Construction method for synthesizing flora based on pure culture flora characteristics and application

Abstract

The invention discloses a construction method for synthesizing flora based on pure culture flora characteristics and application, and belongs to the technical field of agriculture. The method comprises the following steps: step 1, obtaining pure culture strain groups in different growth stages of crop rhizosphere through a culture omics method, and determining culturable core microorganism groups stably existing in each growth stage based on structural analysis of the pure culture strain groups; 2, strains corresponding to the core microorganisms are screened out from a strain group, and the community structure of the strains is directly determined according to the actual abundance of the strains obtained through culture omics; and step 3, analyzing the difference of the growth promoting functions of the synthetic flora with different structures through a crop tieback test. According to the method, the problem of poor correspondence between flora analysis data and used strain materials during construction of the synthetic flora is solved, so that the synthetic flora can better represent the structure and functional characteristics of a natural flora, and the effectiveness of the synthetic flora in scientific research and practical application is favorably improved.

Description

Technical Field

[0001] This invention belongs to the field of agricultural technology, and in particular relates to a method and application for constructing synthetic microbial communities based on the characteristics of pure cultured microbial communities. Background Technology

[0002] Synthetic microbial communities (SynComs) are an important tool for studying microbe-plant interactions. Currently, the construction of SynComs mainly follows this process: First, based on high-throughput sequencing data of 16S rRNA genes, bioinformatics methods such as differential abundance analysis, LEfSe linear discriminant analysis, and co-occurrence network analysis are used to identify the core functional microbial communities in the target environment. Then, candidate strains are obtained through isolation and culture, and the taxonomic consistency between the isolates and the target microbial communities is verified using full-length 16S rRNA gene sequencing. Next, the selected candidate strains undergo multi-dimensional functional characterization, focusing on evaluating their growth-promoting properties such as phosphate-solubilizing activity, siderophore secretion capacity, and IAA synthesis efficiency. Based on the principle of functional complementarity, 3-20 characteristic strains are selected for combination design, and the strain ratio is optimized and the population compatibility is evaluated through in vitro co-culture systems. Finally, synthetic microbial communities (SynComs) with specific ecological functions are constructed. However, the rhizosphere core microbial community ASVs (amplifier sequence variants) obtained through high-throughput sequencing do not directly correspond to the microbial strains isolated through pure culture. This is primarily because the former is based on the analysis of total DNA from environmental samples. In practice, we cannot precisely match every sequence in the total DNA sample to every strain isolated from that sample. Even if the DNA sequence of a strain perfectly matches the data obtained from high-throughput sequencing, they certainly do not originate from the same strain. Considering the functional differences at the strain level inherent in microorganisms, we believe that synthetic microbial communities constructed based on high-throughput sequencing data analysis may lack representativeness and cannot reliably reproduce the functions of microbial communities in the target environment.

[0003] There is an urgent need for a method and application for constructing synthetic microbial communities based on the characteristics of pure cultured microbial communities. Summary of the Invention

[0004] The purpose of this invention is to solve the above-mentioned technical problems and provide a method and application for constructing synthetic microbial communities based on the characteristics of pure cultured microbial communities. This technology does not require high-throughput sequencing analysis results of original soil samples as guidance, and solves the problem of poor correspondence between microbial community analysis data and strain materials used when constructing synthetic microbial communities. This enables synthetic microbial communities to better represent the structural and functional characteristics of natural microbial communities, and helps to improve the effectiveness of synthetic microbial communities in scientific research and practical applications.

[0005] To achieve the above objectives, the present invention mainly provides the following technical solutions:

[0006] First, embodiments of the present invention provide a method for constructing synthetic bacterial communities based on the characteristics of pure cultured bacterial communities.

[0007] The method includes the following steps:

[0008] Step 1: Obtain pure culture strains at different growth stages of crop rhizosphere using cultinomy methods. Based on the structural analysis of the pure culture strains, identify the culturable core microbial groups that are stable at each growth stage.

[0009] Step 2: Screen out strains corresponding to these core microorganisms from the strain community. The community structure is directly determined based on the actual abundance of strains obtained from culture omics.

[0010] Step 3: Analyze the differences in the growth-promoting functions of synthetic microbial communities with different structures through crop re-inoculation experiments.

[0011] Furthermore, step 1 includes the isolation and purification of bacteria and screening of core rhizosphere microorganisms.

[0012] Further, in step 1, the isolation and purification of the bacteria are specifically as follows: 1. Soil samples from the soybean rhizosphere at week 0 (original soil, W0), week 1 (emergence stage, W1), week 3 (three-leaf stage, W3), week 5 (flowering stage, W5), and week 7 (pod formation stage, W7) are weighed and placed in sterile centrifuge tubes and serially diluted with sterile PBS buffer. An appropriate amount of the diluted solution is spread on a plate for subsequent bacterial isolation.

[0013] 2. Incubate the coated R2A solid plates at 28°C for 3-4 weeks, observe daily and pick newly appearing colonies, purify them by continuous streak method, and use the purified strains for subsequent experiments.

[0014] 3. An optimized high-throughput two-end barcoding method combined with high-throughput sequencing technology was used for rapid systematic classification and identification of bacterial strains. The purified strains were sequentially inoculated into numbered 96-well plates, and PCR amplification was performed using primers designed based on the universal 16S rRNA gene primers 515F and 907R. A barcode sequence was added to the leader primer to distinguish the location of strains within the 96-well plate, and a barcode sequence was added to the follow-up primer to distinguish different 96-well plate numbers. After all PCR products were mixed and purified, sequencing was performed using a HiSeq2500 PE250 sequencing platform. The corresponding strains were determined based on the barcode markings, completing the species identification of all strains. Finally, strain groups containing characteristic bacterial groups at these growth stages were obtained, corresponding to the original soil (W0) and the rhizosphere at weeks 1, 3, 5, and 7 (W1, W3, W5, W7), and were named the original soil (T0) and the rhizosphere at weeks 1, 3, 5, and 7 (T1, T3, T5, T7), respectively.

[0015] Furthermore, the screening of core rhizosphere microorganisms specifically involves: based on data analysis of the composition and structure of strains at various stages of soybean growth, genera present at all stages are identified as core microbial genera. Three isolated strains are randomly selected from each core genus, resulting in a total of 23 core microbial genera. These 23 core microbial genera are Variovorax, arthrobacter, Streptomyces, Pseudomonas, Agrobacterium, Stenotrophomonas, Microbacterium, Agromyces, Bacillus, Nocardioides, Phyllobacterium, Pseudoxanthomonas, Ensifer, Lysobacter, Kribbella, Paenarthrobacter, Sphingopyxis, Bosea, Chryseobacterium, Chitinophaga, Caulobacter, Saccharothrix, and Mesorhizobium.

