Recombinant pichia pastoris strain for expressing six-tandem antibacterial peptide MPX as well as construction method and application of recombinant pichia pastoris strain

By optimizing the codons and designing the tandem of the MPX coding sequence, an expression vector with specific restriction sites was constructed. The induction conditions of Pichia pastoris were optimized, which solved the problems of low expression level and easy degradation of MPX in Pichia pastoris. This resulted in efficient expression and good biological activity, which can be applied to the large-scale preparation of antimicrobial peptides and animal health management.

CN121896263APending Publication Date: 2026-04-21HENAN INST OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HENAN INST OF SCI & TECH
Filing Date
2026-01-09
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

In the existing technology, MPX expression levels in Pichia pastoris are low, it is easily degraded by endogenous proteases, and the expression products have insufficient activity, making it difficult to meet the needs of large-scale applications.

Method used

By optimizing the MPX coding sequence with codons, designing a six-copy tandem structure, constructing an expression vector with specific restriction enzyme sites, and optimizing the induction expression conditions of Pichia pastoris, efficient and stable expression was achieved.

Benefits of technology

The expression level and stability of MPX in Pichia pastoris were improved, resulting in an antimicrobial peptide product with good biological activity that can effectively inhibit Salmonella infection and can be used as an animal feed additive and for the treatment of intestinal inflammation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121896263A_ABST
    Figure CN121896263A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of genetic engineering, in particular to a recombinant pichia pastoris strain for expressing six tandem antibacterial peptides MPX as well as a construction method and application of the recombinant pichia pastoris strain. Aiming at the technical problems that the expression quantity of MPX in pichia pastoris is low, MPX is easily degraded by endogenous protease, the product activity is insufficient and the like, the invention constructs a recombinant pichia pastoris strain for expressing the six-tandem antibacterial peptide MPX, and a construction method comprises the following steps: designing and constructing a coding sequence of the six-tandem antibacterial peptide MPX; and a recombinant expression vector pPICZ alphaA-6MPX for expressing the six-tandem antibacterial peptide MPX is constructed. A linearized recombinant vector is introduced into pichia pastoris GS115 through a chemical conversion method, a positive transformant is screened through a bleomycin-containing selective culture medium, and a recombinant strain for stably expressing six tandem MPX is obtained by combining PCR and Westernblot identification. The recombinant strain can be used for inhibiting growth of pathogenic bacteria and has application potential as an antibacterial active preparation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a recombinant Pichia pastoris strain expressing the six-tandem antimicrobial peptide MPX, its construction method, and its application. Background Technology

[0002] With the long-term and extensive use of antibiotics in medicine, animal husbandry, and other fields, bacterial resistance has become an increasingly serious problem and one of the major threats to global public health systems. While traditional antibiotics kill pathogens, they also disrupt the balance of the host's normal gut flora, leading to dysbiosis, weakened immunity, and a series of other side effects. Furthermore, the continuous emergence of drug-resistant strains has reduced or even rendered ineffective the efficacy of many commonly used antibiotics, urgently requiring the development of new antibacterial methods that can replace or reduce antibiotic use.

[0003] Antimicrobial peptides (AMPs) are a class of small-molecule amphiphilic polypeptides composed of several to dozens of amino acids. They are widely found in animals, plants, and microorganisms, possessing advantages such as broad-spectrum antibacterial activity, low toxicity, high thermal stability, and low likelihood of inducing drug resistance, making them important candidates for antibiotic alternatives. Despite the outstanding activity of natural AMPs, their industrial application is still limited by several factors: for example, direct extraction from organisms is difficult and yields are low; some natural AMPs exhibit cytotoxic and hemolytic activities; and chemical synthesis is costly and difficult to mass-produce. These factors all limit the widespread application of AMPs in practical industries.

[0004] MPX (MastoparanX) is a class of small-molecule antimicrobial peptides derived from the venom of hymenopteran insects, exhibiting significant antibacterial, anti-inflammatory, and immunomodulatory activities. Studies have shown that MPX has significant inhibitory effects on both Gram-positive and Gram-negative bacteria, including Staphylococcus aureus, Escherichia coli, and Salmonella, and can inhibit the formation of biofilms from various pathogenic bacteria. Compared to some natural AMPs, MPX exhibits low hemolysis and weak cytotoxicity, demonstrating good biocompatibility and thus attracting widespread attention. However, the natural sources of MPX are limited, direct extraction yields are extremely low, and preparation costs are high, making it difficult to meet the needs of practical large-scale applications.

