR recombinant vector of the bCoro1a gene, inserting the bta-miR-27b target sequence, and downregulating bCoronin-1A expression, the immune evasion problem of bovine tuberculosis was solved, the host's resistance to Mycobacterium tuberculosis infection was improved, and a new breeding strategy for bovine tuberculosis resistance was provided.
Patent Information
- Application Number
- CN202610095943.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-23
- Publication Date
- 2026-04-17
AI Technical Summary
There are no reports of using 3′UTR to prevent and control bovine tuberculosis in the current technology. The discovery and application of bovine tuberculosis resistance genes is an important foundation for breeding tuberculosis-resistant dairy cows. Bovine coronavirus protein 1A is significantly elevated in Mycobacterium tuberculosis infection, leading to host immune evasion and bacterial survival.
A recombinant vector based on the 3′UTR of the bCoro1a gene was constructed. By inserting a specific bta-miR-27b target sequence, the expression of bCoronin-1A was downregulated, which inhibited the immune evasion of Mycobacterium tuberculosis and improved the host's anti-infection ability.
By targeting and downregulating bCoronin-1A expression, the immune evasion of Mycobacterium tuberculosis is inhibited, thereby enhancing the host's resistance to Mycobacterium tuberculosis infection and providing a new strategy for combating bovine tuberculosis.
Smart Images

Figure CN121874267A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the construction method and application of recombinant vectors based on the 3′UTR editing of the bCoro1a gene. Background Technology
[0002] Bovine tuberculosis (TB) is a chronic, wasting zoonotic infectious disease mainly caused by Mycobacterium bovis, resulting in significant economic losses to the cattle industry and seriously threatening public health security. TB in dairy cattle has become a key issue affecting the sustainable development of my country's cattle industry, and the discovery and application of TB resistance genes in dairy cattle is an important foundation for breeding TB-resistant dairy cattle.
[0003] Bovine Coronin-1A (bCoronin-1A) is composed of... bCoro1a Gene-encoded type of bacteria in Mycobacterium tuberculosis (Mycobacterium tuberculosis) Mycobacterium tuberculosis, M.tb ) evading key molecules in the host's innate immune response, M.tb The transcription and expression levels of bCoronin-1A were significantly increased after infection. M.tb By retaining bCoronin-1A, phagosomes are prevented from fusing with lysosomes, thus escaping clearance by host cells; and overexpression of bCoronin-1A also significantly increases... M.tb Intracellular survival. Therefore, targeting and inhibiting the expression of bCoronin-1A could be a potential strategy for breeding tuberculosis-resistant dairy cows.
[0004] The 3′ untranslated region (3′UTR) plays a crucial role in post-transcriptional regulation of gene expression, controlling gene expression through the addition of regulatory sequences. miRNAs, as key post-transcriptional regulators of gene expression, bind to the 3′UTR of target mRNAs, preventing the translation of target proteins and reducing their expression levels, thus playing a role in host regulation. M.tb It plays a crucial role in the immune response to infection. However, there are no reports of using 3′UTR to control bovine tuberculosis in the current technology. Summary of the Invention
[0005] To address the aforementioned technical problems, this invention provides a recombinant vector, its preparation method, and its application, specifically a recombinant vector based on bCoro1a gene 3′UTR editing, its construction method, and its application.
[0006] A recombinant vector comprising an upstream homologous arm of the target site, a 3′ UTR into which the target sequence is inserted, and bCoro1a The nucleotide tailing signal consists of 200 bp, selection markers, and downstream homologous arms of the target site; The target site is bCoro1a The 29th or 70th position of the 3′UTR of the gene; The bCoro1a The sequence of the 3′UTR of the gene is: 5′-AGGACCATCGGCTGGGGCCGACAGCCTCGCCTCCCTCCCTTCCATTCCCACTCCTCAGGCCACAATGGCGGATAAAAAAATAATAATAAAATGGCTT-3′, denoted as SEQ ID NO.48; The screening markers include enhanced green fluorescent protein and puromycin.
[0007] In the recombinant vector of the present invention, the expression level of bCoronin-1A is downregulated by inserting a specific bta-miR-27b target sequence into the 3′UTR, thereby inhibiting M.tb immune evasion and improving the host's ability to resist M.tb infection.
[0008] Preferably, the target sequence is the target sequence of bta-miR-27b.
[0009] Preferably, the sequence of the screening marker is as shown in SEQ ID NO.49.
[0010] The method for constructing the recombinant vector includes the following steps: The screening marker was ligated to the T-Vector pMD19 vector to obtain pEF1α-EGFP-P2A-Puro-T; pEF1α-EGFP-P2A-Puro-T was linearized and ligated to the downstream homologous arm of the target site to obtain pEF1α-EGFP-P2A-Puro-RA. Using the EBL cell genome as a template, the upstream homologous arm of the target site was amplified; Using psiCHECK2-3′UTR-WT as a template, the 3′UTR of the inserted target sequence was amplified, and the 3′UTR of the inserted target sequence and bCoro1a The nucleotide tailing signal of 200 bp is used as a template to amplify the amplified product; The recombinant vector is obtained by ligating the pEF1α-EGFP-P2A-Puro-RA, the upstream homologous arm, and the amplification product.
