Peanut bacterial wilt resistance related gene Ah6Q1KS5, encoding protein thereof, biological material and application thereof in disease-resistant breeding

Abstract

The invention relates to the technical field of plant genetic engineering, in particular to a peanut bacterial wilt resistance related gene Ah6Q1KS5, an encoding protein thereof, a biological material and application of the gene Ah6Q1KS5 in disease-resistant breeding. Through whole genome identification and functional analysis, the gene Ah6Q1KS5 which is remarkably related to bacterial wilt resistance in a peanut SAMS gene family is screened, and the gene is induced by ralstonia solanacearum, salicylic acid (SA), abscisic acid (ABA) and methyl jasmonate (MeJA) to be remarkably expressed in a peanut bacterial wilt resistant variety H108. Peanut and tobacco plants over-expressing Ah6Q1KS5 can significantly reduce cell death, inhibit growth of ralstonia solanacearum, and enhance resistance to bacterial wilt. The molecular marker can be used for analyzing the molecular mechanism of peanut bacterial wilt resistance, provides new gene resources and technical means for cultivating bacterial wilt resistant peanut varieties, and has important application value in the field of peanut breeding.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the peanut bacterial wilt resistance-related gene Ah6Q1KS5, its encoded protein, biomaterials, and its application in disease-resistant breeding. Background Technology

[0002] Peanuts (Arachis hypogaea L.) are an important oilseed and cash crop globally, playing a vital role in my country's agricultural production and national economy. However, peanut production is frequently threatened by various soil-borne diseases. Among them, bacterial wilt caused by Ralstonia solanacearum is a highly destructive vascular disease characterized by rapid onset, rapid spread, and severe damage, which can lead to total crop failure in peanut fields and seriously restrict the improvement of peanut yield and quality.

[0003] Currently, the main methods for controlling peanut bacterial wilt include agricultural control, chemical control, and disease-resistant breeding. However, agricultural control has a long cycle and limited effectiveness, while chemical control easily causes environmental pollution and pathogens readily develop resistance. Therefore, breeding and planting disease-resistant varieties is the most economical, environmentally friendly, and effective approach. Discovering peanut bacterial wilt resistance-related genes and elucidating their molecular mechanisms is the core foundation for disease-resistant breeding.

[0004] S-Adenosylmethionine synthase (SAMS) catalyzes the synthesis of S-adenosylmethionine (SAM) from methionine and ATP. SAM, as an important methyl donor in organisms, participates in various metabolic pathways, including epigenetic regulation and the synthesis of ethylene and polyamines, playing a crucial role in plant growth, development, and abiotic stress responses. Previous studies have shown that SAMS genes participate in biotic stress responses in plants such as Arabidopsis thaliana, rice, and tobacco. However, the systematic identification of the SAMS gene family in peanut and its association with bacterial wilt resistance are still incomplete, lacking clearly defined functional genes for disease-resistant breeding.

[0005] Therefore, this invention is proposed to solve the above-mentioned technical problems. Summary of the Invention

[0006] To address the aforementioned problems, this invention provides an Ah6Q1KS5 gene and its encoded protein, a recombinant expression vector containing the gene, and a recombinant bacterium containing the recombinant expression vector. It also provides the application of this gene and its encoded protein in the breeding of peanut varieties resistant to bacterial wilt.

[0007] To achieve the above objectives, the specific solution of the present invention is as follows:

[0008] The first aspect of the present invention provides a peanut bacterial wilt resistance-related gene Ah6Q1KS5, the nucleotide sequence of which is shown in SEQ ID NO.1, or a nucleotide sequence having at least 90% homology with the sequence shown in SEQ ID NO.1 and encoding the same functional protein.

[0009] Specifically, through whole-genome identification, Ah6Q1KS5, a member of the SAMS gene family, was isolated from peanut. This gene is located on peanut chromosome 16, and its nucleotide sequence is shown in SEQ ID NO.1. This gene was significantly upregulated in the bacterial wilt-resistant variety H108 by Ralstonia solanacearum, SA, ABA, and MeJA, and is a key gene regulating peanut resistance to bacterial wilt.

[0010] The present invention also provides a protein encoded by the gene Ah6Q1KS5 of claim 1, wherein the amino acid sequence is shown in SEQ ID NO.2, or an amino acid sequence based on the sequence shown in SEQ ID NO.2 with one or more amino acid substitutions, deletions or additions and having the same bacterial wilt resistance regulatory function.

[0011] Specifically, the protein encoded by Ah6Q1KS5 contains conserved S-AdoMet_synt_C, S-AdoMet_synt_M, and S-AdoMet_synt_N domains, is a hydrophilic protein, has SAMS enzyme activity, and can catalyze the synthesis of SAM.

[0012] The present invention also provides a recombinant expression vector containing the gene Ah6Q1KS5 as described in claim 1, wherein the recombinant expression vector is constructed by inserting the coding sequence of Ah6Q1KS5 into the pCambia1300-YFP as the base vector.

[0013] Specifically, using pCambia1300-YFP as a vector, the coding sequence of Ah6Q1KS5 was inserted between the SacⅠ and KpnⅠ restriction sites of the vector through seamless cloning technology to construct the recombinant expression vector pCambia1300-Ah6Q1KS5-YFP.