[0005] Genetic expression systems are the primary means of achieving large-scale, efficient production of AMPs. Currently, commonly used expression systems include *E. coli*, yeast, insect cells, and mammalian cell systems. Among these, *Pichia pastoris* has become one of the mainstream systems for heterologous protein and peptide production due to its stable metabolism, high expression levels, ability to correctly fold and process eukaryotic proteins, and low culture costs. Previous studies have shown that various antimicrobial peptides can be expressed in *Pichia pastoris* to obtain bioactive products. However, although *Pichia pastoris* is an ideal host for heterologous protein expression, for antimicrobial peptides, there are still problems such as limited expression levels, low secretion efficiency, and easy degradation of peptides by yeast endogenous proteases. Furthermore, existing literature rarely reports on adaptation optimization strategies for MPX (such as codon optimization, tandem design, and restriction enzyme site arrangement), resulting in a failure to effectively improve the activity, stability, and downstream application value of the expressed products. Therefore, how to improve the expression efficiency of MPX in *Pichia pastoris* and obtain bioactive products remains to be achieved. Summary of the Invention

[0006] To address the aforementioned problems, this invention aims to provide a recombinant Pichia pastoris strain expressing the six-tandem antimicrobial peptide MPX, its construction method, and its applications. By optimizing the MPX coding sequence with codons, designing a multi-copy tandem structure, constructing an expression vector with specific restriction enzyme sites, and optimizing the induction expression conditions in Pichia pastoris, MPX can be efficiently and stably expressed in Pichia pastoris, yielding an antimicrobial peptide product with good biological activity.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: On the one hand, a method for constructing a recombinant Pichia pastoris strain expressing the six-tandem antimicrobial peptide MPX, characterized in that the construction method includes: Design the coding sequence of the hexatandem antimicrobial peptide MPX, wherein the amino sequence of the hexatandem antimicrobial peptide MPX is shown in SEQ ID NO. 2; Construct a recombinant plasmid pPICZαA-6MPX for expressing the six-tandem antimicrobial peptide MPX; The linearized recombinant plasmid pPICZαA-6MPX was transformed into Pichia pastoris GS115 competent cells to obtain the initial recombinant Pichia pastoris strain GS115 / pPICZαA-6MPX. The initial recombinant Pichia pastoris strain GS115 / pPICZαA-6MPX was screened on bleomycin medium to obtain positive recombinant strains, which were then identified. Positive recombinant Pichia pastoris strain GS115 / pPICZαA-6MPX was cultured under methanol-induced conditions, including a final methanol concentration of 1%, 28°C, 180 rpm / min, and culture for 3–5 days, so that the expression product of the six-tandem antimicrobial peptide MPX was present in the cultured yeast GS115 cells. The expression product of the six-tandem antimicrobial peptide MPX was identified using Western blot.

[0008] Secondly, the construction of the MPX encoding sequence for the six-tandem antimicrobial peptide includes the following steps: Using the gene unit encoding the antimicrobial peptide MPX as the basic repeat unit, and the enterokinase cleavage site DDDK as the linking sequence between adjacent MPX units, six MPX gene units were tandemly linked, and a His tag coding sequence was added to the end of the tandem structure to obtain the original nucleotide sequence of six-tandem MPX. Based on the codon preference of Pichia pastoris, the original hexatandem MPX nucleotide sequence was codon optimized, and EcoRI and KpnI restriction endonuclease sites were introduced at its 5' and 3' ends, respectively. At the same time, a stop codon was set to obtain the hexatandem MPX coding sequence for subsequent ligation into the expression vector pPICZαA.

[0009] Thirdly, the six-tandem MPX coding sequence fragment and the pPICZαA vector were digested with EcoRI and KpnI, respectively, so that the six-tandem MPX coding sequence fragment was directionally inserted between the EcoRI and KpnI sites of pPICZαA to construct the recombinant plasmid pPICZαA-6MPX.

