Application of circZNF148 as therapeutic target and prognostic marker of triple negative breast cancer
By identifying circZNF148 circular RNA as a therapeutic target and prognostic biomarker for triple-negative breast cancer, and using RT-PCR detection and inhibitor therapy for triple-negative breast cancer, the treatment challenges of triple-negative breast cancer have been solved, and patient survival rates and the accuracy of prognosis have been improved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANDONG UNIV QILU HOSPITAL
- Filing Date
- 2026-01-27
- Publication Date
- 2026-04-17
AI Technical Summary
Triple-negative breast cancer is highly heterogeneous, prone to early recurrence, has a high tendency to metastasize, and is prone to developing resistance to conventional chemotherapy. Existing treatment strategies are limited, and its metabolic abnormalities lead to poor prognosis. There is an urgent need for new therapeutic targets and prognostic biomarkers.
circZNF148 circular RNA was screened and identified as a potential therapeutic target. Its expression level was detected by RT-PCR. A circZNF148 inhibitor was developed for the treatment of triple-negative breast cancer and used as a prognostic biomarker for diagnosis and prediction.
circZNF148 inhibitors can suppress the proliferation, migration and invasion of triple-negative breast cancer cells, reduce glycolytic activity, and improve patient survival. The expression level of circZNF148 can predict patient prognosis and provide effective treatment and diagnostic methods.
Smart Images

Figure CN121874347A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology and relates to the application of circZNF148 as a therapeutic target and prognostic biomarker for triple-negative breast cancer. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] Breast cancer is the most common malignant tumor among women worldwide, with persistently high morbidity and mortality rates, making it a major public health issue. Triple-negative breast cancer (TNC) is a highly aggressive and difficult-to-treat subtype of breast cancer, characterized by the lack of expression of estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 (HGF-2). This subtype is characterized by high heterogeneity, early recurrence, high metastatic tendency, and resistance to conventional chemotherapy, resulting in limited treatment options and generally poor prognosis. Although systemic treatment strategies have made progress in recent years, the survival rate of patients with metastatic TNC remains unsatisfactory, necessitating in-depth exploration of its molecular mechanisms of development and the development of new effective therapeutic targets. Another significant feature of TNC is its metabolic abnormalities, primarily manifested as upregulation of key glycolytic enzymes and a significantly enhanced glycolytic flux. This enhanced glycolytic activity not only provides energy and biosynthetic precursors for the rapid proliferation and metastasis of tumor cells but also participates in shaping the immunosuppressive tumor microenvironment, further promoting tumor progression.
[0004] Circular RNAs (RNAs) are a class of endogenous non-coding RNA molecules widely distributed in eukaryotic cells. They possess a covalently closed circular structure, resisting degradation by exonucleases and thus exhibiting high stability in vivo. Studies have confirmed that RNAs participate in the regulation of various biological processes and play an important role in disease development. Recent findings have revealed that some RNAs exhibit abnormal expression under pathological conditions such as metabolic stress, and are closely related to tumor progression and treatment resistance. However, the specific regulatory mechanisms of RNAs in the glycolytic metabolic reprogramming of triple-negative breast cancer remain to be elucidated. Summary of the Invention
[0005] This invention screened and identified a novel circular RNA, circZNF148, associated with enhanced glycolysis and lung metastasis potential. The nucleic acid sequence of this circular RNA is shown in SEQ ID NO:1. Its circularized nucleotide sequence contains 475 bases. The role of circZNF148 in the development and progression of triple-negative breast cancer is currently unclear. In vitro experiments showed that interfering with circZNF148 expression inhibits the proliferation, migration, and invasion of triple-negative breast cancer cells and promotes apoptosis. In vivo experiments demonstrated that circZNF148 significantly promotes tumor proliferation and metastasis in triple-negative breast cancer. Furthermore, this study also showed that circZNF148 enhances glycolytic metabolism in triple-negative breast cancer. Therefore, circZNF148 plays a crucial role in the proliferation and metastasis of triple-negative breast cancer and can serve as a potential diagnostic and pharmacological target for the treatment of triple-negative breast cancer. This invention uses qRT-PCR to detect the differential expression of circZNF148 in primary breast cancer tissue and adjacent normal breast tissue. The results showed that circZNF148 expression in breast cancer tissue was significantly higher than in adjacent normal tissue, indicating that circZNF148 can be used for the diagnosis of triple-negative breast cancer. Finally, analysis of the association between circZNF148 expression levels and clinicopathological characteristics of 238 patients with triple-negative breast cancer showed that circZNF148 can serve as an independent prognostic biomarker for breast cancer, thereby predicting tumor progression and poor survival outcomes in patients with triple-negative breast cancer.