[0014] The present invention also provides a recombinant bacterium containing the recombinant expression vector of claim 3, wherein the recombinant bacterium is Agrobacterium EHA105.

[0015] This invention provides the application of the gene Ah6Q1KS5 described in claim 1 and the protein described in claim 2 in the breeding of peanut varieties resistant to bacterial wilt.

[0016] This invention provides a method for breeding peanut varieties resistant to bacterial wilt, comprising the following steps:

[0017] S1. Construct the recombinant expression vector as described in claim 3, and transform it into Agrobacterium;

[0018] S2. The recombinant expression vector was introduced into peanut receptor material via Agrobacterium-mediated transformation to obtain peanut leaves with transient overexpression.

[0019] S3. Identify bacterial wilt resistance in overexpressing peanut plants, screen out resistant plants, and breed offspring.

[0020] Preferably, in step S2, the peanut receptor material is the bacterial wilt susceptible variety Nongdahua 107 (H107).

[0021] Preferably, in step S3, the bacterial wilt resistance identification includes artificial inoculation with Ralstonia solanacearum, observation of plant disease symptoms, detection of leaf cell death and pathogen quantity.

[0022] Specifically, the recombinant expression vector was transformed into Agrobacterium EHA105, and then peanuts were transformed using the Agrobacterium-mediated transformation method to obtain peanut leaves overexpressing Ah6Q1KS5. After artificial inoculation with Ralstonia solanacearum, the transgenic plants showed a significant reduction in cell death, a significant decrease in the number of pathogens in the leaves, and a significant enhancement in resistance to bacterial wilt.

[0023] The beneficial effects of this invention are:

[0024] This invention identifies and verifies for the first time that Ah6Q1KS5 in the peanut SAMS gene family is a key gene for bacterial wilt resistance, clarifies its function in the peanut bacterial wilt defense response, and enriches the peanut bacterial wilt resistance gene resources.

[0025] The Ah6Q1KS5 gene was induced to express by Ralstonia solanacearum and various disease resistance-related hormones. Its overexpression significantly improved the resistance of peanuts and tobacco to bacterial wilt, providing a core gene for breeding bacterial wilt-resistant peanut varieties using genetic engineering technology.

[0026] The cultivation method provided by this invention is simple to operate and highly efficient, and can quickly obtain transgenic peanut plants resistant to bacterial wilt, thus accelerating the process of peanut disease resistance breeding and having important prospects for industrial application. Attached Figure Description

[0027] Figure 1 A diagram illustrating the chromosome location, phylogenetic evolution, structure, and physicochemical properties of the peanut AhSAMS family.

[0028] Figure 2 Phylogenetic analysis diagram of the peanut AhSAMS family and its homologous genes in multiple species;

[0029] Figure 3Conserved motifs, domains, sequence alignments, and three-dimensional structural analysis diagrams of peanut AhSAMS family genes;

[0030] Figure 4 A diagram illustrating the evolutionary origin, regulatory mechanisms, and expression patterns of the peanut AhSAMS gene family;

[0031] Figure 5 The graph shows the relative expression analysis of four peanut SAMS gene family members (AhRG5YED, Ah6Q1KS5, AhPNM9T4, AhFJ1AK4) under stress treatment using qRT-PCR.

[0032] Figure 6 This is a diagram illustrating the functional verification of Ah6Q1KS5 in peanut bacterial wilt resistance. Detailed Implementation

[0033] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0034] Example 1: Identification of peanut SAMS genes across the entire genome

[0035] 1.1 Experimental Materials and Data Sources

[0036] The complete genome assembly sequence and annotation file (version 1.0) of the peanut cultivar Tifrunner were downloaded from the PeanutBase database (https: / / peanutbase.org). Hidden Markov Model (HMM) files for the S-adenosylmethionine synthase core domain, including PF00438, PF02772, and PF02773, were obtained from the Pfam database. Software tools used: TBtools v1.098765, HMMER v3.3.2, MEGA 11, ExPASy ProtParam, NCBI Batch Web CD-Search Tool, MEME 5.5.8, AlphaFold, and PyMOL2.

[0037] 1.2 Experimental Methods

[0038] 1.2.1 Screening of candidate SAMS genes

[0039] The BlastP program was used to search for the predicted peanut proteome, using identified SAMS protein sequences from Arabidopsis thaliana and rice as query sequences. The E-value threshold was set to 1×10⁻⁶. -5Using the hmmsearch program of HMMER software, proteomes were screened based on SAMS core domain HMM files in the Pfam database, with an E-value threshold of 1×10⁻⁶. -5 Sequence filtering and redundancy removal: Candidate gene sequences obtained through dual search were extracted using TBtools. The screening criteria were: SAMS domain coverage ≥80% and amino acid length ≥300aa. Some and redundant sequences were removed. The SAMS conserved domain of the candidate sequences was verified using the NCBI Batch Web CD-Search Tool. Sequences containing complete functional domains were retained as members of the peanut SAMS gene family.