[0010] Fourthly, the induction time for methanol-induced induction is 3 days.

[0011] Fifthly, the recombinant Pichia pastoris strain was prepared using the above-mentioned construction method.

[0012] The sixth aspect is the application of recombinant Pichia pastoris strains expressing the six-tandem antimicrobial peptide MPX in the preparation of animal feed additives for inhibiting or preventing Salmonella infection.

[0013] The seventh aspect concerns the application of recombinant Pichia pastoris strains expressing the six-tandem antimicrobial peptide MPX in the preparation of drugs for treating or preventing intestinal inflammation caused by Salmonella infection.

[0014] Compared with existing technologies, the recombinant Pichia pastoris strain expressing the six-tandem antimicrobial peptide MPX, its construction method, and its application bring the following significant advantages: 1. This invention optimizes the MPX coding sequence based on the codon preferences of Pichia pastoris and employs a tandem structure of six-copy MPX via an enterokinase cleavage sequence DDDDK, significantly improving the translation efficiency and expression stability of exogenous genes in Pichia pastoris. Compared to single-copy MPX, the tandem structure increases the protein molecular weight and reduces the risk of degradation by endogenous proteases, thereby obtaining higher expression levels and more stable antimicrobial peptide products; 2. This invention uses DDDDK as the linking sequence between tandem MPX molecules, enabling the expression product to release the native conformation of MPX monomers under the action of enterokinase after entering the animal intestine, thereby enhancing its antibacterial activity and bioavailability. This design combines the advantages of expression stability and active release under feeding conditions, avoiding the expression difficulties and activity loss problems caused by excessively small molecular weight of antimicrobial peptides; 3. This invention optimizes the final methanol concentration and induction time to achieve the best MPX expression level in recombinant Pichia pastoris, thereby improving the final yield and functional performance of the active antimicrobial peptide. Simultaneously, Pichia pastoris grows rapidly, has a clear background, can undergo eukaryotic post-translational modification, and is safe and non-toxic, posing no threat to animals or the environment. This makes the expression system of this invention suitable for industrial fermentation and feed additive development. 4. The recombinant MPX obtained in this invention has shown an effective inhibitory effect on Salmonella infection in animal experiments, which can reduce intestinal bacterial load, improve intestinal tissue structure, and reduce inflammatory response, thus expanding its application prospects in the fields of feed additives and animal health management. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 Design diagram of the tandem antimicrobial peptide MPX; Figure 2 Predicted protein structure for tandem antimicrobial peptide MPX; Figure 3 The results are from the PCR identification of the six-tandem MPX gene. Figure 4 To screen for positive colonies transformed with GS115 / pPICZαA-6MPX for bleomycin; Figure 5 Screening for high-copy plasmid recombinant strains for bleomycin; Figure 6 To screen for positive recombinant yeast strains by PCR; Figure 7 To identify recombinant strains expressing MPX using Western blotting; Figure 8 To optimize the induction concentration of the target protein; Figure 9 Optimize the induction time for the target protein; Figure 10 Stability analysis of plasmid pPICZαA-6MPX in recombinant strains; Figure 11 For intestinal colony count analysis; Figure 12 These are pathological and histological changes. Detailed Implementation

[0017] This application proposes a recombinant Pichia pastoris strain expressing the hexatandem antimicrobial peptide MPX, its construction method, and its applications. It primarily addresses the technical challenges of low MPX expression levels, easy degradation by endogenous proteases, and insufficient activity of the expressed product in existing technologies within Pichia pastoris. This application achieves high-efficiency MPX expression in Pichia pastoris and obtains an antimicrobial peptide product with good biological activity through codon optimization of the MPX coding sequence, design of a tandem MPX structure, construction of a recombinant expression vector at a specific site, and transformation of an engineered Pichia pastoris strain. Simultaneously, it systematically optimizes methanol induction conditions. This lays the technical foundation for the large-scale preparation of MPX and its application in animal feed additives and other fields.