[0006] Based on the above research findings, the purpose of this invention is to provide the application of circZNF148 as a therapeutic target and prognostic biomarker for triple-negative breast cancer.
[0007] To achieve the above objectives, the present invention provides the following technical solution:
[0008] In the first aspect, the use of a substance for detecting circZNF148 or its expression level in the preparation of products for diagnosing, detecting, monitoring, or predicting the progression of triple-negative breast cancer.
[0009] The nucleic acid sequence of circZNF148 described in this invention is shown in SEQ ID NO:1.
[0010] In some embodiments, the substance used to detect circZNF148 or its expression level is a substance detected using RT-PCR technology. Specifically, it includes a primer pair for detecting circZNF148. More specifically, the nucleic acid sequences of the primer pair are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively.
[0011] Specifically, it also includes at least one of RNA extraction reagents, reverse transcription reagents, and RT-PCR amplification reagents.
[0012] In some implementations, the product is a test kit.
[0013] This invention also provides a diagnostic method for triple-negative breast cancer, comprising detecting the expression level of circZNF148 in a patient's tumor tissue using the product described in the first aspect of this invention. The method further includes detecting the expression level of circZNF148 in adjacent normal tissue. If the expression level of circZNF148 in the tumor tissue is significantly higher than that in the adjacent normal tissue, the risk of colorectal cancer is higher.
[0014] Secondly, the application of circZNF148 as a therapeutic target for triple-negative breast cancer in the screening of drugs for the prevention and / or treatment of triple-negative breast cancer.
[0015] Specifically, the method for screening drugs for the prevention and treatment of triple-negative breast cancer includes detecting the expression level of circZNF148 in tumor tissues of cell models or animal models using the products used in the first aspect of this invention. Drugs that significantly reduce the expression level of circZNF148 after administration have potential effects in preventing and treating colorectal cancer.
[0016] Thirdly, the use of an inhibitor of circZNF148 in the preparation of drugs for the prevention and / or treatment of triple-negative breast cancer.
[0017] The drug described in this invention has the effects of inhibiting the proliferation of triple-negative breast cancer cells, inhibiting the migration and invasion of triple-negative breast cancer cells, and inhibiting glycolysis.
[0018] The inhibitors of circZNF148 described in this invention include, but are not limited to, eukaryotic expression plasmids, adenoviruses, adeno-associated viruses, lentiviruses, retroviruses, gene editing system elements, homologous recombination vectors, ASO, ASO modifiers, ASO conjugates, small molecule inhibitors, and siRNA. In some embodiments, the inhibitor of circZNF148 is siRNA. Specifically, the sense and antisense sequences of the siRNA are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively.
[0019] In some embodiments, the drug is a composition comprising pharmaceutical excipients. Specifically, the pharmaceutical excipients include, but are not limited to, binders, fillers, disintegrants, wetting agents, lubricants, stabilizers, pH adjusters, etc.
[0020] In some embodiments, the dosage form of the drug is tablets, capsules, granules, solutions, suspensions, or injections.
[0021] The present invention also provides a method for treating triple-negative breast cancer, which involves administering the drug used in the third aspect of the present invention.