[0040] 1.2.2 Gene Characterization

[0041] Using TBtools in conjunction with peanut genome annotation files, the specific locations of AhSAMS gene family members on chromosomes were determined and their distribution maps were drawn. The ExPASy ProtParam tool was used to analyze the coding sequence (CDS) length, molecular weight (Mw), theoretical isoelectric point (pI), instability index, gravy, aliphatic index, and molecular formula of each AhSAMS protein. The CDS and uncoding region (UTR) structures of the genes were visualized using TBtools. Conserved motifs were identified using the MEME tool, with parameters set to a maximum of 10 motifs and a length of 6-100 amino acids; the results were displayed using TBtools. The tertiary structure of AhSAMS proteins was predicted using AlphaFold, and models with a per-residue confidence score (pLDDT) > 70 were selected. PyMOL2 was used for structure rendering and analysis.

[0042] 1.2.3 Phylogenetic Tree Construction

[0043] SAMS gene sequences from Arabidopsis thaliana were obtained from the TAIR database, and SAMS protein sequences from wheat, barley, rice, soybean, tobacco, and maize were obtained from the Phytozome and NCBI databases. Multiple sequence alignment of the SAMS protein sequences from peanut and the aforementioned seven species was performed using the MUSCLE algorithm in MEGA 11 software, with default parameters. A phylogenetic tree was constructed using the neighbor-joining method, with evolutionary distance calculated using a Poisson-corrected model. Sites containing gaps and missing data were removed. The reliability of the tree was assessed through 1000 bootstrap tests, and visualization and annotation were performed using the iTOL online tool.

[0044] 1.2.4 Collinearity and Promoter Cis-Action Element Analysis

[0045] Based on the genomic data of the cultivated peanut species (Arachis hypogaea) and its wild relatives (diploid ancestors A. duranensis and A. ipaensis, and tetraploid wild species A. monticola), collinearity analysis was performed using the "One Step MCScanX" function of TBtools, with the following parameters set: match score = 50, match size = 5, and E value = 1 × 10⁻⁶. -10 Collinear blocks were visualized using the "Advanced Circos" function. The promoter sequence 2000 bp upstream of the transcription start site (TSS) of each AhSAMS gene was extracted, and cis-acting elements were identified using the PlantCARE database. Motif enrichment analysis was performed using the AME tool in MEME Suite (p<0.05), and the element types and quantities were statistically analyzed and visualized using TBtools.

[0046] Nine members of the peanut SAMS gene family were identified and named AhRG5YED, AhFJ1AK4, AhI49WQS, Ah6Q1KS5, AhPNM9T4, AhGLNG4N, AhP6SB2Z, AhLGSY73, and Ah40BQ9A. These are unevenly distributed across five chromosomes (Chr01, Chr04, Chr06, Chr16, and Chr17), with Chr06 containing three genes and exhibiting the highest density (see...). Figure 1As shown, (A) Chromosomal localization of AhSAMS family members. Gray bands represent peanut chromosomes Chr01, Chr04, Chr06, Chr16, and Chr17. The bottom scale bar indicates physical distance (Mb). Gene names are labeled at their respective chromosome locations, showing the genomic distribution pattern of family members. (B) Phylogenetic tree and conserved domain analysis of the AhSAMS family. The left side is the neighbor-joining (NJ) phylogenetic tree (constructed using MEGA 11 software, with 1000-repeat bootstrapping test; branch values ​​represent bootstrapping support percentages). The right side is a schematic diagram of conserved protein domains, with different colors (pink, green, and yellow) corresponding to the S-adenosine_C, S-adenosine_M, and S-adenosine_N functional domains, reflecting the evolutionary relationship and structural conservation of the gene family. (C) Phylogenetic tree and structural analysis of the AhSAMS gene. The left side is the NJ phylogenetic tree, and the right side is a schematic diagram of the gene structure, where the green box represents the coding region (CDS) and the yellow box represents the untranslated region (UTR). (D) Physicochemical properties analysis of the AhSAM family. CDS: coding sequence length; Mw: protein molecular weight (kDa); pI: isoelectric point; li: instability index; GRAVY: overall average hydrophilicity. The CDS length of the AhSAMS gene is 1182-1338 bp, the molecular weight of the protein is 42.98-49.19 kDa, the theoretical isoelectric point is 5.20-7.99, the instability index is 20.03-34.74, and the GRAVY value is -0.55 to -0.19, all indicating hydrophilic proteins (see...). Figure 1 D. As shown in Table 1).

[0047] Table 1

[0048] Gene ID Genename CDSlength Aminoacidsnumber Molecularweight(kDa) Theoretical pI Instabilityindex Aliphaticindex Grandaverageofhydropathicity arahy.Tifrunner.gnm1.ann1.RG5YED AhRG5YED 1278 425 46.74 5.23 22.95 80.49 -0.34 arahy.Tifrunner.gnm1.ann1.6Q1KS5 Ah6Q1KS5 1203 400 44.06 5.20 20.03 80.15 -0.33 arahy.Tifrunner.gnm1.ann1.PNM9T4 AhPNM9T4 1257 418 45.92 6.36 23.92 81.60 -0.24 arahy.Tifrunner.gnm1.ann1.I49WQS AhI49WQS 1263 420 46.17 6.40 23.80 81.90 -0.24 arahy.Tifrunner.gnm1.ann1.FJ1AK4 AhFJ1AK4 1185 394 43.19 5.67 26.92 81.12 -0.31 arahy.Tifrunner.gnm1.ann1.P6SB2Z AhP6SB2Z 1338 445 49.19 7.99 29.77 75.80 -0.48 arahy.Tifrunner.gnm1.ann1.40BQ9A Ah40BQ9A 1281 426 46.52 6.32 22.74 83.52 -0.19 arahy.Tifrunner.gnm1.ann1.LGSY73 AhLGSY73 1182 393 42.98 6.32 22.34 80.84 -0.28 arahy.Tifrunner.gnm1.ann1.GLNG4N AhGLNG4N 1314 437 48.32 7.29 34.74 70.50 -0.55