[0011] Preferably, the primers used to amplify the upstream homologous arm of the target site are shown in SEQ ID NO.26~SEQ ID NO.29.
[0012] Preferably, the primers used to amplify the 3′UTR of the inserted target sequence are shown in SEQ ID NO.34~SEQ ID NO.35.
[0013] Preferably, the primers used to amplify the amplification product are shown in SEQ ID NO.34 and SEQ ID NO.37.
[0014] Preferably, the target sequence is a bta-miR-27b sequence.
[0015] An anti-infection system comprising a targeting vector and the recombinant vector; The targeting vector is obtained by linking sgRNA and pSpCas9(BB)-2A-Puro(PX459) vector, and the sequence of the sgRNA is shown in SEQ ID NO.8~9, SEQ ID NO.10~11, SEQ ID NO.14~15 or SEQ ID NO.16~17.
[0016] The application of the aforementioned anti-infection system in the fight against Mycobacterium tuberculosis infection.
[0017] The application of the aforementioned anti-infection system in the preparation of drugs for treating bovine tuberculosis.
[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention is based on bCoro1a The 3'UTR-edited gene expression regulation system targets and downregulates bCoronin-1A expression levels by inserting a specific bta-miR-27b target sequence into the 3'UTR, thereby inhibiting... M.tb Immune evasion and increased host resistance M.tb Infectivity. Attached Figure Description
[0019] Figure 1 For bta-miR-27b bCoro1a Inhibitory effects of inserting target sequences at different sites in the 3′UTR.
[0020] Figure 2 for bCoro1a 3′UTR Insertion target sequence editing strategy.
[0021] Figure 3 For the detection of sgRNA SSA activity.
[0022] Figure 4 For cell fluorescence imaging.
[0023] Figure 5 This is the result of Junction PCR.
[0024] Figure 6 These are the results of Sanger sequencing.
[0025] Figure 7 for bCoro1aThe level of bCoronin-1A mRNA in 3′UTR-29 / 70 edited cells after BCG infection.
[0026] Figure 8 For bCoro1a The number of intracellular bacteria in 3′UTR-29 / 70 edited cells. Detailed implementation manners
[0027] The following describes the detailed implementation manners of the present invention. However, it should be understood that the protection scope of the present invention is not limited by the detailed implementation manners. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified.
[0028] The information of the vectors used in the present invention is as follows: Construction process of p3×Flag-bCoronin-1A: (1) Amplification of the target gene: Using Primer Premier 5 software, primers were designed according to the bCoro1a gene CDS sequence retrieved from the NCBI website, and two rounds of PCR amplification were carried out respectively. The upstream and downstream primer sequences were synthesized by Tsingke Biotechnology Co., Ltd. The first round was amplified with bovine spleen tissue cDNA as the template, and the primer sequences were as follows:
[0029] bCoronin-1A-F1 (5′-3′): CGCTCATCTCTCAGCCGCAGG, denoted as SEQ ID NO.51; bCoronin-1A-R1 (5′-3′): CAGCCGATGGTCCTCTACTT, denoted as SEQ ID NO.52.
[0030] The reaction system is shown in Table 1.
[0031] Table 1 PCR reaction system The PCR reaction conditions are shown in Table 2.
[0032] Table 2 PCR reaction conditions The PCR product was mixed with DNA loading buffer and then subjected to 1% agarose gel electrophoresis. The gel block containing the target band was cut off in an ultraviolet gel cutting instrument and placed in a 1.5 mL centrifuge tube for DNA product recovery.
[0033] (2) DNA product recovery: DNA products were recovered using the Magen agarose gel DNA recovery kit.
[0034] The second round of PCR was performed using the recovered DNA product as a template. The primer sequences are as follows (the underlined parts are homologous sequences of the linearized vector): bCoronin-1A-F2 (5′-3′): CGATGACAAGCTTGCG ATGAGCCGGCAGGTGGTC, designated as SEQ ID NO. 53; bCoronin-1A-R2 (5′-3′): TATCGATGAATTCGC CTTGGCCTGGACTGTCTC, denoted as SEQ ID NO.54.
[0035] The reaction system and conditions are the same as in Table 1, as shown in Table 2.
[0036] DNA product recovery was performed according to step (2). The resulting solution was the desired DNA fragment. The concentration was measured using a NanoDrop One ultraviolet-visible spectrophotometer and then stored at -20°C.
[0037] (3) Vector linearization: p3×Flag-CMV vector used Not I. Linearization was performed, and the reaction system is shown in Table 3.
[0038] Table 3 linearization system of p3×Flag-CMV carrier The above reaction system was placed in a 37°C water bath for 1-4 h. After mixing with DNA loading buffer, 1% agarose gel electrophoresis was performed. The gel block containing the target band was cut off in a UV gel cutter. The DNA product was recovered according to step (2), and the concentration was measured and stored at -20°C.