[0018] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0019] Example 1 like Figure 1-12 As shown, a method for expressing the six-tandem antimicrobial peptide MPX using Pichia pastoris includes the following steps: a. Design the nucleotide sequence of the six-tandem MPX gene unit and add restriction enzyme sites and stop codons as shown in SEQ ID NO. 1. Design the total amino acid sequence of the six-tandem antimicrobial peptide MPX unit as shown in SEQ ID NO. 2. The three-dimensional structure of the six-tandem antimicrobial peptide MPX is shown below. Figure 2 As shown.

[0020] SEQ ID NO.1 is as follows: GAATTCATTAATTGGAAAGGTATTGCTGCTATGGCAAAGAAATTGTTGGATGATGACGATAAAATTAATTGGAAAGGTATTGCTGCAATGGCAAAAAAGTTATTGGATGACGATGATAAGATTAACTGGAAGGGTATTGCTGCAATGGCTAAAAAATTATTGGATGATGACGACAAGATTAATTGGAA GGGTATTGCTGCTATGGCTAAGAAGTTATTGGATGACGATGATAAAATCAATTGGAAAGGTATTGCTGCTATGGCAAAGAAATTGTTGGATGATGACGATAAGATCAATTGGAAGGGTATTGCTGCAATGGCAAAAAAATTGTTAGATGACGATGATAAACATCACCATCACCATCATTAAGGTACC; SEQ ID NO.2 is: INWKGIAAMAKKLLDDDDKINWKGIAAMAKKLLDDDDKINWKGIAAMAKKLLDDDDKINWKGIAAMAKKLLDDDDKINWKGIAAMAKKLLDDDDKINWKGIAAMAKKLLDDDDKHHHHHH b. Provide a method for designing and synthesizing the hexatandem antimicrobial peptide MPX.

[0021] c. Construct the recombinant plasmid pPICZαA-6MPX expressing the six-tandem antimicrobial peptide MPX in a recombinant yeast strain; d. Transform Pichia pastoris GS115 cells with recombinant plasmid pPICZαA-6MPX. The transformation method of the recombinant plasmid is chemical transformation, using transformation reagents provided by Shanghai Weidi Biotechnology Co., Ltd. e. Screening and identifying transforming bacteria, wherein the method for screening transforming bacteria is to culture them on plates using a minimum synthesis medium containing bleomycin and in liquid culture using a maximum synthesis medium. f. The transformant bacteria were cultured for 3-5 days in 1% methanol (v / v), at 28°C and 180 rpm / min to obtain the hexatandem antimicrobial peptide MPX, which was present in the cells of cultured yeast GS115. g. Identification of the six-tandem antimicrobial peptide MPX, wherein the six-tandem antimicrobial peptide MPX is identified using Western blot.

[0022] The specific operation process of the method for expressing the antimicrobial peptide MPX using Pichia pastoris according to the present invention is as follows: (a) Obtaining the MPX sequence of the antimicrobial peptide: The amino acid sequence of the antimicrobial peptide MPX is: INWKGIAAMAKKLL. Using the enterokinase cleavage site DDDDK as a bridge, six antimicrobial peptide MPX units were sequentially tandemly and a His tag was added to the end, thus determining the amino acid sequence of the six-tandem antimicrobial peptide MPX (SEQ ID NO.2). Then, based on the codon preference of Pichia pastoris, synonymous codons were designed and optimized for the nucleotide sequence encoding the amino acid sequence, resulting in the optimized base sequence of the six-tandem MPX gene unit, SEQ ID NO.3. SEQ ID NO.3 is specifically as follows: ATTAATTGGAAAGGTATTGCTGCTATGGCAAAGAAAATTGTTGGATGATGACGATAAAATTAATTGGAAAGGTATTGCTGCAATGGCAAAAAAGTTATTGGATGACGATGATAAGATTAACTGGAAGGGTATTGCTGCAATGGCTAAAAAATTATTGGATGATGACGACAAGATTAATTGG AAGGGTATTGCTGCTATGGCTAAGAAGTTATTGGATGACGATGATAAAATCAATTGGAAAGGTATTGCTGCTATGGCAAAGAAATTGTTGGATGATGACGATAAGATCAATTGGAAGGGTATTGCTGCAATGGCAAAAAAATTGTTAGATGACGATGATAAACATCACCATCACCATCAT.