[0049] All AhSAMS proteins contain three conserved domains: S-AdoMet_synt_C, S-AdoMet_synt_M, and S-AdoMet_synt_N; eight members contain ten conserved motifs, with only AhGLNG4N lacking motifs 8 and 9; gene structure analysis shows that AhFJ1AK4 and AhLGSY73 contain a single CDS, while the remaining members contain two or more CDSs. The nine AhSAMS proteins cluster into five evolutionary branches (Group IV), specifically Groups III, IV, and V. Group III contains one member (AhFJ1AK4), Group IV contains two members (Ah6Q1KS5 and AhRG5YED), and Group V contains six members. The peanut SAMS gene is most closely related to the soybean homolog, reflecting the evolutionary conservation of legumes (see...). Figure 2 , 3 As shown, where Figure 2This is a phylogenetic analysis diagram of the peanut AhSAMS family and its homologs in multiple species. This neighbor-joining (NJ) phylogenetic ring tree shows the evolutionary relationships among the SAMS homologous amino acid sequences from 9 peanut SAMS families and 7 representative species (Arabidopsis thaliana (4), wheat (13), rice (3), soybean (10), tobacco (14), maize (4), and barley (4)). This tree was constructed using the neighbor-joining method based on amino acid sequence alignment (default parameters, branch confidence was evaluated through 1000 bootstrap replicates). The fill level of the rings at branch points (range 0.7 to 1.0) indicates the bootstrap support value; a higher support value indicates a stronger reliability of the corresponding branch's evolutionary relationship. Figure 3 These are conserved motifs, domains, sequence alignments, and 3D structural analysis diagrams of peanut AhSAMS family genes. (A) Analysis of conserved motifs in the AhSAMS family. Conserved motifs were identified using the MEME tool (maximum motif number set to 10, minimum motif length set to 6 amino acids). Rectangles of different colors represent motifs 1-10. The horizontal axis represents amino acid positions. (B) Major amino acid composition of AhSAMS family members. (C) Multiple sequence alignment of the AhSAMS family with rice OsSAM1. Using rice OsSAM1 as a reference sequence, the ClustalW algorithm was used for alignment. Color gradients indicate amino acid conservation (red represents high conservation). Key conserved motifs are marked: C-terminal ATP-binding motif (GGGAFSGKD) and central methionine-binding motif (GAGDQGHMFG). Red boxes indicate core conserved regions; blue shading indicates 100% identity. (D) 3D structural prediction of AhSAMS family proteins. Homology modeling was performed using rice OsSAM1 as a template based on the Alphafold platform. The spatial folding structures of OsSAM1, Ah6Q1KS5, AhRG5YED, and AhFJ1AK4 were demonstrated. Conserved collinear blocks were found in peanut SAMS genes between diploid ancestors and tetraploid species, indicating stable genome structure during polyploidization. The promoter region was enriched with light-responsive elements (G-box, GT1-motif), hormone-responsive elements (ABA, JA, IAA related), stress-responsive elements (drought, low temperature, salt stress related), and development-related elements (meristematic activation, seed-specific regulation). Figure 4(A) Collinearity analysis of AhSAMS genes during peanut ploidy evolution. Chromosomal fragments from wild diploid species (A. duranensis, A. ipaensis), wild tetraploid species (A. monticola), and cultivated species (A. hypogaea) are shown. Yellow / green / pink rectangles represent genomic regions containing loci. Arrows indicate the correspondence between homologous chromosomal regions in different species. Blue curves connect homologous AhSAMS gene pairs. (B) Prediction of cis-regulatory elements in the AhSAMS gene promoter region. The transcription start site (TSS) upstream 2000 bp region was analyzed using the PlantCARE database. Elements are classified by function. Light blue: light-responsive elements; pink: hormone-responsive elements; green: stress-responsive elements; yellow: development-related elements. The numbers in the table indicate the number of elements of each type. (C) Prediction of protein-protein interaction network of AhSAMS protein. This interaction network was constructed using the STRING database (confidence threshold >0.7). Nodes represent proteins (labeled with gene names); edges represent predicted interactions, with line width proportional to confidence scores. (D) Schematic diagram of peanut tissue sampling used for breeding analysis. Nine representative tissues (numbered 1-9) are labeled: 1. Root, 2. Stem, 3. Shoot tip, 4. Leaf, 5. Stamen, 6. Pistil, 7. Peg, 8. Pericarp, 9. Seed coat. This defines the source of material for subsequent tissue-specific expression analysis. (E) Tissue-specific expression profile of the AhSAMS gene. The heatmap shows the normalized expression values ​​after log2 transformation. Red: high expression; blue: low expression. (F) Inoculation with Ralstonia solanacearum (Ralstonia solanacearum, 10 8 Heatmaps of AhSAMS gene expression in H107 and H108 varieties at different time points (0 days, 1 day, 7 days) after CFU / mL. The intensity of the color in the heatmap represents the relative change in gene expression levels; darker colors indicate greater magnitude of change.