[0016] Further, in step 2, bacterial culture was aspirated from the corresponding deep-well plate according to the sequencing number, spread onto R2A solid medium, and incubated upside down at 28°C for two days. Single colonies were then picked and purified using the streak plate method until pure cultures were obtained. Sixty-nine pure cultures of core microbial genera were inoculated into R2A liquid medium, and bacterial cells were collected and total DNA extracted using a TIANamp Bacteria DNA Kit. This DNA was then used as a template to amplify the 16S rRNA gene. After sequencing and assembly, the results were compared using the EzBioCloud database (https: / / www.ezbiocloud.net / ) to complete the molecular identification and genus-level classification of the strains. Subsequently, the relative abundance of 23 core genera in the strain set at different growth stages was quantified. These abundances were then used to construct SynComs, which summarized the stage-specific structural characteristics of the rhizosphere microbiota.

[0017] Furthermore, in step 2, three isolates were randomly selected from each core genus and combined in equimolar ratios to represent each genus in the final SynCom assembly. The synthetic communities included native (SC0), week 1, week 3, week 5, week 7 (SC1, SC3, SC5, SC7), and homogenized (SCp) communities.

[0018] Furthermore, in step 2, the 69 strains used to construct the time-series core microbial community were prepared after shaking culture. The bacterial suspension was serially and sequentially diluted. Each dilution was then plated onto R2A plates (five replicates per gradient) and incubated upside down at 28°C for 1–3 days. Colony counting was performed, and colony forming units (CFU / mL) were calculated. Finally, a standard curve was established, plotting the OD value of each strain on the x-axis and the corresponding CFU value on the y-axis, to determine the one-to-one correspondence between the OD values ​​and CFU of the 69 strains.

[0019] The inoculum for each strain used to construct the time-series core microbial community was prepared according to the following procedure: First, the strains were cultured in liquid medium with shaking for 3 days. Based on the standard curves and results obtained from previous experiments, the growth rates of these 69 bacterial strains varied: some strains grew faster, and some slower. At this culture duration, the fast-growing strains had entered the stationary phase and exhibited lower activity; while the slow-growing strains remained in the logarithmic growth phase and showed higher activity. Subsequently, 500 μL of the above-mentioned 3-day culture solution was used as inoculum and transferred to the same fresh R2A liquid medium for further culture; the original culture was cultured for another day (i.e., co-cultured for 4 days). After this treatment, the fast-growing strains, having regained sufficient nutrients, entered the logarithmic growth phase and exhibited high activity; while the slow-growing strains, having just been transferred to a new environment, were still in the lag phase and exhibited lower activity. In the original culture solution cultured for the fourth day, the fast-growing strains remained in the stationary phase and showed poor activity; the slow-growing strains remained in the logarithmic growth phase and exhibited high activity. Thus, we obtained four strains in different physiological states: the fast-growing strains exhibited high activity (1 day after transfer) and low activity (4 days in stock solution); the slow-growing strains also exhibited high activity (4 days in stock solution) and low activity (1 day after transfer). Mixing the same strains corresponding to high and low activity ensures that all strains are in a high-activity state for subsequent community construction.

[0020] Next, to construct synthetic communities at different growth stages (SC0, SC1, SC3, SC5, SC7, SCp), we calculated the required volume of inoculum for each strain at each stage based on the OD600 value of each bacterial strain, the established standard curve between OD values ​​and colony-forming units (CFU) of 69 strains, and the actual abundance ratio of each strain. After mixing the bacterial suspensions of all strains according to the calculated volume, the concentration of the resulting mixed bacterial suspension was 10¹¹ CFU / mL. Finally, the mixed bacterial suspension was centrifuged at 8000 rpm for 10 minutes, the supernatant was discarded, and the bacterial body was resuspended in sterile 0.7% NaCl physiological saline and brought to a final volume of 1000 mL, thus precisely adjusting the concentration of the final inoculum to 10¹¹ CFU / mL. 8 CFU / mL was used for subsequent plant inoculation experiments.

[0021] Furthermore, step 3 includes soybean pot experiments and inoculation tests, as well as the determination of total nitrogen and total phosphorus in the plants.

[0022] This invention uses the soybean variety 'Zhonghuang 13' as the experimental material. The experimental soil was collected from the Yangling Caoxinzhuang Experimental Farm, air-dried and sieved, then mixed with vermiculite and perlite in a mass ratio of 10:2:1. Water was added and stirred thoroughly to prepare the cultivation substrate. The mixed substrate was dispensed into heat-resistant planting bags, sterilized at high temperature, and then cooled for later use. Plump, uniform, and healthy soybean seeds were selected and surface-sterilized. Seeds with consistent germination were selected and transplanted into the prepared planting bags under aseptic conditions. All plants were placed in a greenhouse for uniform cultivation.

[0023] The inoculation experiment consisted of four treatment groups: a time-series dynamic group (W0, W1, W3, W5, W7), a homogenized ratio group (Wp), a sterilized control group (Ws, prepared by high-temperature sterilization of Wp bacteria), and a blank control group (CK, with an equal volume of sterile water added). After the first pair of true leaves unfolded, the bacterial suspensions were inoculated at the base of the seedlings using a sterile syringe. Each treatment group received 5 mL of the corresponding bacterial suspension (bacterial concentration of 1×10⁻⁶) per plant. 11 CFU·mL⁻¹, ensuring a total inoculation amount of 5×10⁻¹ per plant. 8 The control group was inoculated with an equal volume of sterile water (5 ml). Each treatment group had 5 biological replicates, with 3 plants per replicate (i.e., 15 plants per treatment). After inoculation, 30 mL of sterile water was applied every 2 days to meet the plants' normal water requirements. 30 days after inoculation, samples were taken, the planting bags were cut open, and the plants were removed intact. The aboveground and underground parts were separated using sterile scissors. The aboveground parts were placed directly into envelopes; the underground parts were gently shaken to remove large clumps of soil, washed with sterile water, and then placed into another envelope. All samples were dried in an 80℃ oven for 5 days until constant weight. The dry weight of the aboveground and underground parts was weighed separately, and the total nitrogen and total phosphorus contents of the aboveground and underground parts were determined. The total nitrogen content of the plants was determined using the H2SO4-H2O2 digestion method on an AA3 type continuous flow analyzer. Total phosphorus in plants was determined using the H2SO4-H2O2 digestion method and the molybdenum-antimony colorimetric method in a UV-1900i (Shimadzu) instrument.

[0024] Secondly, this embodiment of the invention also provides the application of the synthetic microbial community established by the method of constructing synthetic microbial communities based on the characteristics of pure cultured microbial communities in the crop planting process.

[0025] Furthermore, the crop in question is soybean.

