Compositions and methods for modulating ATXN2 expression

By designing antisense oligonucleotides of specific length and sequence to hybridize with ATXN2 transcripts, their splicing and expression are regulated, overcoming the shortcomings of existing technologies in the treatment of ATXN2-related diseases, and achieving the effect of significantly reducing ATXN2 protein expression and improving the symptoms of related diseases.

CN121889504APending Publication Date: 2026-04-17瑞博威治疗公司
View PDF 18 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
瑞博威治疗公司
Filing Date
2024-05-17
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

Existing technologies have not yet effectively addressed the treatment needs of ataxin-2 (ATXN2)-related neurodegenerative diseases such as spinocerebellar ataxia type 2 (SCA2) and amyotrophic lateral sclerosis (ALS), especially the methods for regulating ATXN2 expression through antisense oligonucleotides (ASO) still have room for improvement.

Method used

Designing and using antisense oligonucleotides (ASOs) of specific lengths and sequences to hybridize with target regions in the ATXN2 transcript, regulating ATXN2 splicing and expression via the nonsense-mediated decay (NMD) pathway, including combinations of modified nucleotides and multiple ASO sequences, for the development of pharmaceutical compositions.

Benefits of technology

Significantly reduces ATXN2 protein expression, improves related disease symptoms such as improved motor function, reduces the amount of ATXN2-encoded protein in cells, and provides therapeutic effects for diseases such as SCA2 and ALS.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121889504A_ABST
    Figure CN121889504A_ABST
Patent Text Reader

Abstract

The present disclosure provides antisense oligonucleotides that hybridize to a target region in the ATXN2 RNA transcript, wherein hybridization of the antisense oligonucleotides to the target region alters (e.g., reduces) expression in a cell of a functional protein encoded by the ATXN2 RNA transcript. The disclosure also provides antisense oligonucleotides, pharmaceutical compositions, and methods for treating, preventing, or ameliorating diseases, disorders, and conditions associated with ATXN2 in a subject in need thereof.
Need to check novelty before this filing date? Find Prior Art

Description

Cross-reference to related applications

[0001] This application claims priority to U.S. Provisional Application No. 63 / 503,163, filed May 19, 2023, the entire contents of which are incorporated herein by reference for all purposes.

[0002] sequence list This application is submitted together with an electronic sequence list. The sequence list is provided as a file named 044369-00007_ST26.xml, created on May 17, 2024, and is 300KB in size. The information in the electronic sequence list is incorporated herein by reference in its entirety. Background Technology

[0003] Newly synthesized eukaryotic mRNA molecules, called primary transcripts or precursor mRNA, undergo processing before translation. During precursor mRNA processing, a 5' methylation cap and a poly(A) tail of approximately 200-250 bases are added to the 3' end of the transcript. Processing from precursor mRNA to mRNA often involves precursor mRNA splicing; 90%-95% of mammalian mRNA undergoes splicing during maturation. Introns (or interfering sequences) are regions in the precursor mRNA (or its coding DNA) that are not present in the coding sequence of the mature mRNA. Exons are primary transcript regions retained in mature mRNA. The mature mRNA sequence is formed by splicing exons. Splice joints are also called splice sites; the 5' side is called the "5' splice site" or "splicing donor site," and the 3' side is called the "3' splice site" or "splicing acceptor site." During splicing, the 3' end of the upstream exon connects to the 5' end of the downstream exon. Therefore, unspliced ​​precursor mRNA has an exon / intron adapter at the 5' end of the intron and an intron / exon adapter at the 3' end of the intron. In mature mRNA, exons are continuous after the removal of introns, at what are sometimes called exon / exon adapters or boundaries. Alternative splicing, defined as the splicing of various combinations of exons, often results in the production of multiple mRNA transcripts from a single gene.

[0004] Antisense technology is an efficient way to regulate the expression of one or more specific gene products, including alternative splicing products, and plays a unique role in many therapeutic, diagnostic, and research applications. The principle behind antisense technology is that antisense oligonucleotides hybridize with target nucleic acids and regulate gene expression activities, such as transcription, splicing, or translation, through one of a series of RNA regulatory mechanisms, such as the nonsense-mediated decay (“NMD”) pathway. NMD is an evolutionarily conserved RNA surveillance system that was initially thought to selectively mitigate the harmful effects of premature stop codons (such as those caused by point mutations).

[0005] Ataxin-2 (“ATXN2”) is an RNA-binding protein encoded by a gene located on human chromosome 12q24.12. This gene encodes several mRNA transcript variants (e.g., NCBI accession numbers NM_002973.4, NM_001310121.1, NM_001310123.1, and NM_001372574.1) and multiple protein isoforms (e.g., NCBI accession numbers NP_002964.4, NP_001297050.1, NP_001297052.1, and NP_001359503.1). ATXN2 is a regulator of stress granule assembly and is involved in the pathogenesis of neurodegenerative diseases. Expansion of polyglutamine (“CAG”) with repeats greater than 34 in ATXN2 protein isoforms is a pathogenic factor in spinocerebellar ataxia type 2 (“SCA2”) disease. Currently, intermediate extensions that do not reach the SCA2 threshold are considered a risk factor for amyotrophic lateral sclerosis (ALS), and ATXN2 has been shown to be a regulator of TDP43 toxicity in yeast, fly, and ALS mouse models. Despite ongoing efforts by researchers and medical experts worldwide to address ATXN2-related genetic diseases, a safe and effective treatment for such diseases remains urgently needed. Summary of the Invention

[0006] This disclosure provides antisense oligonucleotide (“ASO”) constructs that can be used to regulate ATXN2 expression (e.g., using the NMD pathway), as well as related compositions and methods.

[0007] In a first general aspect, this disclosure provides a method for... Antisense oligonucleotides that hybridize to the target region in transcripts, where hybridization with the target region alters (e.g., reduces) the amount of... Expression of functional proteins encoded by transcripts in cells.

[0008] In some respects, Transcripts are precursor mRNA molecules.

[0009] In some respects, the antisense oligonucleotide has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, or a length within the range of endpoints defined by any pair of the above length values. For example, in some respects, the antisense oligonucleotide has a length of 15 to 25 nucleotides, or a length of 18 to 20 nucleotides.

[0010] In some respects, the target region is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long. In some respects, the antisense oligonucleotide is the same length as the target region; in others, the antisense oligonucleotide is longer than the target region.

[0011] In some aspects, the antisense oligonucleotide comprises a nucleotide sequence of any one of the sequences in SEQ ID NO: 10-137. In some aspects, the antisense oligonucleotide comprises a nucleotide sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide substitutions compared to any one of the sequences in SEQ ID NO: 10-137. In some aspects, the antisense oligonucleotide comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to any one of the sequences in SEQ ID NO: 10-137.

[0012] In some aspects, the antisense oligonucleotide comprises a nucleotide sequence identical to the consecutive 18-22-mer portions of any sequence in SEQ ID NO: 10-12. In some aspects, the antisense oligonucleotide comprises a sequence of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide substitutions compared to any sequence in SEQ ID NO: 10-12 or its aligned portions. In some aspects, the antisense oligonucleotide comprises a nucleotide sequence identical to any consecutive 18-22-mer portions of SEQ ID NO: 10-12 having 1, 2, 3, 4, or 5 nucleotide substitutions.

[0013] In some aspects, the antisense oligonucleotide comprises a nucleotide sequence identical to the consecutive 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19, 20-mer portions of any sequence in SEQ ID NO: 13-137. In some aspects, the antisense oligonucleotide comprises a sequence of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide substitutions compared to any sequence in SEQ ID NO: 13-137 or its aligned portions. In some respects, the antisense oligonucleotide comprises a nucleotide sequence identical to any consecutive 15, 16, 17, 18, 19, or 20-mer partial sequence of SEQ ID NO: 13-137, having 1, 2, 3, 4, or 5 nucleotide substitutions. The foregoing also considers insertions or deletions in any antisense oligonucleotide that are identical or substantially similar to any consecutive 15-20-mer partial sequence of SEQ ID NO: 13-137, having 1, 2, 3, 4, or 5 nucleotide substitutions.

[0014] In some respects, antisense oligonucleotides include one or more modified nucleotides.

[0015] In some respects, one or more modified nucleotides include modifications to ribose, phosphate, nucleobases, or combinations thereof.

[0016] In some respects, ribosyl modifications include 2'-O-methyl, 2'-fluorine, 2'-deoxy, 2'-O-(2-methoxyethyl) (“MOE”), 2'-O-alkyl, 2'-O-alkoxy, 2'-O-alkylamino, 2'-NH2, restricted nucleotides, or combinations thereof. In some respects, restricted nucleotides include locked nucleic acids (LNA), ethyl restricted nucleotides, 2'-(S)-restricted ethyl (“S-cEt”) nucleotides, restricted MOE, 2'-O,4'-C-aminomethylene-bridged nucleic acids (2',4'-BNANC), α-L-locked nucleic acids, tricyclic DNA, or combinations thereof.

[0017] In some respects, modifications of the phosphate group include thiophosphate, phosphonoacetate (“PACE”), thiophosphonoacetate (“thioPACE”), amide, triazole, phosphonate, phosphate triester modification, or combinations thereof.

[0018] In some respects, nucleobase modifications include 2-thiouridine, 4-thiouridine, N6-methyladenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5-methylcytosine, 5-substituted pyrimidine, isoguanine, isocytosine, one or more halogenated aromatic groups or combinations thereof.

[0019] In a second general aspect, this disclosure provides a pharmaceutical composition comprising at least one antisense oligonucleotide selected from the antisense oligonucleotides of any one of claims 1-16, and at least one pharmaceutically acceptable carrier, diluent, or buffer.

[0020] In some aspects, at least one antisense oligonucleotide comprises a plurality of antisense oligonucleotides with different sequences (e.g., a pharmaceutical composition may comprise a mixture of any ASO sequences disclosed herein). In some aspects, a pharmaceutical composition may comprise 2, 3, 4, 5, 6 or more different ATXN2 ASO sequences.

[0021] In some aspects, at least one antisense oligonucleotide is present in the composition in an amount of 0.001 to 100 mg / ml. In some aspects, at least one antisense oligonucleotide is present in a unit dose amount. In some aspects, the unit dose includes 0.001 to 100 mg.

[0022] In a third general aspect, this disclosure provides a method of treating a disease or condition in a subject in need, comprising: a) administering to the subject an effective amount of any of the antisense oligonucleotides (or pharmaceutical compositions) disclosed herein; and b) treating the disease or condition. In some aspects, the disease or condition is a neurodegenerative disease (such as spinocerebellar ataxia, ALS, Parkinson's disease, frontotemporal dementia, Alzheimer's disease) or a protein disease, such as TDP43 proteinopathy.

[0023] In some aspects, treating a disease or condition includes preventing, reducing, slowing down, or eliminating one or more symptoms of the disease or condition. In some aspects, treating a disease or condition includes improving a subject's motor function by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 60%, 70%, 80%, 90%, or 100%, or within a range defined by endpoints selected from any of the above values. In some aspects, treating a disease or condition includes improving a subject's motorrotarod performance by at least 10%, 15%, or 20%. In some respects, the extent of improvement can be determined using the ALS Functional Rating Scale Revision (“ALSFRS-R”) or any other metric known in the art.