[0022] This invention demonstrates that the expression level of circZNF148 in triple-negative breast cancer tissues differs significantly from that in adjacent normal tissues. It provides diagnostic reagents and drug screening methods for triple-negative breast cancer using circZNF148 as a biomarker. This invention verifies the inhibitory effect of circZNF148 on the proliferation and migration of triple-negative breast cancer cells through functional experiments and animal experiments. It also provides the application of circZNF148 inhibitors as therapeutic drugs for triple-negative breast cancer. Attached Figure Description
[0023] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0024] Figure 1 Figure 1 shows the experimental results of circZNF148 promoting the progression and metastasis of triple-negative breast cancer in an embodiment of the present invention. Figure 2 shows the results of EdU experiment showing the inhibition of triple-negative breast cancer cell proliferation by interfering with circZNF148 expression. Figure 3 shows the results of flow cytometry detection showing that low expression of circZNF148 promotes apoptosis of triple-negative breast cancer cells. Figures 4 and 5 show the results of overexpression of circZNF148 enhancing cell proliferation and reducing apoptosis, respectively. Figures 6 and 7 show the results of scratch assay and transwell assay showing that interfering with circZNF148 expression inhibits the in vitro migration and invasion of triple-negative breast cancer cells, respectively. Figures 8 and 9 show the results of overexpression of circZNF148 improving the in vitro migration and invasion of triple-negative breast cancer cells, respectively. Figure 10 shows the results of nude mouse tumor-bearing experiment showing that circZNF148 promotes tumor proliferation. Figure 11 shows the results of tail vein injection lung metastasis model confirming that circZNF148 enhances the metastatic ability of tumor cells.
[0025] Figure 2 Figure A shows the experimental results of circZNF148 promoting glycolysis in triple-negative breast cancer in an embodiment of the present invention. Figure A shows the results of the extracellular acidification rate (ECAR) test analysis of glycolysis stress test, showing the effect of knockdown or overexpression of circZNF148 on glycolysis flux. Figures B, C, and D show the results of the detection of intracellular lactate, adenosine triphosphate (ATP), and glucose-6-phosphate (G6P) levels, showing the effect of knockdown or overexpression of circZNF148 on the levels of key glycolysis products.
[0026] Figure 3 Figure A shows the experimental results of circZNF148 as a prognostic biomarker for triple-negative breast cancer patients in this embodiment of the invention. Figure B shows the results of qRT-PCR detection of circZNF148 expression levels in paired primary breast cancer tissues and adjacent normal breast tissues. Figure C shows the results of in situ hybridization (ISH) showing the localization and expression intensity of circZNF148 in tumor tissues and normal tissues. Figure D shows the results of receiver operating characteristic (ROC) curve analysis to determine the circZNF148 expression cutoff value and Kaplan-Meier survival curves comparing the overall survival of patients with high and low circZNF148 expression. Figure D shows the results of Kaplan-Meier survival curves in the triple-negative breast cancer subgroup showing the association between circZNF148 expression and patient prognosis. Detailed Implementation
[0027] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0028] The test materials used in the embodiments of the present invention are all commercially available products that can be purchased on the market.
[0029] The technologies involved in the embodiments of the present invention are conventional molecular cloning techniques. Unless otherwise specified, the reagents and reaction conditions involved can be reasonably selected based on the experience of those skilled in the art. The reagents and consumables involved are common commercially available products, and the detection methods and instruments involved are well known and skillfully mastered by those skilled in the art.
[0030] Example Experimental methods 1. Cell proliferation assay: The EdU proliferation assay kit (Raybot Biotech, China) was used for assay. Transfected cells were sputtered at a rate of 1×10⁶ cells / year. 4 Cells were seeded per well in 96-well plates and cultured for 48 hours. Then, 50 μM EdU was added and the cells were incubated for another 2 hours. The cells were then fixed with 4% paraformaldehyde, stained with Apollo dye, and the nuclei were stained with Hoechst. Finally, the cells were imaged and observed using a ZEISS microscope.
[0031] 2. Flow cytometry analysis of apoptosis: Apoptosis was analyzed using the Annexin V Apoptosis Detection Kit I (BD Pharmingen). Transfected cells were washed twice with PBS, resuspended in 1× binding buffer, and stained with PE-labeled Annexin V and 7-AAD for 1 hour in the dark, followed by flow cytometry analysis.
[0032] 3. RNA Extraction and Quantitative Real-Time PCR (qRT-PCR): Total RNA was extracted from cells or tissues using RNA-easy separation reagent (Novozymes, China). RNA purity and concentration were detected using NanoDrop 2000 (Thermo Fisher, USA). cDNA was synthesized using the PrimeScript reverse transcription kit (Takara, Japan). qRT-PCR analysis was performed using SYBR Premix Ex Taq II (Takara) on a Light Cycler 480 II real-time quantitative PCR system (Roche, Switzerland), with β-actin as an internal control gene.