[0026] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0027] The technical solution of this invention does not require high-throughput sequencing analysis results of the original soil samples as guidance, and solves the problem of poor correspondence between microbial community analysis data and strain materials used when constructing synthetic microbial communities. This enables synthetic microbial communities to better represent the structural and functional characteristics of natural microbial communities, and helps to improve the effectiveness of synthetic microbial communities in scientific research and practical applications. Attached Figure Description

[0028] Figure 1 The community composition of dominant phyla in the rhizosphere of soybean at different growth stages;

[0029] Figure 2 (a) The distribution of common and unique genera of microbial communities at the genus level in soybean at different growth stages; (b) The proportion of core genera ASVs and all genera ASVs in soybean at different growth stages.

[0030] Figure 3 Procrustes analysis and Simpson diversity correlation analysis were performed on the four datasets. (a) Procrustes analysis was used to investigate the correlation between high-throughput sequencing data of complete rhizosphere microbial communities (dots) and high-throughput sequencing data of core rhizosphere microbial communities (circles) at different growth stages of soybean. (b) Procrustes analysis was used to investigate the correlation between high-throughput sequencing data of complete rhizosphere microbial communities (dots) and rhizosphere complete community culture data (circles) at different growth stages of soybean. (c) Procrustes analysis was used to investigate the correlation between rhizosphere complete community culture data (dots) and rhizosphere core synthetic community data (circles) at different growth stages of soybean. (d) Procrustes analysis was used to investigate the correlation between high-throughput sequencing data of core rhizosphere microbial communities (dots) and rhizosphere core synthetic community data (circles) at different growth stages of soybean. (e) The regression coefficient of the Simpson index between high-throughput sequencing data of complete rhizosphere microbial communities and high-throughput sequencing data of core rhizosphere microbial communities at different growth stages of soybean. (f) Regression coefficients of the Simpson index between high-throughput sequencing data of intact rhizosphere microbial communities at different growth stages of soybean and data from cultured rhizosphere communities. (g) Regression coefficients of the Simpson index between cultured rhizosphere communities at different growth stages of soybean and data from rhizosphere core synthetic communities. (h) Regression coefficients of the Simpson index between high-throughput sequencing data of core rhizosphere microbial communities at different growth stages of soybean and data from rhizosphere core synthetic communities.

[0031] Figure 4 The dry weight of soybean plants 30 days after inoculation with each core microbial community is shown in (a) aboveground dry weight and (b) underground dry weight. * and ** indicate differences between groups at the P<0.05 and P<0.01 levels, respectively, and the test method is t.test.

[0032] Figure 5 The total nitrogen and total phosphorus contents of soybeans 30 days after inoculation with each core microbial community were calculated as follows: (a) total nitrogen content in the aboveground parts; (b) total nitrogen content in the underground parts; (c) total phosphorus dry weight in the aboveground parts; and (d) total phosphorus dry weight in the underground parts. * and ** indicate differences between groups at the P<0.05 and P<0.01 levels, respectively, and the test method was t.test.

[0033] Figure 6 (a) Bacterial α-diversity (Shannon index) of bulk soil and rhizosphere soil at different time points. "*" indicates significant differences in Shannon index between different soybean growth stages. (b) Bacterial β-diversity of bulk soil and rhizosphere soil, analyzed using principal coordinate analysis (PCoA). (c) Differences in Shannon index between bulk soil and rhizosphere soil at different soybean growth stages. "*" indicates significant differences in Shannon index between bulk soil and rhizosphere soil at different soybean growth stages.

[0034] Figure 7 The relative abundance of the top ten bacterial phyla in bulk soil and rhizosphere soil samples. (ab) The effect of soybean growth stage on the relative abundance of bacterial phyla in (a) bulk soil and (b) rhizosphere soil.

[0035] Figure 8 (a) Alpha diversity of core microbial genera that maintained stable relative abundance across all growth stages. (b) Principal coordinate analysis (PCoA) of core microbial communities based on Bray-Curtis distance. (c) Regression coefficients of the Simpson diversity index between total rhizosphere ASVs (RASimpson) and core ASVs (RC Simpson). (d) Procrustes analysis comparing the overall differences between rhizosphere ASVs and core ASVs at each growth stage. Detailed Implementation

[0036] Exemplary embodiments of the invention will now be described in more detail with reference to the accompanying drawings. While exemplary embodiments of the invention are shown in the drawings, it should be understood that the invention may be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this invention will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

[0037] Experimental procedure:

[0038] Isolation and purification of bacteria

[0039] 1. Weigh 1 g of soil samples from the soybean rhizosphere at week 0 (original soil, W0), week 1 (emergence stage, W1), week 3 (three-leaf stage, W3), week 5 (flowering stage, W5), and week 7 (pod formation stage, W7), and place them in sterile 10 mL centrifuge tubes. Add sterile PBS buffer to a final volume of 10 mL and vortex for 15-20 seconds to mix. Then, transfer 1 mL of the suspension to a new sterile 10 mL centrifuge tube, and again bring the volume to a final volume of 10 mL with PBS buffer, vortexing to mix. Repeat the above steps for serial dilution. Spread an appropriate amount of the diluted solution onto agar plates, controlling the dilution to ensure approximately 100 bacterial colonies grow on each plate for subsequent bacterial isolation.

[0040] 2. Spread the diluted soil suspension evenly onto R2A solid medium, with three replicates for each soil sample, for a total of 30 plates per period. Incubate at 28°C for 3-4 weeks, observing and recording the formation of new colonies daily. Pick newly formed colonies promptly and purify them using the streak plate method. The purified strains are used for subsequent experiments.

[0041] 3. An optimized high-throughput two-end barcoding method combined with high-throughput sequencing technology was used for rapid systematic classification and identification of bacterial strains. The purified strains were sequentially inoculated into numbered 96-well plates, and PCR amplification was performed using primers designed based on the universal 16S rRNA gene primers 515F and 907R. A barcode sequence was added to the leader primer to distinguish the location of strains within the 96-well plate, and a barcode sequence was added to the follow-up primer to distinguish different 96-well plate numbers. After all PCR products were mixed and purified, sequencing was performed using a HiSeq2500 PE250 sequencing platform. The corresponding strains were determined based on the barcode markings, completing the species identification of all strains. Finally, strain groups containing characteristic bacterial groups at these growth stages were obtained, corresponding to the original soil (W0) and the rhizosphere at weeks 1, 3, 5, and 7 (W1, W3, W5, W7), and were named the original soil (T0) and the rhizosphere at weeks 1, 3, 5, and 7 (T1, T3, T5, T7), respectively.