[0050] Example 2: Response of the peanut SAMS gene to biotic and abiotic stresses

[0051] 2.1 Experimental Materials and Reagents

[0052] The peanut variety resistant to bacterial wilt, “Nongdahua 108” (H108), and the susceptible variety, “Nongdahua 107” (H107), were bred by Professor Yin Dongmei's team at Henan Agricultural University. Ralstonia solanacearum strain 180731 was provided by Wang Zhenyu's team at the Henan Academy of Agricultural Sciences. Reagents included salicylic acid (SA), abscisic acid (ABA), methyl jasmonic acid (MeJA), Tween 20, 70% ethanol, 5% sodium hypochlorite, EZNA® Plant RNA Kit (Omega Bio-tek), PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa), and TB Green Premix Ex TaqII (TaKaRa). Equipment included an artificial climate chamber (Philips LPB2819), a CFX96 Touch™ qRT-PCR system (Bio-Rad), a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific), and a high-speed refrigerated centrifuge.

[0053] 2.2 Experimental Methods

[0054] 2.2.1 Plant Culture and Stress Treatment

[0055] Seeds were treated with 70% ethanol for 30 seconds, sterilized with 5% sodium hypochlorite by shaking for 10 minutes (120 rpm), rinsed three times with sterile water, and then germinated on sterile filter paper in a 28℃ incubator for 3 days (radicle ≥ 5 mm). Germinated seedlings were transferred to hydroponic incubators containing 1 / 2 Hoagland nutrient solution (3L / incubator, 12 seedlings / incubator). The pH of the nutrient solution was adjusted to 7.0±0.1, EC value 1.2±0.1 mS / cm, and continuous aeration (0.5L / min / incubator) was maintained, with the solution changed every 2 days. The culture conditions were 26 / 20℃ (day / night), 65%±5% relative humidity, 16 / 8h light / dark cycle, and light intensity of 300 μmol / m². -2 s -1 .

[0056] Biological stress treatment (Ralstonia solanacearum inoculation): Seedlings were inoculated using the root dip method when they reached the three-leaf stage. The pathogen was cultured in TTC medium at 28°C and 180 rpm until the logarithmic growth phase (OD600=0.6), and the concentration was adjusted to 10. 8 cfu / mL; use sterile scissors to slightly damage the lateral roots (1-2 mm incision), immerse the roots in the bacterial solution for 30 min, and set up sterile water soaking the roots as a control.

[0057] Abiotic stress treatments (hormone treatments): SA treatment: 3 mM SA (dissolved in sterile water, stock solution 1 M), foliar sprayed onto runoff, with 0.1% Tween 20 added as a surfactant; ABA treatment: 38 μM ABA (dissolved in 95% ethanol, stock solution 10 mM), foliar sprayed onto runoff, with 0.1% Tween 20 added; MeJA treatment: 100 μM MeJA (dissolved in 95% ethanol, stock solution 100 mM), foliar sprayed onto runoff, with 0.1% Tween 20 added; Control settings: 0.1% ethanol solution (solvent control), sterile water (blank control). Sample collection: Root and leaf samples were collected at 0, 1, and 7 days after treatment. Each treatment had 3 biological replicates. Roots / leaf samples from 3 plants were collected from each replicate, flash-frozen in liquid nitrogen, and stored at -80°C for RNA extraction.

[0058] 2.2.2 RNA extraction and qRT-PCR analysis

[0059] Total RNA was extracted using the EZNA® Plant RNA Kit, and its integrity was verified by 1.5% agarose gel electrophoresis. Purity was determined using NanoDrop 2000 (A260 / A280 = 1.8-2.1). Using 1 μg of total RNA as a template, first-strand cDNA was synthesized using the PrimeScript™ RT reagent Kit with gDNA Eraser to remove genomic DNA contamination. AhSAMS gene-specific primers were designed using Primer 5.0. The primer sequences used in this invention are shown in Table 2. The primer-amplified fragment length was 80-150 bp, and the amplification efficiency was 95%-105%. Specificity was verified by melting curve analysis. Actin7 was used as an internal control gene. The reaction system was 10 μL (TB Green Premix Ex Taq II 5 μL, forward and reverse primers 0.5 μL each, cDNA template 1 μL, ddH2O 3 μL). The reaction program was: 95℃ pre-denaturation for 30 s, 40 cycles (95℃ 5 s, 58℃ 30 s), and melting curve analysis (65℃-95℃, increments of 0.5℃). The relative expression level was calculated using the 2⁻ΔΔCt method. Data are expressed as mean ± standard deviation (SD) and statistical analysis was performed using GraphPad Prism 8.0.