[0039] (4) Seamless cloning: The target DNA fragment obtained in step (2) is ligated with the linearized vector obtained in step (3) using pEASY. ® The Basic Seamless Cloning and Assembly Kit is used for connection. The reaction system is shown in Table 4.
[0040] Table 4 Seamless Cloning System After mixing the above system thoroughly, react at 50°C for 15 min. After the reaction is complete, cool on ice for a few seconds, then store at -20°C or proceed with the conversion directly.
[0041] (5) Transformation, bacterial selection and sequencing: Trelief was taken out of the -80℃ ultra-low temperature freezer. ® Thaw 5α competent cells on ice, add the ligation product to the competent cells, gently pipette to mix, and incubate on ice for 5 min. Heat shock at 42°C for 60 s, then immediately transfer to ice and incubate for 2 min. Add 100 μL of antibiotic-free LB liquid medium and mix well. Spread 70 μL of the bacterial culture evenly onto a solid LB plate containing ampicillin using a sterile spreader. Incubate upside down at 37°C for 12–16 h. Pick a single colony and place it in a 2 mL centrifuge tube, add 1 mL of ampicillin-resistant LB liquid medium, and incubate at 37°C with shaking for approximately 6 h. Send 200 μL of the bacterial culture to Qingke Biotechnology Co., Ltd. for sequencing identification. Store the remaining bacterial culture at 4°C for later use.
[0042] (6) Plasmid extraction: The bacterial culture with correct sequencing was expanded to 20 mL, and endotoxin-free plasmids were extracted using Endo-Free Plasmid Mini Kit II.
[0043] psiCHECK2 carrier: purchased from Promega, product number: C8021 pSpCas9(BB)-2A-Puro(PX459) vector: purchased from Addgene's official website, product number: plasmid#48139; pGL3-Control: Purchased from Shanghai Zeye Biotechnology Co., Ltd., product number: ZY1555; T-Vector pMD™19 (Simple) vector: purchased from TaKaRa Corporation, Japan, item number: 3271; Information on the pSSA1-3 vector and pEF1α-EGFP-P2A-Puro vector comes from the following literature: Yuan, M., Zhang, J., Gao, Y., Yuan, Z., Zhu, Z., Wei, Y., Wu, T., Han, J., & Zhang, Y. (2021). HMEJ-based safe-harbor genome editing enables efficient generation of cattle with increased resistance to tuberculosis. The Journal of biological chemistry , 296 , 100497. miR-27b is M.tb The upregulation after infection was relatively significant and inhibited. M.tbPrevious studies have confirmed that the target sequence of bta-miR-27b, which is an intracellular miRNA, is 5'-CGAAUACAUGUGGUUCCUCCUGUACUGUGAGG-3'.
[0044] Example 1. bCoro1a Construction of 3′UTR Insertion Target Reporting Vector Using p3×Flag-bCoronin-1A as a template, the bCoronin-1A-3′UTR sequence was amplified using bCoronin-1A-F2 and 3′UTR-WT-R primers; the bCoronin-1A-3′UTR-29 sequence was amplified using bCoronin-1A-F2 and 3′UTR-29-R primers; the bCoronin-1A-3′UTR-45 sequence was amplified using bCoronin-1A-F2 and 3′UTR-45-R primers; and the bCoronin-1A-3′UTR-70 sequence was amplified using bCoronin-1A-F2 and 3′UTR-70-R primers.
[0045] bCoro1a The 3′UTR target editing reporter vector uses the above sequences as templates and 3′UTR-F and 3′UTR-R as primers to amplify the 3′UTR, 3′UTR-29, 3′UTR-45 and 3′UTR-70 sequences, which are then ligated into the target vectors. Not I. The effect of bta-miR27b on reporter gene expression was detected in the linearized psiCHECK2 vector. The correctly sequenced plasmids were named psiCHECK2-3′UTR-WT, psiCHECK2-3′UTR-29, psiCHECK2-3′UTR-45, and psiCHECK2-3′UTR-70. Primer sequences are shown in Table 5.
[0046] Table 5 Primer List 2. bCoro1a Screening of 3′UTR target sites and construction of target vectors (1) Screening of target sites: bCoro1a The gene 3′UTR (97 bp in length) sequence was input into the CRISPOR website to design the target site and select... Bos taurus For the genome, the sgRNA length corresponding to the target site was selected to be 20 nt. Based on the specificity score, cleavage efficiency score, potential off-target information score ranking, and the restriction enzyme sites contained in the sequence provided by the website, the five most ideal sites were selected for subsequent construction of CRISPR / Cas9 eukaryotic expression vectors and sgRNA cleavage activity testing.
[0047] (2) Design and synthesis of sgRNA: Oligonucleotide sequences corresponding to the five target sites selected above were designed and synthesized by Qingke Biotechnology Co., Ltd. The synthesized sequences are shown in Table 6.