[0042] Screening of core rhizosphere microorganisms

[0043] Based on data analysis of the composition and structure of bacterial strains at different stages of soybean growth, genera present at all stages were identified as core microbial genera. To minimize potential bias caused by functional heterogeneity among strains within the same genus, three isolates were randomly selected from each core genus. Ultimately, a total of 23 core microbial genera were identified (Table 1), with each genus containing 3 strains, for a total of 69 strains (Table 2). Subsequently, based on the sequencing results, 40 μL of bacterial culture was aspirated from the corresponding deep wells, spread onto R2A solid medium, and incubated at 28°C for two days. Single colonies were then picked and subcultured using the streak plating method onto fresh solid medium. This process was repeated multiple times to ensure pure cultures. The 69 pure cultures of the core microbial genera were inoculated into 5 mL of R2A liquid medium and cultured at 28°C and 180 rpm for 3 days with shaking. Subsequently, bacterial cells were collected and total DNA was extracted using the TIANamp Bacteria DNA Kit. Using extracted DNA as a template, the 16S rRNA gene was amplified by PCR using universal primers 27F and 1492R, and the product was sequenced. Finally, the obtained sequences were spliced ​​and proofread, and compared with the EzBioCloud database (https: / / www.ezbiocloud.net / ) to complete the molecular identification of the strains and further determine their genus-level taxonomic information. Subsequently, we quantified the relative abundance of 23 core genera in the strain ensemble at different growth stages. These abundances were then used to construct SynComs proportionally, which summarized the stage-specific structural features of the rhizosphere microbiota. Furthermore, to minimize potential biases caused by functional heterogeneity among strains within the same genus, we randomly selected three isolates from each core genus and combined them in equimolar ratios to represent each genus in the final SynCom assembly. The synthesized communities included native soil (SC0), week 1, week 3, week 5, week 7 (SC1, SC3, SC5, SC7), and homogenized (SCp) communities.

[0044] The 69 bacterial strains used to construct the time-series core microbial community were all cultured for 3 days at 28°C and 180 rpm in 100 mL R2A liquid medium with shaking. 50 μL of the bacterial culture was added to 500 mL of sterile water to prepare 10⁻ 4The bacterial suspension was then serially diluted, with volumes of 200 μL, 160 μL, 120 μL, 80 μL, 40 μL, and 0 μL (blank control) added to 96-well plates. Each well was then brought to a final volume of 200 μL with sterile water. Three replicates were performed for each dilution to determine the OD value. Simultaneously, the above-mentioned... The diluted bacterial culture was further serially diluted 10-fold to obtain... Four dilutions were used. 50 μL of each dilution was spread onto R2A agar plates, with five replicates per dilution. The plates were incubated upside down at 28°C for 1–3 days, followed by colony counting and calculation of colony forming units (CFU / mL). Finally, a standard curve was established, plotting the OD values ​​of each strain at different dilutions on the x-axis and the corresponding CFU values ​​on the y-axis, to establish a one-to-one correspondence between the OD values ​​and CFU of the 69 strains.

[0045] The inoculum for each strain used to construct the time-series core microbial community was prepared according to the following procedure: First, the strains were cultured in 300 mL of R2A liquid medium at 28°C and 180 rpm with shaking for 3 days. Based on the standard curves and results obtained from previous experiments, the growth rates of these 69 bacterial strains varied: some strains grew faster, while others grew slower. At this culture duration, the fast-growing strains had entered the stationary phase and exhibited lower activity; while the slow-growing strains remained in the logarithmic growth phase and showed higher activity. Subsequently, 500 μL of the above-mentioned 3-day culture solution was used as inoculum and transferred to 300 mL of the same fresh R2A liquid medium for further culture; the original culture was then cultured for another day (i.e., co-cultured for 4 days). After this treatment, the fast-growing strains, having regained sufficient nutrients, were in the logarithmic growth phase and exhibited high activity; while the slow-growing strains, having just been introduced to a new environment, were still in the lag phase and exhibited lower activity. In the bacterial culture that was continued until day 4, the fast-growing strains remained in the stationary phase with poor activity, while the slow-growing strains remained in the logarithmic growth phase with high activity. Thus, we obtained four strains in different physiological states: the fast-growing strains exhibited high activity (1 day after transfer) and low activity (4 days in the original culture); the slow-growing strains also exhibited high activity (4 days in the original culture) and low activity (1 day after transfer). Mixing the corresponding high- and low-activity strains of the same strain ensured that all strains were in a highly active state for subsequent community construction.

[0046] Next, to construct synthetic communities at different growth stages (SC0, SC1, SC3, SC5, SC7, SCp), we calculated the required volume of inoculum for each strain at each stage based on the OD600 value of each bacterial strain, the established standard curve between OD values ​​and colony-forming units (CFU) of 69 strains, and the actual abundance ratio of each strain. After mixing the bacterial suspensions of all strains according to the calculated volumes, the concentration of the resulting mixed bacterial suspension was 10¹¹ CFU / mL. Finally, the mixed bacterial suspension was centrifuged at 8000 rpm for 10 minutes, the supernatant was discarded, and the bacterial body was resuspended in sterile 0.7% NaCl physiological saline and brought to a final volume of 1000 mL, thus precisely adjusting the concentration of the final inoculum to [specific value missing]. CFU / mL was used for subsequent plant inoculation experiments.

[0047] Soybean pot experiment and inoculation test

[0048] This study used soybean variety Zhonghuang 13 as the experimental material. The experimental soil was collected from the Yangling Caoxinzhuang Experimental Farm, air-dried, and sieved through a 7 mm sieve. The sieved soil sample was mixed with vermiculite and perlite at a mass ratio of 10:2:1 (200 g of vermiculite and 100 g of perlite per 1 kg of soil), and an appropriate amount of purified water was added and stirred thoroughly to prepare the cultivation substrate. The mixed substrate was packaged into heat-resistant planting bags, approximately 700 g per bag. Subsequently, it was sterilized at 121℃ under high temperature and pressure for 1.5 hours, and then cooled for later use. Plump, uniform, and healthy soybean seeds were selected for surface disinfection. The disinfection process was as follows: first, soaking in 75% (v / v) ethanol for 30 seconds, then rinsing with sterile water 3-5 times; then soaking in 3% (v / v) sodium hypochlorite solution for 3 minutes, followed by thorough rinsing with sterile water 3-5 times. Sterilized seeds were sown on plates containing 1.5% water agar and incubated in a 28°C incubator in the dark for 3 days to promote germination. Seeds with consistent germination were selected and transplanted into prepared planting bags under aseptic conditions, two seedlings per bag. All plants were cultivated in a greenhouse with the following environmental conditions: day / night temperature 25°C, air humidity 70%, and a photoperiod of 16 hours light / 8 hours darkness.