[0024] In some respects, the effective amount is sufficient to reduce ATXN2 The amount of the encoded protein expressed in at least one cell or tissue of the subject. In some respects, the cell is a nerve cell (such as a Purkinje cell). In some respects, an effective amount includes an amount sufficient to achieve a concentration of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, or 400 nM in one or more cells of the subject. In some aspects, the methods of this disclosure may include administering a pharmaceutically acceptable dosage form comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53. 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 mg (or amounts within the range defined by any pair of the above values) of one or more antisense oligonucleotides described herein. For example, a suitable liquid formulation may contain 5-20 mg of the antisense oligonucleotide described herein in a solution of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 ml (or a volume within the range defined by any pair of the above values). In some aspects, administration includes administering the antisense oligonucleotide or pharmaceutical composition at least, at most, or exactly 1, 2, 3, 4, or 5 times daily. In some aspects, the antisense oligonucleotide or pharmaceutical composition is administered parenterally.

[0025] In a fourth general aspect, this disclosure provides a cell comprising any antisense oligonucleotide disclosed herein, or a vector configured to express any antisense oligonucleotide disclosed herein. In some aspects, this disclosure provides lipid nanoparticles or extracellular vesicles comprising one or more antisense oligonucleotides disclosed herein.

[0026] In a fifth general aspect, this disclosure provides a method for reducing the amount or activity of a target mRNA encoding an ATXN2 isoform in a cell, comprising contacting the cell with an antisense oligonucleotide configured to hybridize with the target mRNA; and causing degradation of the target mRNA transcript (e.g., via NMD). In some aspects, the antisense oligonucleotide is configured to hybridize with... ATXN2 Multiple consecutive nucleotide hybridizations within the intron region of exon 8, exon 9, or between exon 8 and exon 9.

[0027] To achieve the foregoing and related objectives, one or more aspects include the features fully described below and specifically pointed out in the claims. The following description and drawings illustrate certain illustrative features of one or more aspects in detail. However, these features represent only a few of the many ways in which the principles of the multiple aspects can be applied, and this description is intended to include all such aspects and their equivalents. Attached Figure Description

[0028] The accompanying drawings illustrate and describe exemplary aspects of this disclosure, but are not intended to limit the scope of the invention as defined in the claims.

[0029] Figure 1 This describes the visualizations of the UCSC Genome Browser (genome.ucsc.edu). ATXN2 The genomic locations of genes targeting alternative splicing events are shown, along with the positions of the putative early stop codons (“PTCs”) for each regulated transcript. These include three 5' splicing site variants of exon 8 (47nt inclusion, 25nt skip, and 70nt skip), and a complete skip of either of the two variants of exon 18 (61nt and 67nt in length, respectively). There are two alternative splicing exons between exon 18 and exon 20, with lengths of 45nt and 33nt; if exon 18 is skipped, the PTC will occur on the first inclusion exon of the three exons (45nt, 33nt, or exon 20). The figure shows transcript trajectories annotated by GENCODE V41 (Frankish A). et al ., Nucleic Acids Res 2021; PMID33270111).

[0030] Figure 2 The mechanism by which ASO regulates gene expression in this invention is described. (The upper right corner shows...) Normal processing; the lower right corner shows the adjustment. The expected effect of the processing is illustrated using the 47nt inclusion of exon 8 as an example; other events follow a similar pattern. The ASO described herein is designed to trigger any of the following mechanisms: The molecule undergoes nonsense-mediated decay: 1) variable 5' splicing of exon 8 (47nt inclusion, 70nt skipping, or 25nt skipping); 2) skipping of variable exon 18 (which has two variants, 61nt and 67nt). As a result, the expression of ATXN2 protein is reduced.

[0031] Figure 3-4 Characterized the exon 8 target region in U2OS cells treated with ASO in either the control or experimental groups. Figure 1 shown) Isomer expression. In Figure 3 In the image, the RT-PCR product of exon 8 is visualized on an acrylamide gel. The bands correspond to the various isomers indicated. After treatment with some of the ASOs described in this paper, the canonical form decreased (resulting in weaker bands), while the variant form increased (resulting in stronger bands), indicating that such ASOs can effectively regulate exon 8 splicing. Figure 4 The quantitative representation of each isoform expression rate (47nt inclusion, 70nt skip reading, 25nt skip reading) is shown by density analysis of acrylamide gel images.

[0032] Figure 5 This is a set of agarose gel images showing the exon 8 target region (e.g., ...) in cells treated with ASO in the control or experimental groups. Figure 1 Characterization of 47nt alternative splicing (shown). The upper PCR band correlates with the 47nt containing isoform, and the lower PCR band correlates with the canonical isoform. ASO was tested in labeled A549 or T98G cells.

[0033] Figure 6-7 47nt alternative splicing was characterized in A549 cells treated with selected ASO. Figure 6 These are acrylamide gel images depicting isomer expression. Figure 7 The quantitative data (47nt content %) of the isomer ratio is shown by density analysis of acrylamide gel images.

[0034] Figure 8-9 Alternative splicing of exon 18 in U2OS cells transfected with ASO was characterized. Figure 8In the image, the RT-PCR product of exon 18 is visualized on an acrylamide gel. There are four alternative splicing events around exon 18: 1) exon 18 (61 or 67 nt exon), which are targeted skipping events; 3) 45 nt exon (hg38 chr12:111,482,787-111,482,831), containing a stop codon; and 4) 33 nt exon (hg38 chr12:111,479,070-111,479,102). These events can occur in various combinations. Five bands were observed and labeled (some bands are only visible with increased contrast). Figure 9 The band quantification was demonstrated by density analysis. The abundance of exon 18 (61 / 67nt), exon 33nt, and the combination of exon 33+45nt was sufficient for quantification.

[0035] Figure 10 The dose-response effect of ASO treatment on 47nt alternative splicing was described. T98G cells were treated with different doses (10 nM, 25 nM, 50 nM, and 100 nM, repeated) in a control group and with three selected ASOs disclosed herein. RT-PCR products were visualized on agarose gels.

[0036] Figure 11-15 The proportion of isomers treated with selected ASO (47 nt content %) was characterized using digital PCR (dPCR). Isomer expression was detected using two probes with different fluorescence: one to detect total isomers (fluorescence signal on the y-axis) and the other to detect canonical isomers (fluorescence signal on the x-axis). Two-dimensional plots of the two fluorescence channels are shown below. Figure 11-12 The figure shows two representative ASO-processed samples. The circled area represents the signal from the isomer containing the 47nt component. Figure 13-15 The quantification of dPCR (47nt content %) is shown, with three different cell types (HEK293, A549 and T98G) treated with selected ASO.

[0037] Figure 16 The dose-response effect of ASO treatment on the 47nt inclusion event is described. The figure shows the dPCR quantification of the 47nt inclusion event after cell treatment with specified increasing doses of ASO (from 1 nM to 100 nM).

[0038] Figure 17-19 ASO-treated cells were characterized using RNA-seq. Express. Figure 17 T98G cells were used. Figure 18-19A549 cells were used. Reads obtained during sequencing are displayed in a wobbly format with their mapped genomic coordinates. If the number of supporting reads is ≥4, exon-crossing adapter reads are counted and displayed below the read trajectory as exon-exon adapters and their corresponding read counts. Figure 17 Results for the following three samples are shown: 1) untreated cells (second trajectory); 2) cells transfected with A8 (third trajectory); 3) cells transfected with A9 (fourth trajectory). Quantitative results for the 47nt contained in each trajectory, calculated based on adapter readings supporting the event, are indicated on each trajectory. Figure 18 The results for the following three samples are shown: 1) sham-treated cells (second trajectory); 2) cells transfected with C1 (third trajectory); 3) cells transfected with A6 (fourth trajectory); and 4) cells transfected with A22 (fifth trajectory). Figure 19 Yes Figure 18 The quantitative charts show The abundance and relative amounts of exon 8 variants, which were determined by the 5' end-terminated linker readings of exon 9.

[0039] Figure 20 The TaqMan analysis method was used to analyze Hs01002848_m1 (“2848”) in HepG2 cells treated with ASO in either the control or experimental groups. qPCR quantification of expression.

[0040] Figure 21 The TaqMan analysis method was used to analyze Hs01002848_m1 (“2848”) in HEK293 cells treated with ASO in either the control or experimental groups. qPCR quantification of expression.

[0041] Figure 22 The TaqMan analysis method was used to analyze Hs01002848_m1 (“2848”) in U2OS cells treated with ASO in either the control or experimental groups. Expression was quantified by qPCR. A125 to A149 are ASOs designed to target exon 18.

[0042] Figure 23-24 The effects of ASO treatment (A9 and A28) on U2OS cells using TaqMan analysis with Hs01002848_m1 (“2848”) ASO were described. The expressed dose-response effect. Calculated IC50. 50 The values ​​are shown in the figure.

[0043] Figure 25-30The expression of ATXN2 protein in ASO-treated cells was characterized by ProteinSimple Jess blot. Figure 25 , 27 Image 29 is an image obtained by Simple Western Jess run using the ATXN2 antibody (BD#611378) to detect ATXN2 protein. Figure 25 and Figure 27 Total protein staining and Figure 27 and Figure 29 Vinculin (detected by ThermoFisher #MA5-11690 antibody) was used as a reference. Samples were from different cell types: Figure 25-26 Results for T98G cells are shown. Figure 27-28 The results for U2OS cells are shown. Figures 29-30 Results for HEK293 cells are shown. Gel analysis was performed using ProteinSimple Compass software to determine the quantification of ATXN2 protein levels. Figure 26 , Figure 28 and Figure 30 ).

[0044] Figures 31-32 The changes in ATXN2 protein expression in the cerebellum of Q22 mice after administration of 100 µg ASO via ICV injection were characterized. WT mouse samples were used as controls. In quantitative analysis (… Figure 32 Human protein expression was estimated based on WT expression, and the remaining percentage of human ATXN2 was indicated (relative to PBS).

[0045] Figures 33-34 The changes in ATXN2 protein expression in the spinal cord of Q22 mice after administration of 100 µg ASO via ICV injection were characterized. WT mouse samples were used as controls. In quantitative analysis ( Figure 34 Human protein expression was estimated based on WT expression, and the remaining percentage of human ATXN2 was indicated (relative to PBS). Detailed Implementation

[0046] The detailed description below, taken in conjunction with the accompanying drawings, is intended to describe various configurations and is not intended to represent the only configurations that can implement the concepts described herein. The detailed description includes specific details and is intended to provide a thorough understanding of the various concepts. However, it will be apparent to those skilled in the art that these concepts can be implemented without these specific details.

[0047] It should be understood that the foregoing general description and the following detailed description are exemplary and explanatory only, and do not limit the claimed invention. In this document, the singular includes the plural unless otherwise specified. As used herein, “or” means “and / or” unless otherwise specified. Furthermore, as used herein, “and” means “and / or” unless otherwise specified. Further, the use of the term “comprising” and other forms such as “including” and “including” is not limiting. Additionally, terms such as “element” or “assembly” cover both elements and assemblies comprising one unit and elements and assemblies comprising more than one sub-unit, unless otherwise specified.