[0048] Table 6 bCoro1a sgRNA primer sequence of 3′UTR The above sequence was used to construct the following annealing reaction: 5 μL Top guide primer (100 μM), 5 μL Bottom guide primer (100 μM). The mixture was thoroughly mixed and placed in a PCR instrument for annealing. The annealing program was: 98℃ for 10 min; then at room temperature for 5 min.
[0049] (3) Vector linearization: In this invention, pSpCas9(BB)-2A-Puro(PX459) vector is selected as the linker. pSpCas9(BB)-2A-Puro(PX459) is used... Bbs I. Recover the digestion product after single enzyme digestion;
[0050] (4) Ligation of sgRNA with linearized vector: The above enzyme digestion products and the annealed samples were ligated using Solution I. The ligation system is shown in Table 7.
[0051] Table 7 Solution I Connection System After mixing the above components, the mixture was incubated in a 16°C water bath for 2-4 h. The ligation products were then transformed, selected for sequencing, and the correctly sequenced targeting vectors were named pCas9-1, pCas9-3, pCas9-5, pCas9-6, and pCas9-7.
[0052] 3. Construction of SSA Reporting Carrier The purpose of this invention is to construct an SSA reporter vector to detect sgRNA cleavage activity. The SSA reporter vector contains a repetitive sequence of the firefly luciferase gene, into which the target site sequence can be inserted. After co-transfecting cells with the vector and the corresponding pCas9-sgRNA, a double-strand break occurs in the firefly luciferase gene, which is then restored to its complete expression cassette via the SSA repair pathway. This allows for the assessment of cleavage activity at different target sites.
[0053] Using pGL3-Control plasmid as a template, PCR primers were designed to amplify DNA fragments containing the target site, replacing... Bgl II and EcoRThe DNA sequence between I and II was used to construct the SSA reporter vector. Primers are shown in Table 8.
[0054] Table 8 Primer List After recovering the PCR target fragment, it was ligated into the T-Vector pMD™19 (Simple) vector. The ligation system is shown in Table 9.
[0055] Table 9 Connection System After mixing the above reaction solution, react at 16℃ for 30-60 min; the ligation product is transformed, single clones are picked and sent for sequencing, and the correctly sequenced vectors are named pSSA-1-T, pSSA-3-T, pSSA-5-T, pSSA-6-T and pSSA-7-T.
[0056] pSSA-1-T, pSSA-3-T, pSSA-5-T, pSSA-6-T, and pSSA-7-T were respectively subjected to cross-linking with pSSA1-3 vector. Bgl II and EcoR The plasmid was digested with enzyme I and the target fragment was ligated into the pSSA1-3 backbone vector using Solution I (see Table 3 for the ligation system). The ligation product was transformed, and single clones were picked and cultured. Since the recombinant plasmid contained repetitive sequences and was not suitable for direct sequencing, primers LucRep-F and LucRep-R were used for PCR amplification of the bacterial culture. The primer sequences are as follows:
[0057] LucRep-F (5′-3′):CGAAGGTTGTGGATCTGGATACC, SEQ ID NO.24; LucRep-R (5′-3′): TAGCTGATGTAGTCTCAGTGAGC, SEQ ID NO. 25.
[0058] After recovering the PCR target fragment, it was sent for sequencing. The SSA reporter vectors corresponding to the correctly sequenced fragments were named pSSA-sgRNA-1, pSSA-sgRNA-3, pSSA-sgRNA-5, pSSA-sgRNA-6, and pSSA-sgRNA-7.
[0059] 4. sgRNA cleavage activity assay HEK293T cells are grown in 24-well cell culture plates until the confluence is above 70% for transfection. The total amount of transfected plasmid is 2 μg, and the dosage ratio of pCas9 expression vector:SSA reporter vector:Renilla luciferase reporter vector is 21:20:1. 6 μL of PEI is used, and samples are collected 24 h after transfection. The activities of firefly and Renilla luciferase reporter genes are detected using a dual-luciferase reporter assay kit, and the ratio of the two can indicate the sgRNA cleavage activity.
[0060] 5. Construction of donor vector The donor vectors used in this invention are respectively composed of the upstream homologous arm LA (Left arm) of the targeting site, the 3′UTR of the inserted target sequence, bCoro1a 200 bp of the nucleotide tailing signal, the screening marker LoxP-EF1α-EGFP-P2A-Puro-SV40poly(A) signal-LoxP, and the downstream homologous arm RA (Right arm) of the targeting site. The construction strategy and detailed steps are as follows:
[0061] (1) Construction of pEF1α-EGFP-P2A-Puro-T vector: Using the pEF1α-EGFP-P2A-Puro vector as a template, EF1α-Puro-F and EF1α-Puro-R as primers to amplify the screening marker sequence LoxP-EF1α-EGFP-P2A-Puro-SV40poly(A) signal-LoxP, with EcoR Ⅰ and Spe Ⅰ restriction enzyme sites at both ends. Connect the above amplification product to the T-Vector pMD19 (Simple) vector, and the recombinant donor vector with correct sequencing is named pEF1α-EGFP-P2A-Puro-T. The primer sequences are as follows:
[0062] EF1α-Puro-F (5′-3′): GAATTCCATAACTTCGTATAG, denoted as SEQ ID NO.46; EF1α-Puro-R (5′-3′): ACTAGTCCATAACTTCGTAT, denoted as SEQ ID NO.47.