[0023] Based on the six-tandem MPX gene unit base sequence SEQ ID NO.3, an EcoRI restriction site was introduced upstream, a KpnI restriction site was introduced downstream, and a stop codon was added to form SEQ ID NO.1 ( Figure 1 ).

[0024] (II) Construction of expression vector pPICZαA-6MPX: The pPICZαA plasmid and the six-tandem MPX gene fragment shown in SEQ ID NO. 1 were digested with EcoRI and KpnI. The products were then recovered by 1% agarose gel electrophoresis, ligated with T4 ligase, and ligated at 16℃ for 6 h. The ligation reaction was performed on Escherichia coli TOP10 strains. The transformed colonies were identified by colony-linked PCR and sequenced. Figure 3 ) (III) Transformation of Pichia pastoris GS115 with recombinant plasmid pPICZαA-6MPX: 1. Linearized recombinant plasmid pPICZαA-6MPX The recombinant plasmid pPICZαA-6MPX was digested with SacI. After the product was identified by 1% agarose gel electrophoresis, the reaction solution was recovered using an Omega kit combined with ultrapure water, and the recovery effect was detected by electrophoresis again.

[0025] 2. Transformation of the linear plasmid pPICZαA-6MPX into Pichia pastoris competent cells GS115: ① Following the company's instructions, take a sterile 1.5ml EP tube and add 10ul of pre-cooled linear plasmid, 5ul of yeast conversion promoter, GS115 competent cells thawed on ice, and 500ul of Pichia pastoris conversion broth. Gently invert and mix 6-8 times.

[0026] ② Bathe in a 30℃ water bath for 30 minutes, gently turning and mixing 6-8 times every 15 minutes.

[0027] ③ Add 20 μL of dimethyl sulfoxide to each vial to improve conversion efficiency.

[0028] ④ Bathe in a 42℃ water bath for 15 minutes, gently turning and mixing 6-8 times every 7.5 minutes.

[0029] ⑤ Centrifuge briefly at 12000 rpm, discard the supernatant, add 1 ml of YPD and revive at 30℃ for 2 h.

[0030] ⑥ Centrifuge briefly at 12000 rpm, discard the supernatant, resuspend in 100 μL of 0.9% NaCl, and spread onto a YPD plate containing 1x bleomycin. Invert the plate and incubate at 30°C for 3-5 days until single clones grow. Figure 4 It shows the growth of a large number of single colonies.

[0031] 3. Screening for positive bacterial colonies using bleomycin-conjugated PCR reaction: ① Select multiple single colonies from the YPD plate, number and label them, and use a sterile toothpick to pick up bacterial cells and inoculate them onto a YPD solid plate containing 25 times the amount of bleomycin. Incubate at 30°C for 3-5 days until single colonies grow. Figure 5 ) ② On high-concentration bleomycin YPD solid plates, pick up the bacterial cells with a sterile toothpick and inoculate them into 1 ml of liquid containing 1x bleomycin in an EP tube. Incubate at 30°C for 24 h, then invert and mix once every 3 h until the culture medium becomes turbid.

[0032] ③ Take 0.5 ml of the turbid YPD bacterial culture and extract DNA according to the requirements of the yeast genome extraction kit.

[0033] ④ Add 2 µl of DNA to the PCR system. PCR reaction conditions: 95°C for 6 min, 95°C for 45 s, 55°C for 45 s, 72°C for 1 min, 30 cycles, 72°C for 8 min. Identify the amplified products by 1% agarose gel electrophoresis; positive colonies were detected. Figure 6 ) (iv) Expression of the hexatandem antimicrobial peptide MPX in engineered Pichia pastoris: 1. Inducing engineered bacteria to express a six-tandem MPX domain, the specific steps are as follows: ① Transfer 200µl of Pichia pastoris engineered strain with antimicrobial peptide MPX under 25-fold bleomycin conditions to 15ml of BMGY medium, incubate at 28℃ and 160rpm until the OD600 of the bacterial solution is 2~3, centrifuge at 5000rpm for 5min to collect the bacterial precipitate.

[0034] ② Resuspend in 15 mL of BMMY medium, culture continuously at 28℃ and 180 rpm for 3 days, add methanol every 24 h to a final concentration of 0.5%, and finally centrifuge at 8000 rpm for 5 min to collect the culture supernatant and bacterial cells.