[0048] The chapter headings used herein are for organizational purposes only and should not be construed as limiting the subject matter. All documents or portions thereof cited in this disclosure, including but not limited to patents, patent applications, published patent applications, articles, books, papers, GENBANK accessions and related sequence information available from databases such as the National Center for Biotechnology Information (NCBI), and other data mentioned throughout this disclosure, are expressly incorporated by reference into the documents discussed herein and in their entirety.

[0049] This disclosure provides antisense oligonucleotides, pharmaceutical compositions, and methods for treating, preventing, or improving ATXN2-related diseases, conditions, and illnesses in subjects of need. ATXN2-related diseases, conditions, and illnesses include, but are not limited to, neurodegenerative diseases (such as spinocerebellar ataxia, ALS, Parkinson's disease, frontotemporal dementia, and Alzheimer's disease) or protein diseases such as TDP43 proteinopathy.

[0050] definition Unless otherwise stated, the following terms have the following meanings: The term "antonym" refers to anything that depends on a formulation. ( Methods such as those using single-stranded oligonucleotides, where the formulations are sufficiently complementary to the target sequence to bind to it in a sequence-specific manner (e.g., hybridization with the target sequence). Exemplary applications of antisense in this application include using oligonucleotide formulations that hybridize with the target precursor mRNA molecule and block the activity / effects of the target precursor mRNA sequence (e.g., splicing patterns and / or non-productive splicing sites). Antisense methods are commonly used to target transcriptional repression, translational repression, degradation, etc., of DNA or RNA. Antisense is a human-initiated technique, for example, that can modulate splicing and / or silence expression of target genes.

[0051] As used herein, the term "antisense oligonucleotide" refers to a nucleic acid (such as RNA or its analogues) that has sufficient sequence complementarity to a target RNA (i.e., splice site selection regulated RNA) to effectively block the target RNA (such as precursor mRNA). In an exemplary aspect, ATXN2 This blocking effect of splicing sites in precursor mRNA regulates splicing, either by masking the binding sites of native proteins (which would otherwise regulate splicing) and / or by altering the structure of the target RNA. In some respects, the target RNA is the target precursor mRNA (e.g., ATXN2 Precursor mRNA).

[0052] An antisense oligonucleotide having a sequence "sufficient to be complementary to the target RNA sequence to regulate target RNA splicing" means that the antisense oligonucleotide has a sequence sufficient to induce masking of the natural protein binding site (otherwise the natural protein would regulate splicing) and / or alteration of the three-dimensional structure of the targeted RNA to similarly regulate splicing. Similarly, an oligonucleotide reagent having a sequence "sufficient to be complementary to the target RNA sequence to regulate target RNA splicing" means that the oligonucleotide reagent has a sequence sufficient to induce masking of the natural protein binding site (otherwise the natural protein would regulate splicing) and / or alteration of the three-dimensional structure of the targeted RNA used herein.

[0053] The terms "target gene" or "target RNA transcript" refer to a gene or transcript (such as a precursor mRNA) whose expression will be substantially regulated. This regulation can be achieved through stereotactic blockade of splicing regulatory elements.

[0054] The term "antisense activity" refers to any detectable or measurable activity attributable to the hybridization of an antisense oligonucleotide with its target nucleic acid. In some embodiments, antisense activity refers to a reduction in the amount or expression of the target nucleic acid or the protein encoded by such target nucleic acid.

[0055] The term "target recognition sequence" refers to the portion of an antisense oligonucleotide that recognizes a target nucleic acid. A target recognition sequence has a nucleobase sequence that allows hybridization with a corresponding region or segment of the target nucleic acid.

[0056] As used herein, the term "sufficiently complementary" means that the sequence of the antisense oligonucleotide (e.g., an antisense oligonucleotide with a target recognition sequence) is sufficient to complement the desired target transcript (e.g., ...). ATXN2 The target transcript binds to the target RNA and triggers changes in RNA processing, such as inhibiting or inducing nonproductive splicing of the target transcript (e.g., stereotactic inhibition of the splicing mechanism of the target precursor mRNA). For example, the target recognition sequence binds to the target nucleic acid sequence (e.g., ATXN2 A portion of the transcript has at least 90% complementarity, sufficient to trigger complementary reactions. ATXN2Transcription regulation. The term "complete complementarity" means, for example, that the target recognition sequence and the target nucleic acid sequence are 100% complementary. Complementary nucleic acid molecules hybridize with each other. The term "hybridization" refers to the annealing of complementary nucleic acid molecules to produce stable double-stranded nucleotides. In some embodiments, the complementary nucleic acid molecules include antisense oligonucleotides and target nucleic acids.

[0057] The term "nucleoside" refers to a molecule having a purine or pyrimidine base covalently linked to ribose or deoxyribose. Exemplary nucleosides include adenosine, guanosine, cytidine, uridine, and thymidine. Other exemplary nucleosides include inosine, 1-methylinosine, pseudouridine, 5,6-dihydrouridine, nucleothymidine, 2N-methylguanosine, and N... 2 N 2 - Dimethylguanosine (also known as a "rare" nucleoside). The term "nucleotide" refers to a nucleoside having one or more phosphate groups linked to a sugar moiety by an ester linkage. Exemplary nucleotides include nucleoside monophosphates, nucleoside diphosphates, and nucleoside triphosphates. The terms "polynucleotide" and "nucleic acid molecule" are used interchangeably herein and refer to a polymer of nucleotides in which the 5' and 3' carbon atoms are linked together by a phosphodiester or thiophosphate linkage.

[0058] The terms “RNA” or “RNA molecule” or “ribonucleic acid molecule” refer to a polymer of ribonucleotides (such as 2, 3, 4, 5, 10, 15, 20, 25, 30 or more ribonucleotides). An RNA nucleotide refers to a single ribonucleotide. The terms “DNA” or “DNA molecule” or “deoxyribonucleic acid molecule” refer to a polymer of deoxyribonucleotides. A DNA nucleotide refers to a single deoxyribonucleotide. As used herein, the term “DNA-like” refers to, for example, a conformation of a modified nucleoside or nucleotide that is similar to the conformation of the corresponding unmodified DNA unit. For example, a DNA-like nucleotide may refer to a conformation of a modified deoxyribonucleotide that is similar to the conformation of the corresponding unmodified deoxyribonucleotide. Examples of DNA-like nucleotides include, but are not limited to, 2'-deoxyribonucleotides, 2'-deoxy-2'-substituted arabinonucleotides (such as 2'-deoxy-2'-fluoroarabinonucleotide, also referred to in the art as 2'F-ANA or FANA), and corresponding phosphate thioester analogs. As used herein, the term "RNA-like" refers to, for example, a conformation of a modified nucleoside or nucleotide that is similar to that of the corresponding unmodified RNA unit. RNA-like conformations may employ an A-type helix, while DNA-like conformations employ a B-type helix. Examples of RNA-like nucleotides include, but are not limited to, 2'-substituted RNA nucleotides (e.g., 2'-fluoro-RNA nucleotides, also referred to in the art as 2'F-RNA), locked nucleic acid (LNA) nucleotides (also referred to in the art as bridging nucleic acids or bicyclic nucleotides), 2'-fluoro-4'-thioarabinonucleotides (also referred to in the art as 4'S-FANA nucleotides), 2'-O-alkyl-RNA, and corresponding thiophosphate analogs. In some aspects, the antisense oligonucleotides described herein may include one or more DNA, RNA, DNA-like nucleotides, and / or RNA-like nucleotides.

[0059] The terms "nucleotide analogue," "altered nucleotide," or "modified nucleotide" refer to non-standard nucleotides, including ribonucleotides or deoxyribonucleotides that are not naturally occurring. Exemplary modified nucleotides can be modified at any position to alter certain chemical properties of the nucleotide while retaining the ability of the modified nucleotide to perform its intended function. Examples of derivatizable nucleotide positions include the 5-position, such as 5-(2-amino)propyluridine, 5-bromouridine, 5-propynyluridine, 5-propenyluridine, etc.; the 6-position, such as 6-(2-amino)propyluridine; and the 8-position of adenosine and / or guanosine, such as 8-bromoguanosine, 8-chloroguanosine, 8-fluoroguanosine, etc. Modified nucleotides also include denitronucleotides, such as 7-denitroadenosine; O- and N-modified nucleotides (such as alkylation, such as N6-methyladenosine, or other modifications known in the art); and other heterocyclic modified nucleotides, such as Herdewijn, Antisense Nucleic Acid Drug DevThose described in ., 2000 Aug. 10(4):297-310.

[0060] Modified nucleotides may also include modifications to the sugar moiety of the nucleotide. For example, the 2'OH- group may be substituted with a group selected from H, OR, R, F, Cl, Br, I, SH, SR, NH2, NHR, NR2, COOR, or OR, wherein R is substituted with or unsubstituted with C1-C6 alkyl, alkenyl, alkynyl, aryl, etc. As another example, the ribose may be partially substituted with a bicyclic or tricyclic moiety, such as locked nucleic acid, bound ethyl, tricyclic DNA, or other bridging or bicyclic modifications. Other possible modifications include those described in U.S. Patent Nos. 5,858,988 and 6,291,438.

[0061] The phosphate group of a nucleotide can also be modified, for example, by replacing one or more oxygen atoms of the phosphate group with sulfur (such as thiophosphate), or by other substitutions, which allow the nucleotide to perform its intended function, as described in Eckstein. Antisense Nucleic Acid Drug Dev . 2000 Apr. 10(2):117-21, Rusckowski et al. Antisense Nucleic Acid Drug Dev . 2000 Oct. 10(5):333-45、Stein, AntisenseNucleicAcid Drug Dev. 2001 Oct. 11(5): 317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev 2001 Apr. 11(2):77-85, and U.S. Patent No. 5,684,143. Some of the modifications mentioned above (such as phosphate modifications) can reduce the rate of hydrolysis of polynucleotides, such as those containing the like, in vivo or in vitro.

[0062] As used herein, the terms "unmodified nucleotide" or "non-modified nucleotide" refer to a nucleotide consisting of naturally occurring nucleobases, a sugar moiety, and nucleoside linkages. In some embodiments, the non-modified nucleotide is an RNA nucleotide (such as β-D-ribonucleotide) or a DNA nucleotide (such as β-D-deoxyribonucleotide).

[0063] The term "oligonucleotide" refers to a short polymer of nucleotides and / or modified nucleotides. As described above, these oligonucleotides can be linked to bonds that result in a lower rate of hydrolysis compared to oligonucleotides linked by phosphodiester bonds. For example, the nucleotides of the oligonucleotides may include triazoles, amides, peptides, carbamates, methylene glycol, ethylene glycol, oxymethylthio, oxyethylthio, oxycarbonyloxy, phosphoridamide, phosphoramide, phosphonates, and / or thiophosphate bonds. Modifications or alterations to the oligonucleotides may further include adding non-nucleotide materials, such as to the ends or interior of the oligonucleotide (at one or more nucleotides of the oligonucleotide).

[0064] As used herein, “administer” or “administration” means the act of injecting or otherwise physically delivering a substance present outside the body (such as the antisense oligonucleotides described herein) into a patient. The antisense oligonucleotides described herein can be administered to a patient’s central nervous system. The central nervous system includes the brain and spinal cord. Methods of administration to the central nervous system include, but are not limited to, intravenous, intramuscular, intraperitoneal, intranasal, subcutaneous, intrathecal, intraventricular, or striatal infusion or delivery, and / or any other physical delivery method described herein or known in the art.