[0060] Table 2

[0061] Name Seqence 5'-3' q-AhRG5YED-F GGCTACTGCCAAACCTGAAT q-AhRG5YED-R GGTGACCCTCATTCACTGAC q-Ah6Q1KS5-F CGGTATAGGCTTTGTGTCCG q-Ah6Q1KS5-R CATGGACACCCTGTGCAATA q-AhFJ1AK4-F CCGGTCTCACTGGAAGAAAG q-AhFJ1AK4-R CCTTACGATATAGGCACCGC q-AhPNM9T4-F AGCAGCACAAAGATGGAGAC q-AhPNM9T4-R CTGGGTCTTGCTCCAAACAA Actin7-F TTGGAATGGGTCAGAAGGATGC Actin7-R AGTGGTGCCTCAGTAAGAAGC β-Actin-F [[ID=6 ​ ​ ​ ​ ​ ​ ​ AGAGAACACGGGGGACGAGCTCATGGGATCACAATCTGCCTATAAAC pCambia1300-AhRG5YED-R AGCTCCTCGCCCTTGCTCACCATTTATTCTTGGGGCTTCTCCCAG pCambia1300-Ah6Q1KS5-F AGAGAACACGGGGGACGAGCTCATGGCTTGGGGCTTTTGGATCA pCambia1300-Ah6Q1KS5-R AGCTCCTCGCCCTTGCTCACCATTTATTCTTGGGGCTTCTCCCAG

[0062] 2.2.3 Tissue-specific expression analysis

[0063] Transcriptome data (accession GSE71357) of the peanut variety Tifrunner, publicly available in the PeanutBase database, includes RNA-seq data from nine tissues: root, stem, shoot tip, leaf, stamen, pistil, peg elongation stage, fruit stage, and seed stage, with three biological replicates for each tissue. Gene expression levels were quantified in TPM (Transcripts Per Million), and expression heatmaps were generated by matching AhSAMS gene identifiers with database gene IDs using TBtools.

[0064] 2.3 Experimental Results

[0065] Members of the AhSAMS gene family exhibit significant tissue heterogeneity in expression. AhFJ1AK4 is constitutively highly expressed, with TPM values ​​ranging from 77.33 to 412.21 across all tissues, showing the highest expression in pistils (412.21 TPM) and roots (346.72 TPM). AhRG5YED shows preferential expression in reproductive organs (pistils 28.24 TPM, young pods 50.15 TPM, young seeds 34.50 TPM). AhPNM9T4 is specifically enriched in stamens (35.19 TPM, more than 10 times higher than in other tissues). Ah6Q1KS5 shows high expression in roots (6.19 TPM) and pistils (4.74 TPM). Figure 4 D, E).

[0066] Seven days after inoculation, the expression levels of AhRG5YED and Ah6Q1KS5 in the bacterial wilt-resistant variety H108 were significantly upregulated, increasing 7-fold compared to the control (p<0.01), and significantly higher than the expression levels in the susceptible variety H107 at the same time point; AhFJ1AK4 maintained high expression in both varieties, but showed no significant induced response; the expression of other genes remained largely unchanged. Figure 5 A, where Figure 5 This is a graph showing the relative expression analysis of four peanut SAMS gene family members (AhRG5YED, Ah6Q1KS5, AhPNM9T4, AhFJ1AK4) under stress treatment using qRT-PCR. (A) Ralstonia solanacearum (10 8(cfu / mL), (B) 3 mM salicylic acid, (C) 38 µM abscisic acid, (D) 100 μM methyl jasmonate. Data are the mean ± standard deviation of three biological replicates (n=3). Statistical significance between H107 and H108 at the same time point was determined by an unpaired t-test: * p < 0.05, ** p < 0.01, NS indicates no significance). Abiotic stress (hormonal) response: SA treatment: Ah6Q1KS5 was significantly upregulated in H108 at 7 days (p<0.05), while AhRG5YED and AhPNM9T4 showed no significant changes. No significant induced response was observed in any of the detected genes in H107. ABA treatment: AhRG5YED and Ah6Q1KS5 in H108 were significantly higher than those in H107 at both 1 and 7 days (p<0.05), with expression levels more than 2-fold higher than the control. MeJA treatment: AhRG5YED and Ah6Q1KS5 were significantly upregulated in H108 at both 1 and 7 days, while AhFJ1AK4 was significantly induced at 7 days (p<0.05). No significant changes were observed in the expression of any genes in H107. Figure 5 BD).

[0067] Example 3 Cloning of the peanut Ah6Q1KS5 gene

[0068] 3.1 Plant materials and total RNA extraction

[0069] The root system of Nongdahua 108 (H108), a peanut variety resistant to bacterial wilt, was selected as the material. Total RNA was extracted using the EZNA® PlantRNA Kit (Omega Bio-tek). RNA integrity was detected by 1.5% agarose gel electrophoresis, and RNA purity and concentration were determined using NanoDrop 2000.

[0070] 3.2cDNA synthesis

[0071] First-strand cDNA was synthesized using 1 μg total RNA as a template and the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa).

[0072] 3.3 Gene Cloning

[0073] Based on the sequence information of Ah6Q1KS5 in the peanut genome database, specific primers were designed:

[0074] Ah6Q1KS5-F: 5'-ATGGCTTGGGGCTTTTGGATCA-3'

[0075] Ah6Q1KS5-R:5'-CTGGGAGAAGCCCCAAGAA-3'

[0076] Using cDNA as a template, PCR amplification was performed using KOD-Plus-Neo high-fidelity enzyme. The reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 68℃ extension for 90 s, 35 cycles; and 68℃ final extension for 10 min. After separation of the PCR products by 1% agarose gel electrophoresis, the target fragment was recovered using a gel extraction kit (Vazyme), ligated into a 5×TA / Blunt-Zero Cloning Kit (Novizan), transformed into E. coli DH5α, positive clones were screened and sequenced to obtain the coding sequence of Ah6Q1KS5.