[0063]
[0064] (2) Construction of the pEF1α-EGFP-P2A-Puro-RA vector: Using the fetal bovine lung cell (EBL) genome as a template, RA-F1 and RA-R1 were used as the first-round primers to amplify the sequence containing the downstream homologous arm of the target site, obtaining the amplification product. Using this amplification product as a template, RA-F2 and RA-R2 were used as the second-round primers to amplify the downstream homologous arm sequence RA of the target site. The pEF1α-EGFP-P2A-Puro-T vector was then used... Spe I. The fragment was linearized and ligated to the RA fragment using a seamless cloning method. The recombinant vector with correct sequencing results was named pEF1α-EGFP-P2A-Puro-RA. Primer sequences are shown in Table 10.
[0065] Table 10 Primer List (3) pLA-3′UTR-WT-200-EF1α-EGFP-P2A-Puro-RA, pLA-3′UTR-29-200-EF1α-EGFP-P2A-Puro-RA, p Construction of LA-3′UTR-45-200-EF1α-EGFP-P2A-Puro-RA and pLA-3′UTR-70-200-EF1α-EGFP-P2A-Puro-RA vectors: Using the EBL cell genome as a template, LA-F1 and LA-R1 were used as the first-round primers to amplify sequences containing the upstream homologous arm of the target site, and LA-F2 and LA-R2 were used as the second-round primers to amplify the upstream homologous arm LA of the target site. Using psiCHECK2-3′UTR-WT as a template, and 3′UTR-F and 3′UTR-R as primers, the 3′UTR sequence 3′UTR-WT of the target sequence inserted at the WT site was amplified. Using psiCHECK2-3′UTR-29 as a template, and 3′UTR-F and 3′UTR-R as primers, the 3′UTR sequence 3′UTR-29 of the target sequence inserted at position 29 was amplified. Using psiCHECK2-3′UTR-45 as a template, and 3′UTR-F and 3′UTR-R as primers, the 3′UTR sequence 3′UTR-45 of the target sequence inserted at position 45 was amplified. Using psiCHECK2-3′UTR-70 as a template, and 3′UTR-F and 3′UTR-R as primers, the 3′UTR sequence 3′UTR-70 of the target sequence inserted at position 70 was amplified. Using EBL cell genome as a template, amplification was performed using primers 200-F and 200-R.bCoro1a The 200 bp sequence of the nucleotide tail signal; bCoro1a The 200 bp sequence of the nucleotide tail signal is: 5′-CCTCGCAGACTCTGATGACTAGTCAAGGGGATGCTGGGTATGCTGAACTGACCTGCCTTGTGCTTCCCTCTCCATAGCCTTGATGAGCCTGACCCCTGGCAAGGGGCTGGAGAGATGCCTCTAGATGACCCTAGACCAGTGGTCCCTGAGATTTTTGGCTCCAGGGACTGGTTTCATGGAAGACAATTTTTCCATAGATC-3′, denoted as SEQ ID NO.50.
[0066] Using the 3′UTR-WT and 200 bp sequences as templates, and 3′UTR-F and 200-R as primers, overlap extension PCR was performed to amplify the 3′UTR-WT-200 fragment; Using the 3′UTR-29 and 200 bp sequences as templates, and 3′UTR-F and 200-R as primers, overlap extension PCR was performed to amplify the 3′UTR-29-200 fragment; Using the 3′UTR-45 and 200 bp sequences as templates, and 3′UTR-F and 200-R as primers, overlap extension PCR was performed to amplify the 3′UTR-45-200 fragment; Using the 3′UTR-70 and 200 bp sequences as templates, and 3′UTR-F and 200-R as primers, overlap extension PCR was performed to amplify the 3′UTR-70-200 fragment; The primer sequences are shown in Table 11.
[0067] Table 11 Primer List pEF1α-EGFP-P2A-Puro-RA was used EcoRI. Linearization was performed, and the fragments were ligated with LA and the fragments via seamless cloning. The fragments were 3′UTR-WT-200, 3′UTR-29-200, 3′UTR-45-200, or 3′UTR-70-200. The recombinant vectors that were correctly sequenced after ligation were used as donor vectors and named pLA-3′UTR-WT-200-EF1α-EGFP-P2A-Puro-RA, pLA-3′UTR-29-200-EF1α-EGFP-P2A-Puro-RA, pLA-3′UTR-45-200-EF1α-EGFP-P2A-Puro-RA, and pLA-3′UTR-70-200-EF1α-EGFP-P2A-Puro-RA, respectively.