[0065] "Effective amount" refers to an amount of active pharmaceutical agent (such as the antisense oligonucleotide of this disclosure) sufficient to enable the individual requiring the agent to achieve the desired physiological outcome. Effective amount can vary from person to person and depends on the health and physical condition of the individual to be treated, the individual's taxonomic group, the formulation of the composition, the assessment of the individual's medical condition, and other relevant factors.

[0066] As used herein, the term "subject" includes mammals such as non-primates (e.g., cattle, pigs, horses, cats, dogs, rabbits, rats, etc.) and primates (e.g., monkeys and humans). Mammals include, but are not limited to, humans, non-human primates, wild animals, wild beasts, farm animals, and pets. In some respects, subjects are mammals, such as humans with ATXN2-related diseases (e.g., ALS).

[0067] ATXN2 antisense oligonucleotide In some aspects, targeted ATXN2 The antisense oligonucleotides of the transcript are 10 to 30 nucleotides in length. In other embodiments, targeting ATXN2The antisense oligonucleotides of the transcript are 15 to 25 nucleotides long, or 18 to 20 nucleotides long. For example, the length of an antisense oligonucleotide can be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides, or any range defined by any pair of the above values.

[0068] In some aspects, the antisense oligonucleotides of this disclosure comprise nucleotide sequences selected from SEQ ID NO: 10-137 or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19-mer fragments (or fragments whose size falls within the range defined by any pair of the above values). In some aspects, the antisense oligonucleotide comprises a nucleotide sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide substitutions compared to any sequence in SEQ ID NO: 10-137. In some aspects, the antisense oligonucleotide comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to any sequence in SEQ ID NO: 10-137. In some aspects, the antisense oligonucleotide comprises a nucleotide sequence identical to the consecutive 16-22-mer portions of any sequence in SEQ ID NO: 10-12. In some aspects, the antisense oligonucleotide comprises a sequence of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide substitutions compared to any sequence in SEQ ID NO: 10-12 or its aligned portions. In some aspects, the antisense oligonucleotide comprises a nucleotide sequence identical to any consecutive 16-22-mer portions of SEQ ID NO: 10-12 having 1, 2, 3, 4, or 5 nucleotide substitutions.

[0069] In some aspects, compositions according to this disclosure (such as pharmaceutical compositions) may comprise a combination of two or more antisense oligonucleotides described herein. For example, with Antisense oligonucleotides that hybridize to two or more target regions in the transcript may more effectively reduce the expression of the ATXN2 protein isoform in treated subjects, cells, or tissues. This combination can be administered in vivo or in vitro as individual antisense oligonucleotides (i.e., two or more antisense oligonucleotides in a mixture), or the combination can be administered by linking two or more antisense oligonucleotides. In some aspects, combination therapy may include the separate administration of two or more antisense oligonucleotides (e.g., sequential delivery).

[0070] This disclosure also provides branched antisense oligonucleotides containing two or more target recognition sequences that target Part of a transcript. The branched antisense oligonucleotides disclosed herein may be, for example, branched antisense oligonucleotide compounds. As used herein, the terms "branched antisense oligonucleotide," "branched antisense oligonucleotide," or "polyoligonucleotide compound" refer to two or more antisense oligonucleotides linked together. In some embodiments, two or more antisense oligonucleotides are linked together by a linker.

[0071] In some respects, branched oligonucleotide compounds contain two or more target recognition sequences, wherein the target recognition sequences are interconnected by one or more portions selected from linkers, spacers and branch points.

[0072] This disclosure provides an antisense oligonucleotide comprising a target recognition sequence that targets ATXN2 Nucleic acids (such as) ATXN2 Part of a transcript. In some embodiments, the antisense oligonucleotide has a nucleobase sequence that, when written along the 5' to 3' direction, contains ATXN2 The inverse complement of the nucleic acid component.

[0073] In some respects, the target area is ATXN2 Nucleic acid targets are well-defined structural regions. For example, target regions may include 3' untranslated region (UTR), 5' untranslated region (UTR), exons, introns, exon / intron adapters, exon / exon adapters, coding regions, translation initiation regions, translation termination regions, circular RNA, antisense (such as microRNA and long non-coding RNA) binding regions, promoter sequences, enhancer elements, or other defined nucleic acid regions, such as open reading frames or adapters between open reading frames and untranslated regions, and any combination thereof. ATXN2 The structurally defined regions can be obtained from sequence databases such as NCBI accession numbers, which are incorporated herein by reference. In some implementations, the target region may include sequences from the 5' target site of one target segment to the 3' target site of another target segment within the same target region. Suitable target segments may be located in the 5' UTR, coding region, 3' UTR, introns, exons, and / or exon / intron linkers.

[0074] When a sufficient number of nucleobases in an antisense oligonucleotide can form hydrogen bonds with the corresponding nucleobases in a target nucleic acid, the antisense oligonucleotide and the target nucleic acid (such as...) ATXN2 The transcripts (or portions thereof) are complementary, which produces the desired effect (such as antisense promoting nonproductive target nucleic acids, e.g.) ATXN2 Non-productive transcripts or portions thereof). Antisense oligonucleotides and ATXN2 Non-complementary nucleobases between nucleic acids are permissible, provided that the antisense oligonucleotide can still specifically hybridize with the target nucleic acid. Furthermore, antisense oligonucleotides can... ATXN2 One or more segments of nucleic acids hybridize, such that intermediate or adjacent segments do not participate in the hybridization event (e.g., circular structures, mismatches, or hairpin structures).

[0075] In some respects, the antisense oligonucleotides or specific portions thereof provided in this article are similar to... ATXN2 The nucleic acid, target region, target region segment, or a specific portion thereof is, or at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to the target nucleic acid. The percentage of complementarity between the antisense oligonucleotide and the target nucleic acid can be determined using conventional methods. For example, in an antisense oligonucleotide, 18 out of the 20 nucleotides are complementary to the target region (e.g., ...). ATXN2 The transcript is complementary to the iso-length portion, thus specific hybridization occurs, representing 90% complementarity. In this example, the remaining non-complementary nucleotides may cluster or intersperse with complementary nucleotides, without necessarily being adjacent to each other or to complementary nucleotides. Therefore, the 18-nucleotide antisense oligonucleotide has 4 (tet) non-complementary nucleotides, flanked by two regions that are fully complementary to the target nucleic acid, resulting in an overall complementarity of 77.8% with the target nucleic acid, and is therefore within the scope of this disclosure. The percentage of complementarity of the antisense oligonucleotide to the target nucleic acid region can be determined using the BLAST program (Basic Local Alignment Search Tool) and the PowerBLAST program known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome ResThe homology percentage, sequence identity, or complementarity can be determined, for example, by the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), which uses default settings and the Smith and Waterman algorithm (Adv. Appl. Math., 1981, 2, 482 489).

[0076] A nucleoside is a base-sugar combination. The nucleobase (also called the base) portion of a nucleoside is usually a heterocyclic base portion. A nucleotide is a nucleoside that also includes a phosphate group covalently linked to the sugar portion of the nucleoside. For nucleosides containing pentafuranose, the phosphate group can be linked to the 2', 3', or 5' hydroxyl portion of the sugar. Oligonucleotides are linear polymeric oligonucleotides formed by covalent bonds between adjacent nucleotides. In the oligonucleotide structure, the phosphate group is usually referred to as the nucleoside linker that forms the oligonucleotide.

[0077] Modifications to antisense oligonucleotides include substitutions or alterations to the internucleotide linkages, sugar moieties, or nucleobases. Modified antisense oligonucleotides are generally preferred over the native form of the oligonucleotide due to desired properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid targets, improved stability in the presence of nucleases, or enhanced inhibitory activity.

[0078] Chemically modified nucleosides can also be used to enhance the binding affinity of shortened or truncated antisense oligonucleotides to their target nucleic acids. Therefore, similar results can often be obtained by using shorter antisense oligonucleotides with such chemically modified nucleosides.

[0079] The naturally occurring nucleoside linkages in RNA and DNA are 3' to 5' phosphodiester linkages. Antisense oligonucleotides with one or more modified (i.e., non-naturally occurring) nucleoside linkages are generally preferred over those with naturally occurring linkages due to desired properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and improved stability in the presence of nucleases.

[0080] Oligonucleotides with modified internucleotide linkages include both phosphorus-retaining and phosphorus-free internucleotide linkages. Representative phosphorus-containing internucleotide linkages include, but are not limited to, phosphate diesters, phosphate triesters, methylphosphonates, phosphoramides, and thiophosphates. Methods for preparing phosphorus-containing and phosphorus-free linkages are well known.

[0081] In some implementations, targeting ATXN2 The antisense oligonucleotide of the nucleic acid contains one or more modified internucleotide links. In some embodiments, the modified internucleotide links are phosphate thioester links. In some embodiments, each internucleotide link of the antisense oligonucleotide is a phosphate thioester link.

[0082] The antisense oligonucleotides disclosed herein may optionally contain one or more nucleosides, wherein the glycosyl groups have been modified. Such glycomodified nucleosides may confer enhanced nuclease stability, increased binding affinity, or other beneficial biological properties to the antisense oligonucleotides. In some embodiments, the nucleosides comprise chemically modified nucleofuranose ring moieties. Examples of chemically modified nucleofuranose rings include, but are not limited to, the addition of substituents (including 5' and 2' substituents), bridging ring atoms to form bicyclic nucleic acids (BNAs), and using S, NI, or C(R) groups. 1 (R) 2 (R=H、C1-C) 12 Alkyl or protecting groups) replacing the oxygen atom of the ribosyl ring, and combinations thereof. Examples of chemically modified sugars include 2'-F-5'-methyl-substituted nucleosides (for other disclosed 5',2'-disubstituted nucleosides see PCT International Application WO 2008 / 101157, published August 21, 2008), or S-substituted oxygen atoms of the ribosyl ring with further substitution at the 2'-position (see U.S. Patent Application Publication No. 2005 / 0130923, published June 16, 2005), or 5'-substituted BNA (see PCT International Application WO 2007 / 134181, published November 22, 2007), wherein LNA is substituted, for example, with 5'-methyl or 5'-vinyl.

[0083] Examples of nucleosides with modified sugar moieties include, but are not limited to, nucleosides containing 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F (i.e., 2'-fluoro), 2'-OCH3 (i.e., 2'-O-methyl), and 2'-O(CH2)2OCH3 (i.e., 2'-O-methoxyethyl) substituents. The substituent at the 2' position may also be selected from allyl, amino, azide, thio, O-allyl, O-Cl-C... 10 Alkyl, OCF3, O(CH2)2SCH3, O(CH2)2-ON(R) m (R) n) and O-CH2-C(=O)-N(R m (R) n ), where each R m and R n Independently H or substituted or unsubstituted C1-C 10 Alkyl groups. 2'-Modified nucleotides are useful in this invention, such as 2'-O-methylRNA, 2'-O-methoxyethylRNA, 2'-fluoroRNA, and other 2'-modified nucleotides contemplated by those skilled in the art.