[0049] The inoculation experiment consisted of four treatment groups: a time-series dynamic group (W0, W1, W3, W5, W7), a homogenized ratio group (Wp), a sterilized control group (Ws, prepared by high-temperature sterilization of Wp bacteria), and a blank control group (CK, with an equal volume of sterile water added). After the first pair of true leaves unfolded, the bacterial suspensions were inoculated at the base of the seedlings using a sterile syringe. Each treatment group received 5 mL of the corresponding bacterial suspension (bacterial concentration of [missing information]). Ensure that the total inoculation amount per plant is 5×10 8The control group was inoculated with an equal volume of sterile water (5 ml). Each treatment group had 5 biological replicates, with 3 plants per replicate (i.e., 15 plants per treatment). After inoculation, 30 mL of sterile water was applied every 2 days to meet the plants' normal water requirements. 30 days after inoculation, samples were taken, the planting bags were cut open, and the plants were removed intact. The aboveground and underground parts were separated using sterile scissors. The aboveground parts were placed directly into envelopes; the underground parts were gently shaken to remove large clumps of soil, washed with sterile water, and then placed into another envelope. All samples were dried in an 80°C oven for 5 days until constant weight. The dry weight of the aboveground and underground parts was measured, and the total nitrogen and total phosphorus contents of the aboveground and underground parts were determined.

[0050] Determination of total nitrogen and total phosphorus in plants

[0051] Total nitrogen in plants was determined using an AA3 type continuous flow analyzer via H₂SO₄-H₂O₂ digestion method. The principle is that ammonium nitrogen in the sample (digestion solution) reacts with sodium salicylate and sodium hypochlorite to form a blue compound, the absorbance of which is measured at a wavelength of 660 nm, with sodium nitroprusside as a catalyst. Digestion: Weigh 0.1 g of plant sample into a 100 mL digestion tube, add 5 mL of concentrated sulfuric acid, and digest with H₂O₂ according to the plant sample digestion method. A blank test was performed simultaneously. After digestion, the digestion solution was brought to a final volume of 100 mL. The blank solution was washed into a 50 mL volumetric flask and brought to the mark for later use. Preparation of the standard curve: Pipette 25 mL of the above blank solution into a 50 mL volumetric flask, and then add 100 mg·L⁻¹ to each volumetric flask. -1 NH4 + -N standard solution, prepared to contain NH4+ + -N were 0, 5, 10, 15, 20, and 25 mg·L, respectively. -1 The standard series. Determination: Carefully rinse the sample cup with the supernatant, and then fill the cup with the supernatant. Place the standard curve cups (in descending order) on the sample tray first, then the sample cups, and determine using an AA3 continuous flow analyzer.

[0052]

[0053] Total phosphorus determination in plants was performed using the H₂SO₄-H₂O₂ digestion method and the molybdenum-antimony colorimetric method under UV-1900i (Shimadzu). 5 mL of the clear liquid or filtrate was pipetted into a 50 mL volumetric flask, diluted to 30 mL with water, 2 drops of dinitrophenol indicator were added, and 4 mol·L⁻¹ was added dropwise. -1 NaOH solution was added until the solution turned yellow, then 2 mol·L⁻¹ was added. -1Add 1 drop of (1 / 2H₂SO₄) until the yellow color of the solution just fades. Then add 5 mL of molybdenum antimony reagent, followed by 50 mL of water to stabilize the solution, and shake well. After 30 min, perform colorimetric analysis at 880 nm or 700 nm wavelength, using a blank solution with a transmittance of 100 (or absorbance of 0), and read the transmittance or absorbance value of the measured solution. Standard curve: Accurately pipette 5 μg / mL -1 Phosphorus standard solutions of 0, 1, 2, 4, 6, 8, and 10 mL were placed in separate 50 mL volumetric flasks. Water was added to approximately 30 mL, followed by 5 mL of digestion buffer (from the blank test). The pH was adjusted to 3, and then 5 mL of molybdenum antimony reagent was added. Finally, water was used to bring the volume to 50 mL. Colorimetric analysis was performed after 30 minutes. The phosphorus concentrations in the colorimetric solutions of each flask were 0, 0.1, 0.2, 0.4, 0.6, 0.8, and 1.0 μg·mL⁻¹, respectively. -1 .

[0054]

[0055] Experimental results:

[0056] Data on rhizosphere culture groups at different growth stages of soybean; community composition of rhizosphere microorganisms.

[0057] We isolated and purified rhizosphere microbial communities from soybeans at different growth stages, obtaining strains from five different stages: W0 (1914 strains), W1 (2021 strains), W3 (2110 strains), W5 (2008 strains), and W7 (2003 strains). These strains can be classified into five phyla: Proteobacteria, Actinobacteria, Bacteroidetes, Firmicutes, and Chlorocybenomycota, comprising 45 families and 126 genera. Figure 1 ).

[0058] Data on core rhizosphere microorganisms at different growth stages of soybean rhizosphere

[0059] For pure culture data, the core microorganism was defined as a genus that remained stable throughout all five growth stages of soybean. A total of 126 pure culture genera were identified from rhizosphere samples, of which 36 genera persisted throughout all five growth stages of soybean. Figure 2 a). These persistent genera comprise 1058 strains, representing 41.3% of the total bacterial community. Figure 2(b) indicates that they are broadly representative of the overall bacterial community in the soybean rhizosphere at different growth stages. The 36 core microbial genera include: Variovorax, Pseudarthrobacter, Streptomyces, Pseudomonas, Allorhizobium-Neorhizobium-Pararhizobium-Rhizobium, Stenotrophomonas, Microbacterium, Agromyces, Bacillus, Nocardioides, Phyllobacterium, Pseudoxanthomonas, Ensifer, Lysobacter, Kribbella, Paenarthrobacter, Glycomyces, Sphingopyxis,Bosea, Neorhizobium, Chryseobacterium, Paenibacillus, Chitinophaga,Promicromonospora, Intrasporangium, Terrabacter, Sphingomonas, Devosia,Caulobacter, Xylophilus, Saccharothrix, Mesorhizobium, Bradyrhizobium,Mycobacterium, Pseudorhodoferax and Lechevalieria.Because the relative abundance of some genera (such as Bradyrhizobium, Devosia, Glycomyces, Intrasporangium, Lechevalieria, Mycobacterium, Promicromonospora, Xylophilus, Pseudorhodoferax, Terrabacter, Neorhizobium, Paenibacillus, and Sphingomonas) was less than 0.5%, or the strains were difficult to scale up in R2A liquid medium, we ultimately selected the remaining 23 core genera for constructing the synthetic flora (Variovorax, Pseudarthrobacter, Streptomyces, Pseudomonas, Allorhizobium-Neorhizobium-Pararhizobium-Rhizobium, Stenotrophomonas, Microbacterium, Agromyces, Bacillus, Nocardioides, Phyllobacterium, Pseudoxanthomonas, Ensifer, Lysobacter, Kribbella) Paenarthrobacter, Sphingopyxis, Bosea, Chryseobacterium, Chitinophaga, Caulobacter, Saccharothrix and Mesorhizobium).