[0068] 6. Screening and identification of positive cells (1) Cell transfection: EBL cells were cultured in 6-well plates and transfected when the cell confluence reached 70% or more. One hour before transfection, the culture medium was replaced with 1.8 mL of serum-free DMEM, and 2.5 μg each of donor and target vectors were added. Endotoxin-free plasmid DNA was added to a 1.5 mL centrifuge tube containing 200 μL of Opti-MEM (Opti-MEM volume was 10% of the culture system) and mixed thoroughly. Then, 15 μL of PEI transfection reagent (plasmid mass to PEI volume ratio was 1:3) was added, mixed thoroughly, and allowed to stand at room temperature for 15 min. The mixture was then evenly added to the culture wells and incubated in an incubator. After 18-24 h, the culture medium was replaced with complete culture medium and cultured until the experimental sample collection time.
[0069] (2) Screening and identification of hybrid clones: Since the donor vector contains enhanced green fluorescent protein (EGFP) and puromycin (Puro) selection markers, positive cells were screened by observing cell fluorescence and adding the drug. 24 h after transfection, the culture medium was replaced with DMEM complete medium containing 2 μg / mL Puro. The culture medium was changed daily to remove cells that died due to unsuccessful integration. Once the cells proliferated to a confluence of over 80%, a portion of the cells was taken to extract the genome for identification of hybrid clones. bCoro1a EBL gene-edited cells were targeted for insertion at the 3′UTR site into the bta-miR-27b target sequence. The primers used for identification are shown in Table 12.
[0070] Table 12 Primer List (3) Monoclonal cell screening and identification: The above-mentioned positive mixed clonal cells were digested with trypsin and counted. The cell suspension was serially diluted to prepare a cell suspension with a cell density of 5000 cells / mL, and then diluted 100 times, 5 times and 2 times to a cell suspension of 5 cells / mL. The diluted cell suspension was seeded into 96-well plates, 100 μL per well, with the first well seeded with 100 μL of 5000 cells / mL cell suspension to find the cell field under a microscope. After 5 days, the origin of monoclonal cells was observed under a microscope, and wells containing only a single cell cluster were marked. When the clones grew to 1 / 3-1 / 2 of the bottom area of the well, the cells were digested and transferred to 48-well plates for expansion culture. The identification method was the same as in step (2).
[0071] 7. RNA extraction, reverse transcription, and real-time quantitative PCR (qPCR) (1) RNA extraction: Taking 12-well plate cells as an example, discard the culture medium, wash once with PBS, add 500 μL of TRIZOL reagent to each well, lyse at room temperature for 5 min, and transfer to enzyme-free 1.5 mL centrifuge tubes; add 100 μL of chloroform, shake vigorously for 30 s, and let stand for 5 min; incubate the lysis buffer at 4℃ for 12000 mL. ×g Centrifuge for 15 min; carefully transfer the RNA aqueous phase to a new enzyme-free 1.5 mL centrifuge tube (approximately half the volume of TRIZOL); add an equal volume of isopropanol, mix by inversion, and incubate at room temperature for 10 min. Incubate at 12000 mL / min at 4°C. ×g Centrifuge for 10 min; discard the supernatant, add 500 μL of 75% ethanol (prepared with DEPC water and anhydrous ethanol) to wash the RNA precipitate (until the precipitate floats to the surface), then centrifuge at 750 °C. ×g Centrifuge for 5 min, repeat the above steps; discard the supernatant, open the lid and allow the ethanol to evaporate completely for 10-20 min; when the RNA precipitate becomes translucent, add DEPC water according to the amount of precipitate and dissolve the RNA precipitate on ice. Determine the concentration using a NanoDrop One ultra-micro UV-Vis spectrophotometer. Store the sample in an ultra-low temperature freezer at -80℃ or directly perform reverse transcription.
[0072] (2) Reverse transcription: cDNA was prepared using the HiScript II Q RT SuperMix for qPCR (+gDNA wiper) kit. The reverse transcription system shown in Table 13 was prepared in RNase-free centrifuge tubes.
[0073] Table 13 Reverse Transcription System Gently pipette to mix thoroughly and incubate at 42°C for 2 min. Add 4 μL of 5×HiScript II qRTSuperMix II to the previous reaction solution, mix well, and incubate at 50°C for 15 min and 85°C for 15 sec in a PCR instrument. The product can be used immediately for subsequent reactions or stored at -20°C.
[0074] (3) qPCR: qPCR was performed using the ChamQ Universal SYBR qPCR Master Mix kit. The qPCR reaction system was prepared in RNase-free centrifuge tubes as shown in Table 14.
[0075] Table 14 qPCR System The reaction conditions are shown in Table 15.
[0076] Table 15 qPCR reaction conditions The melting curve was acquired using the instrument's default acquisition program. GAPDH As an internal reference gene, the template cDNA dilution factor is determined based on the Ct value of the internal reference gene detected by qPCR, and the Ct value should preferably be between 15 and 20. Each sample should be set up in triplicate, following a 2:1 ratio. −ΔΔCt Methods for data analysis. The quantitative primer sequences are as follows:
[0077] bCoro1a -F (5′-3′): CCCCTCCTCATCTCCCTCAA, denoted as SEQ ID NO.55; bCoro1a -R (5′-3′): GGACTGTCTCCTCCAGCCTA, denoted as SEQ ID NO.56; bGAPDH -F (5′-3′): GAGCGAGATCCTGCCAACAT, denoted as SEQ ID NO.57; bGAPDH -R (5′-3′): GGTTCACGCCCATCACAAAC, denoted as SEQ ID NO.58.