[0084] Examples of bicyclic nucleic acids (BNAs) include, but are not limited to, nucleosides containing a bridging link between the 4' and 2' ribosyl ring atoms. BNAs containing a bridging link between the 4' and 2' ribosyl ring atoms can be called locked nucleic acids (LNAs), also commonly referred to as inaccessible RNA. As used herein, the term "locked nucleotide" or "locked nucleic acid (LNA)" includes nucleotides in which the 2' deoxyribose sugar moiety is modified by introducing a heteroatom-containing structure that bridges from the 2' carbon atom to the 4' carbon atom. The term "unlocked nucleotide" includes nucleotides in which the ribose sugar moiety does not contain a bridging structure. Therefore, this term includes DNA and RNA nucleotide monomers (phosphorylated adenosine, guanosine, uridine, cytidine, deoxyadenosine, deoxyguanosine, deoxythymidine, deoxycytidine) and their derivatives, as well as other nucleotides having a 2'-deoxy-erythrofuranosyl sugar moiety or a ribosyl-pentafuranosyl moiety. In some aspects, the antisense oligonucleotides provided herein comprise one or more BNA nucleotides, wherein the bridging comprises one of the following formulas: 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)-O-2' (LNA); 4'-(CH2)2-O-2' (ENA); 4'-C(CH3)2-O-2' (see PCT / US2008 / 068922); 4'-CH(CH3)-O-2' and 4'-CH(CH2OCH3)-O-2' (see U.S. Patent No. 7,399,845, issued July 15, 2008); 4'-CH2-N(OCH3)-2' (see PCT / US2008 / 064591); 4'-CH2-ON(CH3)-2' (see U.S. Patent Application No. US, published September 2, 2004). 2004-0171570); 4'-CH2-NI-O-2' (see U.S. Patent No. 7,427,672, granted September 23, 2008); 4'-CH2-C(CH3)-2' and 4'-CH2-C(=CH2)-2' (see PCT / US2008 / 066154); wherein R is independently H, Cl-C 12Alkyl or protecting groups. Each of the above BNAs includes various stereochemical sugar configurations, including, for example, α-L-ribofranose and β-D-ribofranose (see PCT International Application PCT / DK98 / 00393, published on 25 March 1999 as WO99 / 14226).

[0085] In some aspects, the antisense oligonucleotides provided herein comprise one or more 2', 4'-restricted nucleotides. For example, the antisense oligonucleotides provided in this disclosure include those having one or more restricted ethyl (cEt) or restricted methoxyethyl (cMOE) nucleotides. In some aspects, the antisense oligonucleotides provided herein comprise one or more restricted ethyl (cEt) nucleotides. The terms "restricted ethyl" and "ethyl-restricted" are used interchangeably.

[0086] In some respects, nucleosides are modified by replacing the ribosyl ring with a glycosidic compound. This modification includes, but is not limited to, replacing the ribosyl ring with a ring-replacing system (sometimes called a DNA analog) such as a morpholine ring, a cyclohexene ring, a cyclohexyl ring, or a tetrahydropyran ring. Many other bicyclic and tricyclic glycosidic ring systems are also known in the art for modifying nucleosides for inclusion in antisense oligonucleotides (see, for example, a review article: Leumann, J. C, Bioorganic & Medicinal Chemistry 2002, 10, 841-854; Ito, KR; Obika, S., Recent Advances in MedicinalChemistry of Antisense Oligonucleotides., in Comprehensive Medicinal Chemistry, 3 rd (Elsevier edition: 2017). This ring system can undergo various additional substitutions to enhance its activity.

[0087] Methods for preparing modified sugars are well known to those skilled in the art. In nucleotides with modified sugar moieties, the nucleobase moieties (natural, modified, or a combination thereof) remain unchanged in order to hybridize with appropriate nucleic acid targets.

[0088] In some aspects, targeted ATXN2 Antisense oligonucleotides of nucleic acids include one or more modified nucleotides. In one implementation, targeting ATXN2 Antisense oligonucleotides of nucleic acids include 2'-modified nucleotides. In one implementation, targeting ATXN2 Antisense oligonucleotides of nucleic acids include 2'-O-methylRNA, 2'-O-methoxyethylRNA, or 2'-fluoroRNA. In some respects, targeting... ATXN2Antisense oligonucleotides of nucleic acids include tricyclic DNA. Tricyclic DNA belongs to a class of restricted DNA analogs and has strong hybridization ability with complementary RNA; see Ittig et al., Nucleic Acids Res. 32:346-353 (2004); Ittig et al., Prague, Academy of Sciences of the Czech Republic. 7:21-26 (Coll. Symp. Series, Hocec, M., 2005); Ivanova et al., Oligonucleotides 17:54-65(2007); Renneberg et al., Nucleic Acids Res. 30:2751-2757 (2002); Renneberg et al., Chembiochem. 5:1114-1118 (2004); and Renneberg et al., JACS. 124:5993-6002(2002). In some respects, targeting ATXN2 Antisense oligonucleotides of nucleic acids include locked nucleotides, ethyl-restricted nucleotides, or α-L-locked nucleic acids. Various α-L-locked nucleic acids are known to those skilled in the art and are described, for example, Sorensen et al., J. Am. Chem. Soc. (2002) 124(10):2164-2176.

[0089] Nucleobase (or base) modifications or substitutions differ structurally from naturally occurring or synthetically unmodified nucleobases, but are functionally interchangeable. Both natural and modified nucleobases can participate in hydrogen bonding. Such nucleobase modifications can confer stability, binding affinity, or other beneficial biological properties to antisense oligonucleotide nucleases. Modified nucleobases include both synthetic and natural nucleobases, such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly helpful in improving the binding affinity of antisense oligonucleotides to target nucleic acids. For example, 5-methylcytosine substitution has been shown to increase the stability of nucleic acid duplexes by 0.6–1.2 °C (Sanghvi, YS, Crooke, STand Lebleu, B., eds.). Antisense Research and Applications , CRC Press, BocaRaton, 1993, pp. 276-278).

[0090] Other modified nucleobases include 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C=C-CH3)uracil and cytosine, and other alkynyl derivatives of pyrimidine bases, 6-azouracil, cytosine and thymine, and 5-uracil. The heterocyclic base moiety includes pyridine (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogenated, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-aminoadenine, 8-azaguanine and 8-azaadenine, 7-deadenine and 7-deadenine, and 3-deadenine and 3-deadenine. The heterocyclic base moiety may also include those in which the purine or pyrimidine base is substituted by other heterocycles, such as 7-deadenine, 7-deadenine, 2-aminopyridine and 2-pyridone. Nucleotides that particularly contribute to increasing the binding affinity of antisense oligonucleotides include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine.

[0091] In some aspects, targeted ATXN2 Antisense oligonucleotides of nucleic acids include one or more modified nucleotides having a modified sugar moiety. In some embodiments, the modified nucleotides are locked nucleotides. In some embodiments, the locked nucleotides are arranged in a gapmer motif, such as a 3-9-3 gapmer motif, in which nine non-locked nucleotides are flanked by three locked nucleotides. In some aspects, targeting ATXN2 Antisense oligonucleotides of nucleic acids include one or more modified nucleotides. In some respects, the modified nucleotide is 5-methylcytosine. In other respects, each cytosine is 5-methylcytosine.

[0092] In some aspects, the antisense oligonucleotides of this disclosure include a 2'-O-(2-methoxyethyl) modification on one or more nucleotides. In some embodiments, the antisense oligonucleotides of this disclosure include a 2'-O-(2-methoxyethyl) modification on 10% of the nucleotides, 20% of the nucleotides, 30% of the nucleotides, 40% of the nucleotides, 50% of the nucleotides, 60% of the nucleotides, 70% of the nucleotides, 80% of the nucleotides, or 90% of the nucleotides. In some embodiments, the antisense oligonucleotides of this disclosure include a 2'-O-(2-methoxyethyl) modification on each nucleotide (100% 2'-O-(2-methoxyethyl) modification).

[0093] In some aspects, the antisense oligonucleotides of this disclosure comprise one or more phosphate thioester nucleoside linkages. In some embodiments, the antisense oligonucleotides of this disclosure comprise one or more phosphate thioester nucleoside linkages and one or more phosphodiester linkages. In some embodiments, the antisense oligonucleotides of this disclosure comprise phosphate thioester at each nucleoside linkage.

[0094] In some aspects, the antisense oligonucleotides of this disclosure include conjugates. In one embodiment, the antisense oligonucleotides of this disclosure include an antisense oligonucleotide sequence and a conjugate, wherein the conjugate is linked to the antisense oligonucleotide sequence. In some embodiments, the conjugate is selected from any conjugates described herein, such as hydrophobic conjugates, tissue-targeting conjugates, or conjugates designed to optimize pharmacokinetic parameters.

[0095] In some respects, antisense oligonucleotides can also be modified to have one or more stabilizing groups, which are typically attached to one or both ends of the antisense oligonucleotide to enhance properties such as, for example, nuclease stability. Stabilizing groups include cap structures. These end modifications protect the antisense oligonucleotide with terminal nucleic acids from degradation by exonucleases and facilitate intracellular delivery and / or localization. The cap can be present at the 5' end (5'-cap) or the 3' end (3'-cap), or simultaneously at both ends. Cap structures are well known in the art, including, for example, inverted deoxy-base-free caps. Furthermore, 3' and 5' stabilizing groups that can be used at one or both ends of the antisense oligonucleotide to confer nuclease stability include those disclosed in WO 03 / 004602, published January 16, 2003.

[0096] Pharmaceutical compositions that regulate ATXN2 isoform expression This document provides pharmaceutical compositions and formulations comprising one or more of the antisense oligonucleotides described herein. For example, the antisense oligonucleotides described herein can be mixed, encapsulated, conjugated, or otherwise associated with other molecules, molecular structures, or mixtures of compounds. The pharmaceutical compositions of the present invention are formulated to suit their intended route of administration. Examples of routes of administration include intravenous, intraperitoneal, intramuscular, intranasal, subcutaneous, intrathecal, intraventricular, or striatal administration. In some embodiments, administration may be performed using an implantable device, such as an Ommaya reservoir or an implantable intrathecal catheter. Solutions or suspensions intended for administration may include the following components: sterile diluents, such as water for injection, physiological saline, lactated Ringer's solution, Elliott's B solution, fixative oil, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; antimicrobial agents, such as benzyl alcohol or methylparaben; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; buffers, such as acetate, citrate, carbonate, or phosphate; and formulations for adjusting pH, such as sodium chloride or glucose. pH may be adjusted using acids or bases, such as hydrochloric acid or sodium hydroxide. The pharmaceutical composition may be packaged in ampoules, disposable syringes, or multi-dose vials made of glass or plastic.

[0097] Suitable pharmaceutical compositions for injection include sterile aqueous solutions (water-soluble) or dispersions, as well as sterile powders for immediate preparation of sterile injectable solutions or dispersions. In all cases, the composition must be sterile and should have easily injectable flowability. It must remain stable under production and storage conditions and must be protected against contamination by microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Suitable flowability can be maintained, for example, by using coatings such as lecithin, by maintaining the desired particle size in the dispersed state, and by using surfactants. Various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc., can achieve antimicrobial action. In some embodiments, isotonic agents, such as sugars, polyols such as mannitol, sorbitol, and sodium chloride, can be added to the composition. The addition of absorption-delaying agents, such as aluminum monostearate and gelatin, to the composition can prolong the absorption of the injectable composition.