[0060] Correlation between rhizosphere high-throughput sequencing data and rhizosphere culture data

[0061] To validate the representativeness of the synthetic microbial community (SynCom) composed of 23 genera at the community structure level, we conducted Procrustes analysis and Simpson diversity correlation analysis on the following four datasets: high-throughput sequencing data of intact rhizosphere microbial communities [W0, W1, W3, W5 and W7] and high-throughput sequencing data of core rhizosphere microbial communities [WC0, WC1, WC3, WC5 and WC7]; culture datasets of intact rhizosphere communities [T0, T1, T3, T5 and T7] and data of core rhizosphere synthetic communities [SC0, SC1, SC3, SC5 and SC7]). From the perspective of Beta diversity, PCA-based Procrustes analysis ( Figure 3(ad) revealed the relationships between the structures of different communities. Procrustes analysis confirmed the structural similarity among these communities (all P values ​​< 0.001): the high-throughput sequencing data of intact rhizosphere microbial communities had the highest matching degree with the high-throughput sequencing data of core rhizosphere microbial communities (M² = 0.0437); significant correlations were also shown between the high-throughput sequencing data of intact rhizosphere microbial communities and the cultured rhizosphere community data (M² = 0.1926), the cultured rhizosphere community data and the synthetic rhizosphere core community data (M² = 0.1096), and the high-throughput sequencing data of core rhizosphere microbial communities and the synthetic rhizosphere core community data (M² = 0.325).

[0062] Furthermore, from the perspective of α-diversity, the correlation analysis results based on the Simpson diversity index ( Figure 3 The analysis also revealed the correlations between the various microbial community groups in the four datasets mentioned above. Specifically, Simpson diversity index correlation analysis showed a highly significant linear relationship between the high-throughput sequencing data of intact rhizosphere microbial communities and the high-throughput sequencing data of core rhizosphere microbial communities (R²=0.99, q=0); and a significant correlation between the high-throughput sequencing data of intact rhizosphere microbial communities and the rhizosphere intact community culture group data (R²=0.7, q=1.421e). -08 The rhizosphere intact community culture data and the rhizosphere core synthetic community data showed a high linear correlation (R²=0.97, q=0); the rhizosphere core microbial community high-throughput sequencing data and the rhizosphere core synthetic community data also showed a significant linear relationship (R²=0.64, q=6.173e). -07 ).

[0063] Synthetic microbial community (SynCom) growth-promoting function analysis

[0064] We analyzed the growth-promoting functions of a synthetic microbial community (SynCom) composed of 23 genera. This experiment included four treatment groups with eight treatments for inoculation comparison: a time-dynamic group (SC0, SC1, SC3, SC5, SC7), a homogenized ratio group (SCp), a sterilized control group (SWs, prepared from Wp bacteria by high-temperature sterilization), and a blank control group (CK, with an equal volume of sterile water added). After the first pair of true leaves unfolded, the bacterial suspensions were inoculated around the seedling roots using a sterile syringe. Inoculation with different synthetic microbial communities significantly affected soybean growth and nutrient accumulation (P<0.05). In terms of biomass, the aboveground dry weight of the SC3 and SC5 treatment groups was significantly higher than that of the CK, SWs, and SC0 groups, while the underground dry weight of the SC5 treatment group was also significantly higher than that of the CK and SWs groups. Figure 4(ab). Specifically, after inoculation with SC3 and SC5 treatment groups, the aboveground dry weight of soybeans increased to 1.41 g / plant and 1.36 g / plant, respectively, compared with the blank control group (CK) (1.24 g / plant), with relative increases of 1.14 times and 1.10 times, respectively; compared with the sterilized control group (SWs) (1.15 g / plant), it increased to 1.41 g / plant and 1.36 g / plant, respectively, with relative increases of 1.23 times and 1.18 times, respectively; compared with the time-series dynamic group (SC0, 1.19 g / plant), it increased to 1.41 g / plant and 1.36 g / plant, respectively, with relative increases of 1.19 times and 1.14 times, respectively. In addition, after inoculation with SC5, the dry weight of soybean underground parts increased from 0.336 g / plant to 0.336 g / plant compared with the blank control group (CK) (0.305 g / plant), with a relative increase of 1.10 times; compared with the sterilized control group (SWs) (0.297 g / plant), it increased to 0.336 g / plant, with a relative increase of 1.13 times.

[0065] Regarding nitrogen accumulation, after inoculation with SC3 and SC5, the total nitrogen in the aboveground parts of soybean increased to 29.72 mg / plant and 30.85 mg / plant, respectively, compared to the sterilized control group (SWs, 26.34 g / plant), with relative increases of 1.13 times and 1.17 times, respectively. Meanwhile, after inoculation with SC5, the total nitrogen in the underground parts of soybean increased to 7.84 mg / plant compared to the sterilized control group (SWs, 6.41 mg / plant) and the blank control group (CK, 7.08 mg / plant), with relative increases of 1.11 times and 1.22 times, respectively. Furthermore, regarding phosphorus accumulation, after inoculation with SC5, the total phosphorus content in the aboveground soybean plants increased to 1.49 mg / plant compared to the sterilized control group (SWs, 1.23 mg / plant) and the time-dynamic group (SC0, 1.27 mg / plant), representing relative increases of 1.21 times and 1.17 times, respectively. After inoculation with SC3, the total phosphorus content in the aboveground soybean plants increased to 1.43 mg / plant compared to the sterilized control group (SWs, 1.23 mg / plant), representing a relative increase of 1.16 times. Simultaneously, regarding phosphorus accumulation, after inoculation with SC5, the total phosphorus content in the underground soybean plants increased to 0.37 mg / plant compared to the blank control group (CK, 0.33 mg / plant) and the time-dynamic group (SC0, 0.29 mg / plant), representing relative increases of 1.12 times and 1.29 times, respectively. Therefore, these results indicate that the SC3 and SC5 microbial communities have the most significant effects on promoting soybean growth and nutrient absorption.

[0066] In summary, this invention develops a novel technique for constructing synthetic microbial communities based on the characteristics of pure cultured microbial communities. This technique eliminates the need for high-throughput sequencing analysis of original soil samples as guidance, solving the problem of poor correspondence between microbial community analysis data and the strains used in constructing synthetic microbial communities. This allows the synthetic microbial communities to better represent the structural and functional characteristics of natural microbial communities, contributing to improved effectiveness of synthetic microbial communities in scientific research and practical applications.

[0067] Comparative analysis revealed distinct temporal dynamics in bacterial communities of bulk soil and rhizosphere soil samples regarding α-diversity. The Shannon index of bulk soil remained stable throughout the developmental stage (Kruskal–Wallis, p=0.89), while the rhizosphere soil community exhibited significantly greater temporal fluctuations (Kruskal–Wallis, p=0.89). Figure 6 a), and the α diversity was lower in all growth stages than in bulk soil, especially at 1wpp, 3wpp, 5wpp and 7wpp, where the difference between rhizosphere soil samples and bulk soil was most significant (p<0.05) (Kruskal–Wallis, p<0.05). Figure 6 c). The Shannon index of the rhizosphere soil community showed a U-shaped trend with plant growth, reaching its lowest value at the seedling stage (3 wpp). Post-hoc Dunn analysis further showed significant differences between the original soil and 3 wpp / 5 wpp / 7 wpp, as well as between 1 wpp and 3 wpp / 7 wpp (p < 0.001). Figure 6 a). PERMANOVA results based on Bray–Curtis distance indicated that soil type (bulk soil vs. rhizosphere soil) was the main driver of bacterial community structure differentiation, explaining 39.47% of the community variation (P<0.001). Figure 6 b). PCoA visualization further confirmed this zoning effect: bulk soil and rhizosphere soil samples showed a clear separation on the PCoA1 axis (explaining 59.62% of the variance). Figure 6 b). Notably, the rhizosphere soil community exhibited more significant phased reorganization over time, especially during the soybean 1wpp–5wpp phase, where the community structure underwent significant changes (P<0.01). Figure 6 b).