[0033] 4. Cell Scratch Assay: Cells were cultured in 24-well plates to 90% confluence. Using the tip of a 10 μL sterile pipette, scratches were made on the monolayer of cells. After rinsing with PBS, the cells were replaced with serum-free medium and cultured further. Images were taken under an optical microscope at 0 and 48 hours to analyze cell migration ability.
[0034] 5. Transwell migration and invasion experiments: For the migration experiment, (6~8)×10 4 Cells resuspended in serum-free DMEM were seeded into the upper chamber of a Transwell (8 μm pore size, Corning, USA), and the lower chamber was filled with medium containing 20% FBS. For invasion assays, the upper chamber was pre-coated with Matrigel (BD Biosciences, USA). After culturing for 24–48 hours, cells that had migrated or invaded the lower chamber were fixed with methanol, stained with crystal violet, and counted under a light microscope.
[0035] 6. Glycolytic stress assay: The extracellular acidification rate was detected using the Seahorse XF glycolytic stress assay kit. Transfected cells were seeded in XF 96-well plates and cultured overnight. The medium was then replaced with XF basal medium (Agilent) and incubated for 1 hour. Glucose (10 mM), oligomycin (1 μM), and 2-deoxyglucose (50 mM) were added sequentially. Cellular glycolytic function was monitored in real time using a Seahorse XFe96 analyzer.
[0036] 7. Immunohistochemical experiments: Antigen retrieval was performed using 10 mM sodium citrate buffer (pH 6.0). Pathological sections were incubated overnight with the primary antibody at 4°C, followed by incubation with the secondary antibody according to the IHC kit (PV 9000, ZSGB-BIO) instructions. Staining was performed using diaminobenzidine (DAB) (ZLI-9018, ZSGB-BIO), followed by hematoxylin counterstaining. The staining intensity was semi-quantitatively assessed independently by two pathologists.
[0037] 8. Patient Samples: The tissue specimens used in this study were obtained from cancer patients who underwent surgical resection and were histologically confirmed at Qilu Hospital of Shandong University. All participants signed written informed consent forms and completed comprehensive follow-up records. The study followed the principles of the Declaration of Helsinki and was approved by the Research Ethics Committee of Qilu Hospital of Shandong University. The resected specimens were histopathologically verified by certified surgical pathologists using a triple-blinding method, and immediately frozen at -80°C after confirmation.
[0038] 9. Statistical Analysis: All experiments were independently repeated at least three times. Statistical analysis was performed using GraphPad Prism 10.1.2 and IBM SPSS 25.0 software. Two-tailed t-tests were used for intergroup comparisons, and Kaplan-Meier and time series tests were used for survival analysis. Cox proportional hazards models were used for univariate and multivariate prognostic analyses. Experimental results are expressed as mean ± standard error (SEM) of three independent experiments, and p < 0.05 was considered statistically significant.
[0039] The nucleic acid sequence of circZNF148 is as follows: GCAGTTATACTTAAGCATGAACATTGACGACAAACTGGAAGGATTGTTTCTTAAATGTGGCCGGCATAGACGAAATGCAGTCTTCCAGGACAATGGTTGTAATGGGTGGAGTGTCTGGCCAGTCTACTGTGTCTGGAGAGCTACAGGATTCAGTACTTCAAGATCGAAGTATGCCTCACCAGGAGATCCTTGCTGCAGATGAAGTGTTACAAGAAAGTGAAATGAGACAACAGGATATGAT ATCACATGATGAACTCATGGTCCATGAGGAGACAGTGAAAAATGATGAAGAGCAGATGGAAACACATGAAAGACTTCCTCAAGGACTACAGTATGCACTTAATGTCCCTATAAGCGTAAAGCAGGAAATTACTTTTACTGATGTATCTGAGCAACTGATGAGAGACAAAAAACAAATCAGAGAGCCAGTAGACTTACAGAAAAAGAAGAAGCGGAAACAACGTTCTCCCGCAAAA, as in SEQ ID NO:1 is shown.