[0098] The preparation of sterile injectable solutions involves adding the required amount of the active compound to a suitable solvent, along with one or more of the aforementioned components as needed, followed by filtration and sterilization. Generally, the preparation of dispersions involves adding the active compound to a sterile solvent containing a basic dispersion medium and other required components from the list above. For sterile powders used to prepare sterile injectable solutions, some preparation methods include vacuum drying and freeze-drying, which allows obtaining the powder of the active ingredient and any other desired components from a previously sterile filtered solution.

[0099] The pharmaceutical compositions and formulations provided herein can be conveniently presented in unit dosage forms in some embodiments and can be prepared using techniques well known in the pharmaceutical industry. These techniques may include combining the active ingredient with a pharmaceutical carrier or excipient. Generally, the preparation of the formulation involves uniformly and tightly binding the active ingredient with a liquid carrier, fine solid carriers, or both, and then shaping the product where necessary (e.g., shaping it to a specific particle size for easy delivery). In one embodiment, the pharmaceutical formulation is prepared in a suitable solvent (such as water or physiological saline) for intrathecal, intraventricular, or striatal administration. In some aspects, the formulation is designed to allow naked delivery of antisense oligonucleotides to one or more cells of a subject.

[0100] Targeted ATXN2 Antisense oligonucleotides of transcripts can also be administered via transfection or infection using methods known in the art, including but not limited to McCaffrey et al. (2002). Nature , 418(6893), 38-9(hydrodynamic transfection); Xia et al. (2002), Nature Biotechnol ., 20(10),1006-10 (viral-mediated delivery); or Putnam (1996), Am. J. Health Syst. Pharm The method described in .53(2), 151-160.

[0101] Targeted ATXN2 Antisense oligonucleotides of transcripts can also be administered using any method suitable for administering nucleic acid agents, such as DNA vaccines. These methods include gene guns, bio-injectors, and skin patches, as well as needle-free methods such as the microparticle DNA vaccine technology disclosed in U.S. Patent No. 6,194,389 and the powder vaccine transdermal needle-free administration to mammals disclosed in U.S. Patent No. 6,168,587. Furthermore, intranasal administration is feasible, as described in particular by Hamajima et al. (1998). Clin.Immunol.Immunopathol., 88(2), 205-10. Liposomes (as described in U.S. Patent No. 6,472,375) and microcapsules may also be used. Biodegradable targeted microparticle delivery systems (as described in U.S. Patent No. 6,471,996) may also be used.

[0102] In some respects, antisense oligonucleotides are prepared together with a carrier to prevent rapid elimination of the compound from the body, such as in controlled-release formulations, including implants and microcapsule delivery systems. Biodegradable, biocompatible polymers such as ethylene-vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations are apparent to those skilled in the art. These materials are also commercially available from Alza Corporation and Nova Pharmaceuticals, Inc. Liposome suspensions (including liposomes targeting viral antigen monoclonal antibodies that infect cells) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.

[0103] By combining antisense oligonucleotides with suitable pharmaceutically acceptable diluents or carriers, targeted... ATXN2 Antisense oligonucleotides of nucleic acids are used in pharmaceutical compositions. Pharmaceutically acceptable diluents include phosphate-buffered saline (PBS). PBS is a diluent suitable for parenteral delivery compositions. Therefore, in one embodiment, the pharmaceutical composition used in the methods described herein contains a targeted... ATXN2 The nucleic acid is an antisense oligonucleotide, and a pharmaceutically acceptable diluent is used. In some embodiments, the pharmaceutically acceptable diluent is PBS.

[0104] The pharmaceutical composition may be packaged in a container, package, or dispenser along with the instructions for use.

[0105] Pharmaceutical compositions comprising antisense oligonucleotides include any pharmaceutically acceptable salt, ester, or salt of such esters, or any other oligonucleotide that, upon administration to animals (including humans), can (directly or indirectly) provide its biologically active metabolites or residues. Therefore, for example, this disclosure also relates to pharmaceutically acceptable salts of antisense oligonucleotides, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. Prodrugs may include the addition of additional nucleosides to one or both ends of the antisense oligonucleotide, which are cleaved by endogenous nucleases in the body to form the active antisense oligonucleotide.

[0106] Treatment methods for ATXN2-related diseases and symptoms This disclosure provides a method for treating a subject suffering from an ATXN2-related disease or condition. The treatment involves administering an effective amount of any of the antisense oligonucleotides described herein to the subject in need. In some embodiments, the antisense oligonucleotide is combined with… Target region hybridization in transcripts, wherein the target region comprises a sequence complementary to and / or hybridized with a sequence having 0, 1, 2, 3, 4, or 5 nucleotide substitutions compared to any consecutive 18-22-mer portion of SEQ ID NO: 10-12, or consecutive 16-22-mer portions of SEQ ID NO: 10-12. In some aspects, the antisense oligonucleotide comprises a nucleotide sequence identical to the nucleotide sequence of any sequence in SEQ ID NO: 10-137 (or the 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19-mer fragments of any sequence in SEQ ID NO: 10-137). In some respects, the antisense oligonucleotide comprises a nucleotide sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19-mer fragments of any of the sequences in SEQ ID NO: 10-137 (or fragments of 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotide substitutions). In some respects, antisense oligonucleotides include nucleotide sequences having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19-mer fragments of any sequence in SEQ ID NO: 10-137. In some respects, antisense oligonucleotides include 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30-mer nucleotide sequences containing the same continuous sequence as any of the sequences in SEQ ID NO: 10-137 (or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19-mer fragments of any of the sequences in SEQ ID NO: 10-137).

[0107] Diseases or conditions associated with ATXN2 include, but are not limited to, neurological disorders such as spinocerebellar ataxia, ALS, Parkinson's disease, frontotemporal dementia, and Alzheimer's disease, or protein disorders such as TDP43 proteinopathy.

[0108] In some respects, the pharmaceutical compositions according to this disclosure can be administered according to a dosing regimen (such as dose, frequency of dose, and duration of administration), wherein the dosing regimen can be selected to achieve the desired effect. For example, the desired effect may be to reduce the level of ATXN2 protein expression in a subject (or one or more of his / her cells or tissues), or to prevent, alleviate, improve, or slow the progression of one or more symptoms or diseases or conditions associated with ATXN2.

[0109] In some aspects, variables of the dosing regimen are adjusted to achieve the desired concentration of the antisense oligonucleotide in the subject to be treated. For example, in some embodiments, the dose and dosing frequency are adjusted to provide an amount of ATXN2 antisense oligonucleotide in the cells, tissues, or plasma sufficient to achieve the desired effect. In some aspects, the desired cell concentration may be 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, or 400 nM, or a concentration within the endpoint range defined by any pair of the above concentration values. In some respects, a composition comprising 0.001 to 250 mg / ml of at least one antisense oligonucleotide described herein may be administered to a subject.For example, in some aspects, the method according to this disclosure may include administering a pharmaceutically acceptable dosage form, including the following: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69. 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 13 5, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 1 93, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249 or 250mg (or any quantity within the range defined by any pair of the above values) one or more antisense oligonucleotides as described herein.For example, a liquid formulation suitable for administration may contain 5-20 mg of the antisense oligonucleotide described herein dissolved in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 ml (or the volume within the range defined by any pair of the above values).

[0110] Dosage depends on the severity and responsiveness of the disease being treated, and the course of treatment can range from several days to several months, or until an effective cure or remission of the disease state. Dosage also depends on the potency and metabolism of the drug. In some respects, the dosage is from 0.01 µg to 100 mg per kilogram of body weight, or in the range of 0.001 mg to 1000 mg, and may be administered once or more daily, weekly, monthly, quarterly, semi-annually, or annually. For example, the dosage may include 10, 20, 30, 40, 50, 60, 70, 80, or 90 mg / kg (or the amount per kg within any pair of values ​​defined above), administered 1, 2, or 3 times daily (e.g., by means of a liquid formulation containing 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mL). After successful treatment, patients may need to receive maintenance therapy to prevent relapse of the disease state. The maintenance dose of antisense oligonucleotides ranges from 0.01µg to 100mg per kg of body weight, administered once or more daily, weekly, monthly, quarterly, semi-annually, or annually.

[0111] Example The invention will be described in more detail through the following embodiments. However, it should be understood that the invention is not limited in any way to these embodiments.

[0112] Example 1: Identification of Humans Targetable variable splicing events Materials and Methods On the UCSC Genome Browser, for humans ATXN2 Genes were visualized, and the presence of alternative splicing events in the mRNA transcripts that could lead to the formation of premature stop codons was examined.

[0113] result Four druggable alternative splicing events were identified. Figure 1Three variable 5' splicing sites were found in exon 8, resulting in 47nt inclusion, 70nt skipping, or 25nt skipping events, each leading to an early stop codon in exon 9; alternative splicing in exon 18—skipping a 61nt / 67nt exon—resulted in an early stop codon in the next included exon (exon 19a, 19b, or 20). The various ASOs described in this paper were designed to increase the incidence of these alternative splicing events and reduce ATXN2 protein levels. Figure 2 ).

[0114] Example 2: Regulation of ASO-mediated exon 8 and exon 18 splicing in cell lines Materials and Methods As shown in Table 1 below, the variable splicing events surrounding exon 8 ( Figure 1 ASOs were designed. ASOs C1 and C5 (SEQ ID NO: 8 and 9, respectively) were designed as non-targeting control ASOs; C1 targeted... SMN1 and SMN2 C5 does not target any gene.

[0115] Table 1 Oligonucleotides designed to regulate exon 8 splicing.

[0116] In addition, an ASO targeting the region surrounding exon 18 was designed.

[0117] Table 2 Oligonucleotides designed to regulate exon 18 splicing.

[0118] ASO was tested in cell lines (A549, HEK293, T98G, or U2OS) using the Lipofectamine transfection reagent (ThermoFisher #13778075). Cells were transfected the day after plating, and total RNA was isolated and reverse transcribed into cDNA using the RNEasy Mini kit (Qiagen #74104).

[0119] To characterize the splicing of exon 8 region, primers were designed to amplify the target region, and PCR was performed. PCR products were visualized on agarose or acrylamide gels. Figure 3 , Figure 5 and Figure 6 ). Figures 3-4The primer sequences amplify the regions of exon 7 to exon 10, namely AAATTATGGTGTAGTGTCTACG (forward) and TGATGGCATGGAGCCCGAT (reverse). Figures 5-7 The primer sequences amplified the 47nt contained region of exon 8, namely AATTCCAGTGAACGTGAGGG (forward) and GTGGATCTTGATGGCATGGA (reverse).

[0120] To characterize the splicing of exon 18, primers were designed to amplify the exon 17 to exon 20 region, and PCR was performed. The PCR products were visualized on an acrylamide gel. Figure 8 The primer sequences are CTACCCCAACTTCACCTCGG (forward) and CGCTGTTGGGGCATATTTGG (reverse).

[0121] To quantify the use of alternative splicing events, density analysis of acrylamide gel images was used to quantify PCR product bands. Figure 4 , Figure 7 and Figure 9 ).