[0068] To reveal the microbial dynamics at specific stages, we performed a phylum-level differential abundance analysis of soybean development stages. Figure 7 a, b). Among the top ten most abundant phyla, the abundance of rhizosphere microbial communities fluctuated more significantly during the soybean growth stage (primitive soil - 5 weeks later) as soybean development progressed, while the bulk soil microbial community showed greater stability, with only a few phyla showing significant abundance changes. Figure 7 a, b).

[0069] Under the criteria of persistent presence threshold (detected in at least 8 out of 10 replicates at each growth stage) and minimum relative abundance (>0.01%), we identified 120 core genera from 536 genera that were stably colonized in the rhizosphere at all developmental stages of soybean. These core subpopulations replicated the α- and β-diversity succession patterns observed in the complete soybean community at different growth stages. Figure 8 a, b). This structural consistency was statistically validated by a linear model (r=0.99, q=0) and Procrustes analysis (M²=0.2278, P<0.001). Figure 8 (c, d). These findings suggest that the assembly dynamics of the core microbial community are consistent with the responses of the complete community in plant-mediated processes, and therefore can serve as a reliable alternative for studying rhizosphere community dynamics.

[0070] The artificial microbial community construction method provided by this invention is based on microbiome sequencing technology. It is the first to employ the concept of core microbial genera selected under the criteria of a sustained occurrence threshold (detection in at least 8 out of 10 replicates at each growth stage) and a minimum relative abundance (>0.01%), verifying that the assembly dynamics of core microbial communities can serve as a reliable alternative method for studying rhizosphere community dynamics. However, the ASVs (amylon sequence variants) of rhizosphere core microbial communities obtained through high-throughput sequencing cannot directly correspond to microbial strains isolated through pure culture. Therefore, we provide a method and application for constructing synthetic microbial communities based on the characteristics of pure culture microbial communities. This technology does not rely on high-throughput sequencing analysis results from original soil samples as guidance, solving the problem of poor correspondence between microbial community analysis data and the strain materials used in constructing synthetic microbial communities. This allows synthetic microbial communities to better represent the structural and functional characteristics of natural microbial communities, contributing to improved effectiveness of synthetic microbial communities in scientific research and practical applications.

[0071] In this embodiment, the strains from 23 genera in the synthetic community included: Variovorax, arthrobacter, Streptomyces, Pseudomonas, Agrobacterium, Stenotrophomonas, Microbacterium, Agromyces, Bacillus, Nocardioides, Phyllobacterium, Pseudoxanthomonas, Ensifer, Lysobacter, Kribbella, Paenarthrobacter, Sphingopyxis, Bosea, Chryseobacterium, Chitinophaga, Caulobacter, Saccharothrix, and Mesorhizobium. These strains were obtained from rhizosphere soil samples of soybean at different growth stages, and the pure cultures of the strains underwent full-length PCR amplification of the 16S rRNA gene. The PCR primers used were universal primer pairs: 1492R: TACGCTACCTTGTTACGACTT; 27F: AGAGTTTGATCCTGGCTCAG. The amplified product was approximately 1450 bp. The complete 16S rRNA gene sequence was obtained via Sanger sequencing and compared using the EzBioCloud database (https: / / www.ezbiocloud.net / ). The identification results are as follows:

[0072] The strain Variovorax: its 16S rRNA sequence is 99.10% identical to Variovorax paradoxus (NBRC 15149 type strain), and it is identified as Variovorax paradoxus.

[0073] The strain *Arthrobacter* was identified as *Arthrobacter pascens* because its 16S rRNA sequence showed 99.44% similarity to that of *Arthrobacter pascens* (DSM 20545 type strain).

[0074] The strain Streptomyces: its 16S rRNA sequence is 99.65% identical to Streptomyces bobili (NRRL B-1338 type strain), and it is identified as Streptomyces bobili;

[0075] The strain Pseudomonas: its 16S rRNA sequence is 99.85% identical to LT707064_s (7SR1 type strain), and it is identified as LT707064_s;

[0076] The strain Agrobacterium: its 16S rRNA sequence is 100% identical to that of Agrobacterium tomkonis (IIF1SW-B1 type strain), and it is identified as Agrobacterium tomkonis;

[0077] The strain Stenotrophomonas: its 16S rRNA sequence is 99.58% identical to Stenotrophomonascyclobalanopsidis (TPQG1-4 type strain), and it is identified as Stenotrophomonascyclobalanopsidis;

[0078] The strain Microbacterium: its 16S rRNA sequence is 99.37% identical to that of Microbacterium kunmingense (JXJ CY27-2 type strain), and it is identified as Microbacterium kunmingense;

[0079] The strain Agromyces: its 16S rRNA sequence is 99.65% identical to that of Agromyces fucosus (VKM Ac-1345 type strain), and it is identified as Agromyces fucosus;

[0080] The strain Bacillus: its 16S rRNA sequence is 99.54% identical to that of Bacillus mexicanus (FSQ1 type strain), and it was identified as Bacillus mexicanus;

[0081] The strain Nocardioides: its 16S rRNA sequence is 99.09% identical to that of Nocardioides pinisoli (STR3 type strain), and it was identified as Nocardioides pinisoli;

[0082] The strain Phyllobacterium: its 16S rRNA sequence is 99.64% identical to that of Phyllobacterium ifriqiyense (STM370 type strain), and it is identified as Phyllobacterium ifriqiyense.

[0083] The strain Pseudoxanthomonas: its 16S rRNA sequence is 98.76% identical to that of Pseudoxanthomonas wuyuanensis (CGMCC 1.10978 type strain), and it is identified as Pseudoxanthomonas wuyuanensis;

[0084] The strain Ensifer: its 16S rRNA sequence is 99.49% identical to that of Ensifer sesbaniae (CCBAU 65729 type strain), and it is identified as Ensifer sesbaniae;

[0085] The strain Lysobacter: its 16S rRNA sequence is 99.79% identical to Lysobacter antibioticus (ATCC 29479 type strain), and it is identified as Lysobacter antibioticus;

[0086] The strain Kribbella: its 16S rRNA sequence is 98.96% identical to that of Kribbella pittospori (PIP 158 type strain), and it is identified as Kribbella pittospori;

[0087] The strain Paenarthrobacter: its 16S rRNA sequence is 99.09% identical to that of Paenarthrobacter aurescens (NBRC12136 type strain), and it is identified as Paenarthrobacter aurescens;

[0088] The strain Sphingopyxis: its 16S rRNA sequence is 98.64% identical to that of Sphingopyxis chilensis (S37 type strain), and it is identified as Sphingopyxis chilensis.