[0040] Research Results 1. circZNF148 promotes the progression and metastasis of triple-negative breast cancer. This embodiment screened and identified a novel circular RNA—circZNF148—associated with enhanced glycolysis and lung metastasis potential. Specifically, to identify circular RNAs associated with both enhanced glycolysis and lung metastasis potential, this embodiment performed comparative expression analysis based on two experimental models. First, in two glucose-free cell lines, we analyzed the expression profiles of circular RNAs relative to their normal controls. Circular RNAs with an average expression level greater than 5 and a fold change greater than 4 were considered significantly upregulated, resulting in 40 candidate circular RNAs. Simultaneously, in the lung metastasis model, we analyzed the expression of circular RNAs by comparing highly metastatic cells with their parental cells, and identified 614 upregulated circular RNAs using the same criteria. Taking the intersection of these two datasets revealed three commonly upregulated circular RNAs. Among them, circZNF148 was selected for subsequent research because it showed the most significant upregulation in both the enhanced glycolysis and metastasis-prone cell models, and this was verified by qRT-PCR and FISH experiments.
[0041] To elucidate the biological function of circZNF148 in triple-negative breast cancer, this embodiment validated it through a series of techniques, including in vitro cell experiments. circZNF148-specific siRNA (si-circZNF148 sequence: Sense(5'-3'): GCAAAAGCAGUUAUACUUA, as shown in SEQ ID NO:2; Antisense(5'-3'): UAAGUAUAACUGCUUUUGC, as shown in SEQ ID NO:3) and overexpression plasmids were used to effectively knock out or overexpress circZNF148 in vitro. EdU experiments showed that interfering with circZNF148 expression could inhibit the proliferation of triple-negative breast cancer cells in vitro. Figure 1 As shown in A in the figure. Flow cytometry experiments revealed that low expression of circZNF148 promotes apoptosis in triple-negative breast cancer cells, such as... Figure 1 As shown in B. Conversely, overexpression of circZNF148 in triple-negative breast cancer cell lines resulted in enhanced cell proliferation and reduced apoptosis, as shown in Figure B. Figure 1 As shown in C and D in the figure. Subsequently, in vitro experiments were conducted to investigate the effect of circZNF148 on the migration and invasion abilities of triple-negative breast cancer cells: scratch assays and transwell assays showed that interfering with circZNF148 expression inhibited the migration and invasion abilities of triple-negative breast cancer cells in vitro, such as... Figure 1 As shown in E and F; conversely, overexpression of circZNF148 enhances the migration and invasion ability of triple-negative breast cancer cells in vitro, such as Figure 1As shown in G and H. In vivo experiments further confirmed the function of circZNF148: results from nude mouse tumor-bearing experiments showed that circZNF148 significantly promoted tumor proliferation, such as... Figure 1 As shown in Figure I; a tail vein injection lung metastasis model confirmed that circZNF148 can significantly enhance the metastatic ability of tumor cells, such as Figure 1 As shown in J in the figure. In summary, circZNF148 can promote the progression and metastasis of triple-negative breast cancer.
[0042] 2. circZNF148 promotes glycolysis in triple-negative breast cancer. This study evaluated the key role of circZNF148 in regulating glycolysis in triple-negative breast cancer. Analysis of extracellular acidification rate (ECAR) using a glycolytic stress assay revealed that knockdown of circZNF148 significantly reduced glycolytic flux in triple-negative breast cancer, while overexpression of circZNF148 significantly increased glycolytic flux. Figure 2 As shown in A in the figure. Meanwhile, analysis of key glycolysis products revealed that knockdown of circZNF148 significantly reduced intracellular levels of lactate, adenosine triphosphate (ATP), and glucose-6-phosphate (G6P), demonstrating that knockdown of circZNF148 inhibits glycolysis; while overexpression of circZNF148 significantly increased the levels of key glycolysis products, such as... Figure 2 As shown in B, C, and D, circZNF148 promotes glycolysis. In summary, the experiment confirms that circZNF148 enhances glycolytic metabolism in triple-negative breast cancer.