[0122] result First acrylamide gel image ( Figure 3 Four distinct bands were observed in the sample, compared with... Figure 1 The different splice isomers in exon 8 region are shown. In the control sample (C1), the bands representing alternative splice isomers were found to be very weak or absent, but became dominant in some ASO-treated samples. Band density analysis was performed ( Figure 4 The changes in splicing were quantified. Compared to PBS, ASO promoted the use of 47nt inclusion in all tests. The inclusion rate was 8% in PBS, increasing to a range of 18%–56% after ASO treatment. A 25nt truncation event was observed in most (but not all) of the ASO tests. Its inclusion rate was 0% in PBS; 13% in A9; and 5%–66% in A217–A223, increasing with increasing ASO length. A 70nt truncation event was observed only in the A6 event, although A6 promoted a high usage rate of 53%–63% for this event.

[0123] Further screening was conducted to determine the optimal ASO for splice modulation, and the results are as follows: Figure 5 As shown. Some results were confirmed using acrylamide gel electrophoresis. Figure 6 The bands were quantified, and the results showed that some samples treated with ASO were present in all samples. ATXN2Up to 60% of the 47nt transcripts contain isoforms. Figure 7 These ASOs can induce NMD-mediated... ATXN2 The decay of the 47nt band and its expression were reduced. The opposite effect was also observed in some ASO-treated samples, with the 47nt band disappearing, suggesting that these ASOs can reduce NMD-mediated decay. ATXN2 The decay of ATXN2 increases its level.

[0124] Screening of exon 18 regions identified several ASOs that effectively induce exon skipping, thereby generating NMD isomers. Figure 8 Density analysis showed that, using the most efficient ASO, exon 18 skipping rates reached over 80%. Figure 9 Effects on 33nt and 45nt exon splicing were also observed.

[0125] These experiments demonstrate that ASO can effectively regulate Splicing. It is also worth noting that the inclusion rate is likely underestimated because included isoforms are susceptible to NMD decay, while isoforms that have already decayed in the cell cannot be measured.

[0126] Example 3: Dose-dependent regulation of the 47nt content of exon 8 by ASO Materials and Methods To confirm that splicing alterations are an on-target mechanism, a dose-response experiment was performed. Following the same protocol described in Example 2, ASO 6, 9, and 28 were transfected into T98G cells at increasing doses (1, 2.5, 5, 10, 25, 50, and 100 nM ASO concentrations). Figure 10 As shown, isoform expression of samples at selected doses (100 nM, 50 nM, 25 nM, and 10 nM) is visualized on agarose gel.

[0127] result Compared to the control, all selected ASOs induced 47 nt of ( ) at all detection doses. Figure 10 The observation that the content increased with increasing ASO dosage confirmed this dose-dependent change. This supports the direct effect of ASO. ATXN2 The assumption of variable splicing.

[0128] The Q22 mouse model (containing human) was used. ATXN2 In a transgenic mouse model of the genomic region insert (see Example 8), dose-dependent splicing changes of selected ASOs were observed in vivo.

[0129] Example 4: Digital PCR confirms changes contained in 47nt Digital PCR (dPCR) was used to accurately and directly quantify the splice content contained in 47 nt ( Figures 11-16 The Qiagen Qiacuity dPCR instrument was used. The dPCR reaction consisted of a 47nt inclusion region primer for exon 8 as described in Example 2, a HEX probe located in exon 9 for measuring overall gene abundance, and a FAM probe spanning the exon 8-exon 9 linker for measuring canonical exon 8. Representative dPCR readings are shown below. Figures 11-12 The 47nt isomer group is circled. The percentage of the total number of isomers containing the 47nt isomer group is shown as the inclusion rate. Figures 13-15 Cell lines measured during screening included HEK293, A549, and T98G. Dosage-response experiments were performed in T98G cells (as in Example 3). Figure 16 ).

[0130] result The results of splicing dPCR quantification were consistent with those of Example 2, and some experiments showed that the inclusion rate in ASO-treated samples was as high as 80%. Figures 13-15 Furthermore, dPCR quantification of the dose-response assay confirmed the dose-response effect observed in agarose gels and supports the on-target mechanism of ASO. Figure 16 ).

[0131] Example 5: Assessment of ASO Regulation Using RNA-seq Materials and Methods The extracted RNA was used for next-generation Illumina RNA sequencing. Each sample generated approximately 50 million 150 bp end-chain reads. The raw FASTQ was processed, and its quality was checked using various metrics including overall and per-base sequence quality, nucleotide enrichment, genome coverage, and genome distribution. For final visualization and quantification, the samples were processed to remove ribosomal RNA reads, aligned to the human genome (GRCh38) using the STAR two-way alignment method, and converted to wiggle files for visualization. Adaptor read annotation and read quantification were performed using a custom script. Reads were visualized in the UCSC Genome Browser. Four adapters were observed terminating at the start of exon 9: a canonical adapter (complete exon 8), a 47 nt contained adapter, a 70 nt skipped adapter, and a skipped adapter (exon 8 was completely skipped). The count of each adapter was used to determine the splicing ratio. The proportion of each adapter was calculated and multiplied by the total count of adapters terminating at exon 9 to obtain the splicing ratio. Figure 17 The quantitative results are shown.

[0132] result RNA-seq data showed that, compared with untreated samples, T98G cells transfected with A9 exhibited significant changes at the RNA level. Figure 17 ). Observed coverage ATXN2 Overall gene readouts decreased. An increased coverage of the 47nt gene was observed, quantified to represent 50% of all linkers ending in exon 9, indicating effective regulation of ASO. In contrast, treatment with A8 showed little difference in both metrics compared to the control sample, suggesting it is not an effective ASO. This was observed in A549 cells transfected with A6 and A22. The relative levels of adapter readings supporting 47nt inclusion and 70nt skip-read exon adapters were significantly increased compared to the standard adapter. Figures 18-19 This indicates that effective ASOs (such as A9, A6, and A22), after transfection into cells, promote the use of 47nt inclusion and / or 70nt skip-read 5' splice sites, and reduce... ATXN2 The overall level was adjusted as expected. .

[0133] Example 6: ASO processing Regulation of expression Materials and Methods After ASO transfection, cDNA was obtained according to the above method or using the TaqMan 2-Step Cells-to-CT Kit (ThermoFisher #4399002). Quantitative PCR (qPCR) analysis was used to measure cDNA. ATXN2 The abundance, and with GAPDH (ThermoFisher Hs04420632_g1) or MRPL19 The expression (ThermoFisher Hs00608519_m1) is used as a reference. The expression was measured using the 2848 analysis method (ThermoFisher Hs01002848_m1).

[0134] A dose-response experiment was conducted by treating U2OS cells with increased doses of A9 and A28 ASO, and the results were measured using the 2848 assay. level.

[0135] result Corroborating the RNA-seq analysis, the 2848 assay was observed in many samples treated with ASO targeting exon 8 or exon 18. The expression level decreased significantly. Figures 20-22 This indicates that some tested ASO methods can effectively promote... ATXN2Reduced expression of canonical / functional isomers. In summary, these results indicate that efficient splicing regulation is associated with efficient... The relevant information has been downgraded.

[0136] qPCR analysis of U2OS cells treated with increased levels of ASO confirmed that the tested ASO levels decreased in a dose-dependent manner. The expression ( Figures 23-24 ). Calculations show that the ICs of A9 and A28... 50 The values ​​are 3.7 nM and 1.7 nM, respectively.

[0137] Example 7: Regulation of ATXN2 protein expression by ASO treatment Materials and Methods HEK293 and T98G cells were lysed after 2 days of ASO treatment. ATXN2 was detected using the BD #611378 antibody (measured by anti-mouse secondary antibody-HRP) and its levels were normalized to either total protein (total protein assay module, DMTP01, measured by streptavidin-HRP) or villous plaque protein (Vinculin) (Cell Signaling Technology, rabbit mAb, E1E9V, measured by anti-rabbit secondary antibody-NIR). Quantification was performed using Compass for Simple Western Medicine software.

[0138] result Regarding the aforementioned ability to reduce A significant decrease in ATNX2 protein levels was consistently observed in all expressed ASOs. Figures 25-30 This indicates that the tested ASO effectively reduced ATXN2 protein expression by inducing specific splicing changes, reducing the expression of the canonical isoform, and inducing the expression of the PTC-containing isoform.

[0139] Example 8: Effective reduction of ATXN2 protein expression in vivo using ASO Materials and Methods The Q22 mouse model (Dansithong, PloS Genet. 2015) includes the entire human bacterial artificial chromosome (BAC). ATXN2 Multiple copies of the trans gene (16kb from the 5' end to 3kb from the 3' end, normal copy number of CAG repeats (22)). Normal mice ATXN2 Transcripts are unaffected.

[0140] ASO was reconstituted in 1×PBS (ThermoFisher Scientific, 10010023), and the concentration of the ASO solution was determined by absorbance at OD260 nm. For dosing solutions, the reconstituted ASO was diluted to the desired concentration with PBS. PBS was used as a solvent control. For ICV injection in adult mice, mice were anesthetized by inhalation with 1.5% isoflurane at a flow rate of 0.8 L / min. ASO or PBS solution was slowly injected into one unilateral ventricle at a rate of 1 μL / min. Mice were returned to their cages shortly after injection, and their survival and signs of stress were observed daily. Fourteen days after injection, mice were euthanized, and relevant tissues were dissected. The tissues were divided into two parts: one for RNA extraction and the other for processing to extract cell lysates for protein quantification using SimpleWestern Jess capillary blot. RNA was reverse transcribed into cDNA, amplified, and run on an acrylamide gel. Primer sequences were AAATTATGGTGTAGTGTCTACG (forward) and TGATGGCATGGAGCCCGAT (reverse). ATXN2 was detected using the BD#611378 antibody (measured by anti-mouse secondary antibody-HRP) and its levels were normalized to total protein (total protein detection module, DMTP01, measured by streptavidin-HRP) or villous protein (Vinculin) (Cell Signaling Technology, rabbit mAb, E1E9V, measured by anti-rabbit secondary antibody-NIR). Quantification was performed using Compass for Simple Western Jess software.

[0141] result Compared to WT mice, Q22 mice showed higher levels of ATXN2 protein, which was expected because antibodies cannot distinguish between human and mouse proteins, and Q22 mice express both endogenous mouse and human proteins. Mice injected with ASO showed a reduction in total ATXN2 protein expression (see [link to ASO documentation]). Figures 31-34 The reduction in human ATXN2 can be estimated by considering the differences between WT ATXN2 (mouse protein only) and Q22 ATXN2 (mouse plus human protein); this is possible because splicing events are not conserved in mice (they do not exist), and ASO has been shown to be effective in mice. ATXN2 Expression was not affected (data not shown in mouse cell lines and WT mice). After ASO treatment, the cerebellum ( Figure 32 ) and spinal cord ( Figure 34 Significantly reduced levels of human ATXN2 were observed in [the study]. Further dose-dependent splicing changes and protein reduction were observed in various ASOs tested in mouse models.

[0142] Finally, it should be understood that while this specification emphasizes various aspects by referring to specific embodiments, those skilled in the art will readily understand that these disclosed embodiments merely illustrate the principles of the subject matter disclosed herein. Therefore, it should be understood that the disclosed subject matter is by no means limited to the specific compounds, compositions, articles, instruments, methods, procedures, and / or reagents described herein, unless explicitly stated otherwise. Furthermore, those skilled in the art will recognize that certain changes, modifications, arrangements, alterations, additions, reductions, and sub-combinations can be made based on the teachings herein without departing from the spirit of this specification.