[0078] 8 、M.tb Intracellular proliferation assay (Colony-forming unit, CFU) 2×10 5EBL cells were seeded at 100 cells / well in 12-well cell culture plates and infected with BCG (Bacillus Calmette-Guérin) at an MOI of 20 24 h post-infection. Four hours post-infection, cells were washed three times with PBS to remove any bacteria that had not yet entered the cells. At the 4-hour time point, 1 mL of 0.1% Triton X-100 solution prepared with PBS was added to each well, and cells were lysed at room temperature for 5 min. The lysates were then transferred to 1.5 mL centrifuge tubes and centrifuged at 4500 mL / well. ×g Centrifuge for 5 min and discard the supernatant; resuspend the precipitate in 100 μL PBS and use this as the stock solution for serial dilution with PBS; spread 100 μL of the diluted suspension evenly onto 7H10 plates, repeating 3 times for each sample; incubate the plates at 37℃ for one week, count the number of colonies grown on each plate, and calculate the intracellular bacterial load based on the dilution factor. Replace the medium for the remaining cell wells with complete medium supplemented with gentamicin and continue incubation at 24 h, 48 h, and 72 h for sample collection points, and perform plate spreading as above.
[0079] result 1. bCoro1a Analysis and screening of 3′UTR insertion sites In order to determine bCoro1a To determine suitable insertion sites for the 3′UTR, this invention, based on the functional characteristics of the 3′UTR and the feasibility analysis of bioinformatics tools, established the following screening criteria: ① avoiding miRNA binding sites; ② excluding RNA-binding protein (RBP) binding regions; ③ being far from transcription factor binding sites; ④ avoiding highly conserved sequence regions. By integrating miRNA binding sites, transcription factor binding sites, and RBP binding sites predicted by bioinformatics tools such as TargetScanHuman, catRADPID, and JASPAR, and combining this with the 3′UTR conservation analysis using GeneDoc software, this invention selected sites 29, 45, and 70 as candidate insertion sites for subsequent experiments.
[0080] This invention uses the RNAfold WebServer online tool for prediction. bCoro1a Inserting target sequences at positions 29, 45, and 70 of the 3′UTR had no significant impact on the secondary structure of bCoronin-1A RNA. Further verification of the effect of bta-miR-27b on... bCoro1aThe inhibitory effect of target sequences inserted at positions 29, 45, and 70 of the 3′UTR was investigated. psiCHECK2-3′UTR-WT and reporter vectors psiCHECK2-3′UTR-29, psiCHECK2-3′UTR-45, and psiCHECK2-3′UTR-70 with target sequences inserted at the three positions were constructed. Dual-luciferase reporter assays showed that bta-miR-27b significantly inhibited the luciferase activity of reporter vectors with inserts at positions 29 and 70, but had no significant effect on the luciferase activity of reporter vectors with inserts at positions WT and 45. Figure 1 Based on the above results, sites 29 and 70 were selected as the target insertion sites for subsequent studies.
[0081] 2. bCoro1a Construction and identification of EBL monoclonal cells with target sequence inserted at the 3′UTR site This invention inserts the bta-miR-27b target sequence using CRISPR / Cas9 technology. bCoro1a The 29th and 70th sites of the 3′UTR. Targeting sites and the construction based on the homology-mediated end-joining (HMEJ) strategy. bCoro1a Gene donor vectors such as Figure 2 As shown. The selection of target sites was based on the cleavage activity assays of five screened sgRNAs. The cleavage efficiency of Cas9 nuclease at the five target sites was evaluated using an SSA reporter vector. Dual-luciferase reporter assays showed that sgRNA-1, sgRNA-3, sgRNA-6, and sgRNA-7 all exhibited high activity; therefore, target site number 1, with the highest activity, was selected for subsequent experiments. Figure 3 ).
[0082] The targeting vector and the donor vector were co-transfected into EBL cells. Since the donor sequence contained EGFP and Puro, this invention selected single-clonal cell clusters with green fluorescence by adding puromycin and using a limiting dilution method. Figure 4Furthermore, the genome of the monoclonal cell cluster was identified by junction PCR. At the 5' junction, the upstream primer LF1 was located upstream of the left homologous arm LA, and the downstream primer LR1 was located downstream of the left homologous arm LA, with a product length of approximately 1.6 kb. LF2 was located at the left homologous arm LA, and the downstream primer LR2 was located at the EF1α promoter sequence, with a product length of approximately 1.8 kb. At the 3' junction, the upstream primer RF1 was located at the right homologous arm RA, and the downstream primer RR1 was located downstream of the right homologous arm RA, with a product length of approximately 1 kb. The EGFP sequence was identified as approximately 0.8 kb. The junction PCR and EGFP sequence identification process are as follows: Figure 5 As shown. The Sanger sequencing results of the Junction PCR product are correct. Figure 5 - 6 The above results demonstrate that the present invention has successfully constructed... bCoro1a EBL gene-edited cells in which the bta-miR-27b target sequence was inserted at sites 29 and 70 of the 3′UTR were named EBL. bCoro1a 3′UTR-29 and EBL bCoro1a 3′UTR-70.