[0043] 3. Evaluation of the potential of circZNF148 as a prognostic biomarker for patients with triple-negative breast cancer To evaluate the clinical significance of circZNF148 in breast cancer, qRT-PCR was first used to detect the expression level of circZNF148 (circZNF148 primer sequences: Forward (5'-3'): GAAGAAGCGGAAACAACG, as shown in SEQ ID NO:4; Reverse (5'-3'): TCCACCCATTACAACCAT, as shown in SEQ ID NO:5) in paired primary breast cancer tissues and adjacent normal breast tissues. The results showed that compared with normal tissues, circZNF148 expression was significantly upregulated in tumor tissues, such as... Figure 3 As shown in A in the figure. Further verification using in situ hybridization (ISH) revealed that the ISH signal of circZNF148 was mainly localized in the cytoplasm, and its intensity was significantly higher in the tumor region than in the adjacent histologically normal epithelial region, such as... Figure 3As shown in Figure B, this confirms tumor-specific overexpression of circZNF148. Subsequently, the association between circZNF148 expression levels and clinicopathological characteristics of 238 breast cancer patients was analyzed. To establish clinically meaningful stratification thresholds, receiver operating characteristic (ROC) curve analysis was performed based on overall patient survival to determine the optimal circZNF148 expression cutoff value that balances sensitivity and specificity, as shown in Figure B. Figure 3 As shown in C in the table. Based on this cutoff value, the patient cohort was divided into a circZNF148 high-expression group and a low-expression group. High circZNF148 expression was associated with distant metastasis (P<0.05), as shown in Table 1. Survival analysis was performed using the Kaplan-Meier method, and survival curves were plotted. The results showed that the overall survival of the circZNF148 high-expression group was significantly shorter than that of the low-expression group, as shown in Table 1. Figure 3 As shown in C (log-rank test, P = 0.0024). This association remained significant in the triple-negative breast cancer (TNBC) subgroup analysis, meaning that within this subgroup, elevated circZNF148 expression was also significantly associated with poorer patient prognosis, as shown in Figure C. Figure 3 As shown in D in the table (log-rank test, P = 0.0028). Furthermore, univariate and multivariate Cox proportional hazards regression analyses confirmed that high expression of circZNF148 was an independent predictor of poor prognosis in breast cancer patients (hazard ratio HR = 1.226, 95% confidence interval CI: 1.030–1.459, P = 0.022), as shown in Table 2. In conclusion, circZNF148 can serve as an independent prognostic biomarker for breast cancer, and its high expression is significantly associated with tumor progression and poor survival outcomes.
[0044] Table 1. Correlation between circZNF148 expression level and clinicopathological features in breast cancer patients.
[0045] Table 2. Univariate and multivariate Cox regression analyses of overall survival
[0046] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. The use of a substance for detecting circZNF148 or its expression level in the preparation of products for diagnosing, detecting, monitoring or predicting the progression of triple-negative breast cancer, wherein the nucleic acid sequence of said circZNF148 is shown in SEQ ID NO:
1.
2. The application as described in claim 1, characterized in that, The substance used to detect circZNF148 or its expression level is a substance detected using RT-PCR technology.
3. The application as described in claim 2, characterized in that, It includes a primer pair for detecting circZNF148; preferably, the nucleic acid sequences of the primer pair are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively; Alternatively, it may also include at least one of RNA extraction reagents, reverse transcription reagents, and RT-PCR amplification reagents.
4. The application as described in claim 2, characterized in that, The product in question is a test kit.
5. The use of circZNF148 as a therapeutic target for triple-negative breast cancer in screening drugs for the prevention and / or treatment of triple-negative breast cancer, wherein the nucleic acid sequence of circZNF148 is shown in SEQ ID NO:
1.
6. The application as described in claim 5, characterized in that, The drug that detects the expression level of circZNF148 in cell models or animal model tumor tissues using the product described in claim 1, and whose expression level of circZNF148 is significantly reduced after administration, has the potential to prevent and treat colorectal cancer.
7. The use of an inhibitor of circZNF148 in the preparation of a medicament for the prevention and / or treatment of triple-negative breast cancer, wherein the nucleic acid sequence of circZNF148 is shown in SEQ ID NO:
1.
8. The application as described in claim 7, characterized in that, The drug has the effects of inhibiting the proliferation of triple-negative breast cancer cells, inhibiting the migration and invasion of triple-negative breast cancer cells, and inhibiting glycolysis.
9. The application as described in claim 7, characterized in that, The inhibitor of circZNF148 is siRNA; preferably, the sense sequence and antisense sequence of the siRNA are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively.
10. The application as described in claim 7, characterized in that, The drug is a composition, and the composition includes pharmaceutical excipients; Alternatively, the dosage form of the drug may be tablets, capsules, granules, solutions, suspensions, or injections.