[0077] Example 4 Construction of recombinant expression vector

[0078] 4.1 Vector digestion

[0079] The pCambia1300-YFP vector was double-digested with SacⅠ and KpnⅠ (NEB), reacted at 37℃ for 2 h, and then inactivated by heat at 85℃ for 5 s. The linearized vector was then recovered.

[0080] 4.2 Ligation of the target fragment to the vector

[0081] The Ah6Q1KS5 coding sequence was homologously ligated to a linearized vector using the Seamless Assembly Cloning Kit (Clone Smarter). The reaction mixture consisted of 4 μL of the insert, 3 μL of the linearized vector, 2 μL of 5×CE Ⅱ Buffer, and 1 μL of Exnase Ⅰ. The reaction was carried out at 37 °C for 30 min.

[0082] 4.3 Transformation and Identification

[0083] The ligation product was transformed into E. coli DH5α, plated on LB medium containing 50 mg / L kanamycin, and incubated at 37°C for 12 h. Single clones were picked for PCR identification, and positive clones were sequenced to verify the recombinant expression vector pCambia1300-Ah6Q1KS5-YFP.

[0084] Example 5: Identification of bacterial wilt resistance in peanut plants

[0085] 5.1 Preparation of Agrobacterium tumefaciens bacterial culture

[0086] Select single clones of Agrobacterium EHA105 containing the recombinant vector pCambia1300-Ah6Q1KS5-YFP and the empty vector pCambia1300-YFP, and inoculate them into 5 mL of YEP liquid medium containing two antibiotics (50 mg / L kanamycin + 25 mg / L rifampin). Incubate at 28°C with shaking at 180 rpm for 12-16 h until the early logarithmic growth phase (OD2).600 ≈0.4). Transfer the activated bacterial culture to fresh YEP liquid medium at a ratio of 1:100 and continue culturing until OD. 600 =0.6-0.8; collect bacterial cells by centrifugation at 5000 rpm for 10 min, resuspend in 1 / 2 MS liquid medium containing 100 μM acetylsyringone (AS), and adjust OD. 600 Set the solution to 0.6 and let it stand at room temperature for 30 minutes before use.

[0087] 5.2 Transient overexpression in peanut leaves

[0088] Select the second and third fully expanded leaves from the top of H107 seedlings at the three-leaf stage. Using a sterile syringe (needle removed), inject the prepared Agrobacterium suspension from the underside of the leaves (3-4 injection sites per leaf, approximately 0.1 mL per site), ensuring the suspension is evenly distributed into the leaf mesophyll tissue. Transfer the injected plants to an artificial climate chamber and incubate at 25℃, 90% relative humidity, and in the dark for 24 hours. Then, restore the conditions to normal incubation (26 / 20℃ day / night, 16 / 8h light / dark cycle) and incubate for 48 hours before inoculating with pathogens.

[0089] 5.3 Pathogen inoculation

[0090] Ralstonia solanacearum strain 180731 was cultured to the logarithmic growth phase (OD600=0.6). Transgenic peanut plants and wild-type plants were inoculated using the leaf-cutting method at an inoculation concentration of 10⁸ CFU / mL. Each treatment was divided into three biological replicates, with six plants per replicate.

[0091] 5.4 Observation of resistance phenotype

[0092] Observe the disease status of plants 3 days after inoculation and conduct cell death and pathogen detection.

[0093] Cell death detection (trypan blue staining): Take inoculated leaves, immerse them in 0.4% trypan blue staining solution, incubate at 95℃ for 10 min, and decolorize at room temperature for 24 h (decolorize with trichloroacetaldehyde hydrate solution until the background is transparent); observe under an optical microscope and count the proportion of blue stained area (dead cells) to the total area of ​​the leaf.

[0094] H2O2 accumulation detection (DAB staining): Fresh leaves were soaked in 1 mg / mL DAB staining solution (pH=3.8) and stained at room temperature in the dark for 8 hours; the leaves were destained by boiling with anhydrous ethanol for 10 minutes, and the distribution and intensity of the brown precipitate were observed under an optical microscope. The proportion of brown area was quantitatively analyzed by ImageJ software.

[0095] Pathogen count detection (plate count method): Take 0.1g of inoculated leaves, add 1mL of sterile water and grind into a homogenate, then serially dilute to 102. -4 -10-6 100 μL of the diluted solution was spread onto TTC medium and incubated at 28°C for 48 h. The number of colonies was counted, and the number of pathogens per gram of fresh leaf weight (cfu / g) was calculated.