[0143] When referring to embodiments or aspects of embodiments, the terms "may" or "can" are used with the alternative meaning of "cannot" or "cannot". Therefore, if this specification discloses that a structural feature, element, or function can or can be included, then a negative limitation or exclusionary proviso is also explicitly intended to mean that, alternatively, that structural feature, element, or function can be excluded. Similarly, when referring to embodiments or aspects of embodiments, the term "optionally" means that the embodiment or aspect of the embodiment may or may not be included. Whether such a negative limitation or exclusionary proviso applies will depend on whether it is referenced in the subject matter of the claims.

[0144] The use of numerical ranges in this document is intended only as a shorthand for individually referring to each individual value falling within a range. Unless otherwise stated herein, each individual value within a numerical range is included in this specification as if described separately herein. Where a range is given, the endpoints are also included. Furthermore, it should be understood that, unless otherwise stated, or as can be discerned from the context and by one of ordinary skill in the art, a value expressed as a range can be any specific value within the range or a subrange up to one-tenth of the lower limit unit of the range, unless the context explicitly specifies otherwise.

[0145] The terms “a,” “an,” “the,” and similar references used in the context describing aspects of this disclosure (particularly in the context of the appended claims) shall be construed as including both the singular and plural unless otherwise stated herein or clearly contradicted by the context. Furthermore, serial number indicators—such as “first,” “second,” “third,” etc.—are used to identify elements, to distinguish them, and do not indicate or imply a necessary or limited number of these elements, nor a particular position or order of these elements, unless specifically stated otherwise. Unless otherwise stated herein or clearly contradicted by the context, all methods described herein may be performed in any suitable order. The use of any and all examples or exemplary language provided herein (e.g., “such as”) is intended only to better elucidate this disclosure and does not constitute a limitation on the scope of any subject matter recited in this disclosure or the claims. No wording in this specification should be construed as indicating any non-claim element essential to the implementation of the invention as defined in the claims.

[0146] When used in claims, whether in filed claims or claims added according to amendments, the open-ended transitional term "comprising" (and its equivalent open-ended transitional phrases, such as including, comprising, and having) covers all expressly mentioned elements, limitations, steps, and / or features, whether used alone or in combination with unmentioned subject matter; mentioned elements, limitations, and / or features are essential, but other unmentioned elements, limitations, and / or features may be added, still forming a structure within the scope of the claims. In claims, the closed transitional phrases "consisting of" or "substantially consisting of" may be used in place of "comprising" or as modifications to "comprising" to further define the specific embodiments disclosed herein. When used in claims, whether in filed claims or claims added according to amendments, the closed transitional phrase "consisting of" excludes any elements, limitations, steps, or features not expressly stated in the claims. The closed transitional phrase "substantially consisting of" limits the scope of the claims to the expressly stated elements, limitations, steps, and / or features, as well as any other elements, limitations, steps, and / or features that do not substantially affect the essential and novel features of the subject matter of the claims. Therefore, the meaning of the open transition phrase "comprising" is defined as encompassing all specifically stated elements, limitations, steps, and / or features, as well as any optional, additional, unspecified elements, limitations, steps, and / or features. The meaning of the closed transition phrase "consisting of" is defined as including only those elements, limitations, steps, and / or features specifically stated in the claim, while the meaning of the closed transition phrase "substantially constitutes" is defined as including only those elements, limitations, steps, and / or features specifically stated in the claim, as well as those elements, limitations, steps, and / or features that do not substantially affect the essential and novel features of the claim subject matter. Therefore, the open transition phrase "comprising" (and its equivalents) is used as a limiting case to include the claim subject matter specified by the closed transition phrases "consisting of" or "substantially constitutes." Therefore, such embodiments described herein or those that present claims using the phrase "comprising" have explicitly or implicitly described, enabled, and supported the phrases "substantially constitutes" and "consisting of."

[0147] All patents, patent publications, and other publications referenced and cited in this specification are individually and expressly incorporated herein by reference in their entirety for the purpose of description and disclosure, such as compositions and methods described in these publications that may be used in this disclosure. These publications are intended only for disclosure prior to the date of filing of this application. All statements regarding the dates or contents of these documents are based on information available to the applicant and do not constitute any admission of the accuracy of the dates or contents of these documents.

[0148] sequence list

Claims

1. An antisense oligonucleotide, which is related to Target region hybridization in transcripts, wherein the hybridization of the antisense oligonucleotide with the target region reduces the Expression of functional proteins encoded by transcripts in cells.

2. The antisense oligonucleotide according to claim 1, wherein... Transcripts are precursor mRNA molecules.

3. The antisense oligonucleotide according to claim 1 or 2, wherein the antisense oligonucleotide is 15 to 25 nucleotides in length.

4. The antisense oligonucleotide according to any one of claims 1-3, wherein the antisense oligonucleotide is 18 to 20 nucleotides in length.

5. The antisense oligonucleotide according to any one of claims 1-4, wherein the antisense oligonucleotide comprises a nucleotide sequence of any one of SEQ ID NO: 10-137, or a fragment thereof.

6. The antisense oligonucleotide according to any one of claims 1-4, wherein the antisense oligonucleotide comprises a nucleotide sequence having 1, 2, 3, 4 or 5 nucleotide substitutions compared to any one of the sequences in SEQ ID NO: 10-137, or a fragment thereof.

7. The antisense oligonucleotide according to any one of claims 1-4, wherein the antisense oligonucleotide comprises a nucleotide sequence, or a fragment thereof, having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with any one of the sequences in SEQ ID NO: 10-137.

8. The antisense oligonucleotide according to any one of claims 1-4, wherein the antisense oligonucleotide comprises: a) A nucleotide sequence identical to the consecutive 18-20-mer portions of any sequence in SEQ ID NO: 10-137; or b) A sequence of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides, having 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotide substitutions compared to any of the sequences in SEQ ID NO: 10-137 or their aligned portions.

9. The antisense oligonucleotide according to any one of claims 1-4, wherein the antisense oligonucleotide is 15-30-mer in length and comprises the same nucleotide sequence as any consecutive 16-20-mer portion of SEQ ID NO: 10-137, having 0, 1, 2, 3, 4 or 5 nucleotide substitutions.

10. The antisense oligonucleotide according to any one of claims 1-9, wherein the antisense oligonucleotide comprises one or more modified nucleotides.

11. The antisense oligonucleotide of claim 10, wherein the one or more modified nucleotides comprise modifications of a ribose group, a phosphate group, a nucleobase group, or a combination thereof.

12. The antisense oligonucleotide of claim 11, wherein the modification of the ribosyl group comprises 2'-O-methyl, 2'-fluorine, 2'-deoxy, 2'-O-(2-methoxyethyl) (MOE), 2'-O-alkyl, 2'-O-alkoxy, 2'-O-alkylamino, 2'-NH2, restricted nucleotides, or combinations thereof.

13. The antisense oligonucleotide of claim 12, wherein the restricted nucleotide comprises locked nucleic acid (LNA), ethyl restricted nucleotide, 2'-(S)-restricted ethyl (S-cEt) nucleotide, restricted MOE, 2'-O,4'-C-aminomethylene bridging nucleic acid (2',4'-BNANC), α-L-locked nucleic acid, tricyclic DNA, or combinations thereof.

14. The antisense oligonucleotide of claim 11, wherein the modification of the ribosyl group comprises 2'-O-(2-methoxyethyl) (MOE).

15. The antisense oligonucleotide of claim 11, wherein the modification of the phosphate group comprises thiophosphate, phosphonoacetate (PACE), thiophosphonoacetate (thioPACE), amide, triazole, phosphonate, phosphate triester modification or a combination thereof.

16. The antisense oligonucleotide of claim 11, wherein the modification of the nucleobase comprises 2-thiouridine, 4-thiouridine, N6-methyladenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5-methylcytosine, 5-substituted pyrimidine, isoguanine, isocytosine, one or more halogenated aromatic groups or combinations thereof.

17. A pharmaceutical composition comprising: At least one antisense oligonucleotide selected from the antisense oligonucleotides of any one of claims 1-16, and At least one pharmaceutically acceptable carrier, diluent, or buffer.

18. The pharmaceutical composition of claim 17, wherein the at least one antisense oligonucleotide comprises a plurality of antisense oligonucleotides with different sequences.

19. The pharmaceutical composition according to claim 17 or 18, wherein the at least one antisense oligonucleotide is present in the composition in an amount of 0.001 to 100 mg / ml.

20. The pharmaceutical composition according to claim 17 or 18, wherein the at least one antisense oligonucleotide is present in a unit dose amount.

21. The pharmaceutical composition according to claim 20, wherein the amount of the unit dose is from 0.001 to 100 mg.

22. A method for treating a disease or condition in a subject in need, comprising: a) Administering to the subject an effective amount of the antisense oligonucleotide of any one of claims 1-16 or the pharmaceutical composition of any one of claims 17-21; as well as b) To treat the disease or condition mentioned.

23. The method of claim 22, wherein the disease or condition is a neurodegenerative disease or a protein disease.

24. The method of claim 23, wherein the neurodegenerative disease includes spinocerebellar ataxia, ALS, Parkinson's disease, frontotemporal dementia, or Alzheimer's disease; and the protein disease includes TDP43 protein disease.

25. The method according to any one of claims 22-24, wherein treating the disease or condition includes preventing, alleviating, slowing down or eliminating one or more symptoms of the disease or condition.

26. The method according to any one of claims 22-25, wherein treating the disease or condition comprises improving the motor function of the subject by at least 10%, 15%, or 20%.

27. The method according to any one of claims 22-25, wherein treating the disease or condition comprises improving the subject's performance on the rotarod by at least 10%, 15%, or 20%.

28. The method according to any one of claims 22-27, wherein the effective amount is sufficient to reduce the expression of the protein encoded by ATXN2 in at least one cell or tissue of the subject.

29. The method of claim 28, wherein the cell is a nerve cell.

30. The method of claim 29, wherein the cell is a Purkinje cell.

31. The method according to any one of claims 22-30, wherein the administration is parenteral administration.

32. A cell comprising: The antisense oligonucleotide according to any one of claims 1-16.

33. A vector designed for expressing the antisense oligonucleotide of any one of claims 1-16.

34. A method to reduce coding in cells ATXN2 Methods for determining the amount or activity of the target mRNA of the isoform include: The cells are brought into contact with antisense oligonucleotides configured to hybridize with the target mRNA; as well as This leads to nonsense-mediated decay and degradation of the target mRNA transcript.

35. The method of claim 34, wherein the antisense oligonucleotide is configured to interact with... ATXN2 Multiple consecutive nucleotide hybridizations within the intron region of exon 8, exon 9, or between exon 8 and exon 9.

Citation Information

Patent Citations

  • Jingle gourd bottle

    CN3199565D

  • Label (White Dove Pomelo Drop)

    CN3201070D

  • Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation

    US20040171570A1

  • 4'-thionucleosides and oligomeric compounds

    US20050130923A1

  • Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides

    US4522811A