[0083] 3. Gene-edited cells EBL bCoro1a 3′UTR-29 and EBL bCoro1a 3′UTR-70 Anti [[ID=7,7]]M.tb Functional verification of infection To investigate EBL bCoro1a 3′UTR-29 and EBL bCoro1a 3′UTR-70 affects the mRNA level of bCoronin-1A and M.tb To assess the impact of intracellular survival, this invention establishes a Mycobacterium tuberculosis infection model. The mRNA level of bCoronin-1A in the cells is detected by qPCR, and the number of intracellular bacteria carried in the cells at different time points is detected by CFU.
[0084] qPCR results showed that EBL bCoro1a 3′UTR-29 and EBL bCoro1a The mRNA levels of 3′UTR-70 and bCoronin-1A were significantly lower in BCG-infected cells 24 h later than in wild-type cells. Figure 7 CFU results showed that EBL bCoro1a The intracellular bacterial load of 3′UTR-70 edited cells was significantly lower than that of wild-type cells at both 6 h and 48 h after BCG infection, while EBL... bCoro1a 3′UTR-29 edited cells showed significant differences only 6 h after infection. Figure 8 ).
[0085] The above results indicate that EBL bCoro1a Editing at positions 29 and 70 of the 3′UTR significantly reduced bCoronin-1A mRNA levels and effectively inhibited [the growth of the bCoronin-1A mRNA]. M.tb Intracellular survival was observed, with cells edited at 70 sites exhibiting more stable anti-infection capabilities.
[0086] In summary, this invention establishes a method based on the insertion of the bta-miR-27b target sequence into the 3′UTR to downregulate bCoronin-1A expression and thus enhance EBL cell resistance. M.tb Feasible strategies for assessing infectivity provide a theoretical basis and technical support for developing tuberculosis-resistant breeding programs for dairy cows.
[0087] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.
[0088] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the invention.
[0089] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. A recombinant vector, characterized in that, The recombinant vector consists of an upstream homologous arm of the target site, a 3′ UTR into which the target sequence is inserted, and... bCoro1a The nucleotide tailing signal consists of 200 bp, selection markers, and downstream homologous arms of the target site; The target site is bCoro1a The 29th or 70th position of the 3′UTR of the gene; The bCoro1a The sequence of the 3′UTR of the gene is shown in SEQ ID NO.48; The screening markers include enhanced green fluorescent protein and puromycin.
2. The recombinant vector according to claim 1, characterized in that, The target sequence is the target sequence of bta-miR-27b.
3. The recombinant vector according to claim 1, characterized in that, The sequence of the screening marker is shown in SEQ ID NO.
49.
4. The method for constructing the recombinant vector according to claim 1, characterized in that, Includes the following steps: The screening marker was ligated to the T-Vector pMD19 vector to obtain pEF1α-EGFP-P2A-Puro-T; pEF1α-EGFP-P2A-Puro-T was linearized and ligated to the downstream homologous arm of the target site to obtain pEF1α-EGFP-P2A-Puro-RA. Using the EBL cell genome as a template, the upstream homologous arm of the target site was amplified; Using psiCHECK2-3′UTR-WT as a template, the 3′UTR of the inserted target sequence was amplified, and the 3′UTR of the inserted target sequence and bCoro1a The 200 bp of the nucleotide tailing signal is used as a template to amplify the amplification product; The recombinant vector is obtained by ligating the pEF1α-EGFP-P2A-Puro-RA, the upstream homologous arm, and the amplification product.
5. The construction method according to claim 4, characterized in that, The primers used to amplify the upstream homologous arm of the target site are shown in SEQ ID NO.26~SEQ ID NO.29, and the primers used to amplify the 3′UTR of the inserted target sequence are shown in SEQ ID NO.34~SEQ ID NO.
35.
6. The construction method according to claim 4, characterized in that, The primers used to obtain the amplification products are shown in SEQ ID NO.34 and SEQ ID NO.
37.
7. The construction method according to claim 4, characterized in that, The target sequence is the bta-miR-27b sequence.
8. An anti-infection system, characterized in that, Includes the targeting vector and the recombinant vector as described in claim 1; The targeting vector is obtained by linking sgRNA and pSpCas9(BB)-2A-Puro(PX459) vector, and the sequence of the sgRNA is shown in SEQ ID NO.8~9, SEQ ID NO.10~11, SEQ ID NO.14~15 or SEQ ID NO.16~17.
9. The application of the anti-infection system according to claim 8 in the treatment of Mycobacterium tuberculosis infection.
10. The use of the anti-infection system of claim 8 in the preparation of a medicament for treating bovine tuberculosis.