[0096] 5.5 Experimental Results

[0097] This invention involves inoculating tobacco leaves that transiently overexpress these two genes with *Ralstonia solanacearum*, and verifying the disease efficacy according to Koch's postulates (see...). Figure 6 As shown in Figure A, (A) molecular identification of *Ralstonia solanacearum* by 16S rRNA PCR to verify Koch's postulates. M: Trans2K Plus DNA Marker; Lane 1: H2O (negative control); Lanes 2-4: *Ralstonia solanacearum* cultures. (BC) Phenotypic and histochemical analysis of leaves from *Nicotiana benthamiana* (B) and peanut (C) after inoculation with *Ralstonia solanacearum*. Treatments included: simulated control, empty vector control, and transient overexpression of AhRG5YED-YFP or Ah6Q1KS5-YFP. Leaves were collected on day 3 post-inoculation (3 dpi) for TB (trypan blue) and DAB (3,3'-diaminobenzidine) staining. (D) Relative expression level of Ah6Q1KS5 in peanut leaves transiently overexpressing Ah6Q1KS5-YFP. Data are presented as mean ± standard deviation (n = 3 biological replicates); p < 0.01. (E) Accumulation of reactive oxygen species (ROS) in peanut leaves transiently expressing pCambia1300-YFP or Ah6Q1KS5-YFP on day 3 post-inoculation. Data are mean ± standard deviation (n = 3); p < 0.01 (Student's t-test). (F) SAMS enzyme activity in peanut leaves transiently overexpressing Ah6Q1KS5-YFP on day 3 post-inoculation with Ralstonia solanacearum. (G) Bacterial count in peanut leaves on day 3 post-inoculation, expressed as colony-forming units per gram of fresh weight (cfu / g). Data are mean ± standard deviation (n = 3); p < 0.01 (Student's t-test). (H) Relative expression level of Ah6Q1KS5 in the roots of field-grown peanut varieties after Ralstonia solanacearum inoculation. Data are mean ± standard deviation (n = 3); p < 0.01 (one-way ANOVA and Tukey post-hoc test). Three days after inoculation, tobacco leaves overexpressing AhRG5YED-YFP exhibited symptoms similar to the empty vector control group, while the phenotype of leaves overexpressing Ah6Q1KS5-YFP showed no significant difference from the blank control group. Trypan blue staining results showed that overexpression of Ah6Q1KS5-YFP significantly reduced cell death. In contrast, the amount of hydrogen peroxide accumulated in leaves overexpressing AhRG5YED-YFP was significantly lower than that in the Ah6Q1KS5-YFP group and the empty vector control group. Figure 6 B).

[0098] To further verify the inhibitory effect of Ah6Q1KS5 on bacterial wilt pathogen, the Ah6Q1KS5-YFP fusion protein was transiently expressed in peanut leaves. Figure 6 C, D). Trypan blue staining confirmed that overexpression of this gene reduced cell death, and hydrogen peroxide accumulation was significantly reduced in leaves overexpressing AhRG5YED-YFP. Figure 6 E). Enzyme activity assays confirmed that Ah6Q1KS5 possesses S-adenosylmethionine synthase activity ( Figure 6 F), this result supports the consistency of the structural conservation predictions for AhSAMS proteins with the functionally known OsSAMS1. Figure 3 D). Furthermore, 3 days after inoculation, the bacterial count in peanut leaves overexpressing pCambia1300-YFP was significantly higher than that in the Ah6Q1KS5-YFP expression group (D). Figure 6 G). Analysis of peanut root systems inoculated with bacterial wilt pathogen in the field showed that the expression level of Ah6Q1KS5 in the H108 genotype was significantly higher than that in the H107 genotype. Figure 6 H). In summary, the results indicate that Ah6Q1KS5 can enhance the resistance of peanuts to bacterial wilt.

[0099] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A peanut bacterial wilt resistance-related gene, Ah6Q1KS5, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.1, or a nucleotide sequence that has at least 90% homology with the sequence shown in SEQ ID NO.1 and encodes the same functional protein.

2. A protein encoded by the gene Ah6Q1KS5 as described in claim 1, characterized in that, The amino acid sequence is as shown in SEQ ID NO.2, or an amino acid sequence based on the sequence shown in SEQ ID NO.2 with one or more amino acid substitutions, deletions, or additions and having the same bacterial wilt resistance regulatory function.

3. A recombinant expression vector containing the gene Ah6Q1KS5 as described in claim 1, characterized in that, The recombinant expression vector was constructed by inserting the coding sequence of Ah6Q1KS5 into the pCambia1300-YFP base vector.

4. A recombinant bacterium containing the recombinant expression vector of claim 3, characterized in that, The recombinant bacteria is Agrobacterium EHA105.

5. The application of the gene Ah6Q1KS5 as described in claim 1 and the protein as described in claim 2 in the breeding of peanut varieties resistant to bacterial wilt.

6. A method for breeding peanut varieties resistant to bacterial wilt, characterized in that, Includes the following steps: S1. Construct the recombinant expression vector as described in claim 3, and transform it into Agrobacterium; S2. The recombinant expression vector was introduced into peanut receptor material via Agrobacterium-mediated transformation to obtain peanut leaves with transient overexpression. S3. Identify bacterial wilt resistance in overexpressing peanut plants, screen out resistant plants, and breed offspring.

7. The method for breeding peanut varieties resistant to bacterial wilt according to claim 6, characterized in that, In step S2, the peanut receptor material is the bacterial wilt susceptible variety Nongdahua 107 (H107).

8. The method for breeding peanut varieties resistant to bacterial wilt according to claim 6, characterized in that, In step S3, the bacterial wilt resistance identification includes artificial inoculation with Ralstonia solanacearum, observation of plant disease symptoms, detection of leaf cell death and the number of pathogens.

Images