[0089] The strain Bosea: Its 16S rRNA sequence is 99.41% identical to that of Bosea spartocytisi (SSUT16 type strain), and it was identified as Bosea spartocytisi;

[0090] The strain Chryseobacterium: its 16S rRNA sequence is 99.15% identical to Chryseobacterium lathyri (RBA2-6 type strain), and it is identified as Chryseobacterium lathyri;

[0091] The strain Chitinophaga: its 16S rRNA sequence is 99.10% identical to that of Chitinophaga ginsengisegetis (Gsoil040 type strain), and it is identified as Chitinophaga ginsengisegetis;

[0092] The strain Caulobacter: its 16S rRNA sequence is 99.86% identical to that of Caulobacter radicis (type strain 695), and it is identified as Caulobacter radicis;

[0093] The strain Saccharothrix: its 16S rRNA sequence is 99.02% identical to that of Saccharothrix variisporea (DSM 43911 type strain), and it was identified as Saccharothrix variisporea;

[0094] The strain Mesorhizobium: its 16S rRNA sequence is 99.92% identical to that of Mesorhizobium zhangyense (23-3-2 type strain), and it is identified as Mesorhizobium zhangyense.

[0095] The above description is merely a preferred embodiment of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention. Furthermore, although some specific terms are used in this specification, these terms are merely for convenience of explanation and do not constitute any limitation on the present invention.

Claims

1. A method for constructing synthetic microbial communities based on the characteristics of pure cultured microbial communities, characterized in that, The method includes the following steps: Step 1: Obtain pure culture strains at different growth stages of crop rhizosphere using cultinomy methods. Based on the structural analysis of the pure culture strains, identify the culturable core microbial groups that are stable at each growth stage. Step 2: Screen out strains corresponding to these core microorganisms from the strain community. The community structure is determined directly based on the actual abundance of strains obtained from culture omics. Step 3: Analyze the differences in the growth-promoting functions of synthetic microbial communities with different structures through crop re-inoculation experiments.

2. The method according to claim 1, characterized in that, Step 1 includes the isolation and purification of bacteria and screening of core rhizosphere microorganisms.

3. The method according to claim 2, characterized in that, In step 1, the specific steps are as follows: (1) Soil samples from the rhizosphere of soybeans in weeks 0, 1, 3, 5 and 7 are weighed and placed in sterile centrifuge tubes and serially diluted with sterile PBS buffer. The diluted solution is then spread on a plate for subsequent bacterial isolation. (2) The R2A solid plates were incubated at 28°C for 3-4 weeks. New colonies were observed and picked daily. After purification by continuous streak method, the purified strains were used for subsequent experiments. (3) The purified strains were sequentially inoculated into numbered 96-well plates. Primers were designed based on the universal 16S rRNA gene primers 515F and 907R for PCR amplification. A barcode sequence was added to the leader primer to distinguish the position of the strains in the 96-well plate, and a barcode sequence was added to the follow-up primer to distinguish different 96-well plate numbers. After all PCR products were mixed and purified, they were sequenced using the HiSeq2500 PE250 sequencing platform. The corresponding strains were determined according to the barcode markings, and the species identification of all strains was completed. Finally, pure culture strains corresponding to the original soil and the rhizosphere samples of weeks 1, 3, 5, and 7 were obtained. These strains covered the characteristic bacterial groups of each growth stage and were named the original soil T0 and the rhizosphere strains of week 1 T1, week 3 T3, week 5 T5, and week 7 T7, respectively.

4. The method according to claim 2, characterized in that, The screening of core rhizosphere microorganisms specifically involves: based on data analysis of the composition and structure of strains at various stages of soybean growth, genera present at all stages are identified as core microbial genera. Three isolated strains are randomly selected from each core genus, resulting in a total of 23 core microbial genera. These 23 core microbial genera are Variovorax, arthrobacter, Streptomyces, Pseudomonas, Agrobacterium, Stenotrophomonas, Microbacterium, Agromyces, Bacillus, Nocardioides, Phyllobacterium, Pseudoxanthomonas, Ensifer, Lysobacter, Kribbella, Paenarthrobacter, Sphingopyxis, Bosea, Chryseobacterium, Chitinophaga, Caulobacter, Saccharothrix, and Mesorhizobium.

5. The method according to claim 1, characterized in that, In step 2, bacterial culture was aspirated from the corresponding deep-well plate according to the sequencing number, spread onto R2A solid medium, and incubated upside down at 28°C for two days. Single colonies were picked and purified using the streak plate method until pure cultures were obtained. 69 pure cultures of core microbial genera were inoculated into R2A liquid medium. Bacterial cells were collected and total DNA was extracted using a genomic DNA extraction kit. The 16S rRNA gene was amplified using this DNA as a template. After sequencing and assembly, the DNA was compared using the EzBioCloud database (https: / / www.ezbiocloud.net / ) to complete molecular identification and genus-level classification of the strains. The relative abundance of the 23 core genera in the strain set at different growth stages was quantified. This abundance was used to construct SynComs proportionally, which summarized the stage-specific structural characteristics of the rhizosphere microbiota.

6. The method according to claim 5, characterized in that, In step 2, three isolates were randomly selected from each core genus and combined in equimolar ratios to represent each genus in the final SynCom assembly. The synthetic communities included the original soil, the first week, the third week, the fifth week, the seventh week, and the homogenized microbial community.

7. The method according to claim 6, characterized in that, In step 2, 69 strains used to construct the time-series core microbial community were shaken and cultured to prepare 10⁻ 4 The bacterial suspension was serially diluted and serially diluted. Each dilution was then spread onto R2A plates with five replicates per gradient. After incubation at 28°C upside down for 1–3 days, colony counts were performed, and the number of colony-forming units (CFU / mL) was calculated. Finally, a standard curve was established between the OD value and CFU of 69 bacterial strains, with the measured OD value of each strain on the x-axis and the corresponding CFU value on the y-axis, and a one-to-one correspondence was determined.

8. The method according to claim 1, characterized in that, Step 3 includes soybean pot experiments and inoculation tests, as well as the determination of total nitrogen and total phosphorus in the plants.

9. The application of the synthetic microbial community established by the method of constructing synthetic microbial communities based on the characteristics of pure culture microbial communities according to any one of claims 1-8 in the crop planting process.

10. The application according to claim 9, characterized in that, The crop in question is soybean.

Images