[0035] ③ After washing with PBS, the bacterial cells were sonicated and the lysate and culture supernatant were screened and verified by Western blot. Figure 7 Analysis showed that the expressed antimicrobial peptides were mainly found inside cells and were mostly in the form of dimers.

[0036] (V) Optimization of expression conditions for the hexatandem antimicrobial peptide MPX in Pichia pastoris engineered strains: ① The recombinant Pichia pastoris strain with the best initial Western blot screening results was used as the subject of subsequent research to optimize conditions. Six controls were set for the final methanol concentration, namely 0.25%, 0.5%, 0.75%, 1%, 1.25%, and 1.5%, to determine the optimal methanol induction concentration. Figure 8 The optimal induction concentration was found to be 1%.

[0037] ②Based on the optimal methanol concentration, samples were taken at 24, 48, 72, 96, 120, and 144 hours to determine the optimal induction time for expression. Yeast transformants containing the empty pPICZαA vector were treated as negative controls. Figure 9 The optimal induction time is 72 hours.

[0038] (vi) Performance evaluation of recombinant Pichia pastoris GS115 / pPICZαA-6MPX strain: ① The recombinant bacteria were cultured in 15 mL of YPD liquid medium containing 1x bleomycin at 28°C with shaking at 180 rpm / min for 24 h to reach the plateau phase.

[0039] ② Inoculate the plateau-phase recombinant bacteria at a ratio of 1:10 into 1-fold bleomycin YPD liquid medium and culture at 28℃ with shaking at 180 rpm / min for 12 h.

[0040] ③ After the set time is reached, continue the culture by subculturing at a ratio of 1:10. Repeat this step, with 12 hours as one generation. Culture up to 50 generations, and identify the plasmid pPICZαA-6MPX by PCR every 10 generations of bacterial culture. Figure 10 This indicates that the pPICZαA-6MPX linear plasmid was maintained for at least 50 generations in Pichia pastoris.

[0041] ④ For the 50th generation recombinant bacteria identified, the culture medium was extracted at a ratio of 1:10, centrifuged at 5000 rpm for 5 min, the supernatant was discarded, 15 ml of BMGY medium was added, and the culture was continued with shaking for 24 h. After centrifugation at 5000 rpm for 5 min, the supernatant was discarded, 15 ml of BMMY medium and 1% methanol were added, and expression was induced for 72 h. Western blot was used to identify the expression of six-tandem MPX to analyze and determine the stability of the recombinant plasmid.

[0042] (vii) Evaluation of the resistance of recombinant Pichia pastoris strains to Salmonella infection: 1. Animal experiment setup Eight-week-old female Balb / c mice of uniform growth (Beijing Vital River Laboratory Animal Technology Co., Ltd.) were randomly divided into four groups: GS115 / pPICZαA-6MPX bacterial fragmentation group, GS115 / pPICZαA bacterial fragmentation group, 0.9% NaCl + CVCC541 bacterial fragmentation group, and 0.9% NaCl group. The supernatant of the bacterial fragments and 0.9% NaCl were administered to the mice via gavage twice daily for 24 days. On day 21, the mice were infected with Salmonella CVCC541, and then continued to be administered bacterial fragments and 0.9% NaCl. Relevant indicators were measured on day 3 post-infection (3DPI: 3-Day Post-Infection, day 24).

[0043] 2. Relevant Indicators ① Histopathological sections: After 3 DPI, mouse jejunum was recovered, histopathological sections were prepared, and analyzed. Figure 11The results showed that after Salmonella 3DPI treatment in mice, large-scale ulcers were observed, with necrosis and disappearance of intestinal villi epithelium and intestinal glands, replaced by proliferating connective tissue; numerous lymphocytes and granulocytes infiltrated, and inflammatory cells infiltrated into the submucosa; significant vascular congestion and extensive shedding of intestinal villi epithelial cells and intestinal glands. Compared with the 0.9% NaCl + CVCC541 group, the GS115 / pPICZαA lysate group showed small-scale ulcers, necrosis and disappearance of intestinal villi epithelium and intestinal glands, and a small number of intestinal villi epithelial cells sloughed off (orange arrows), with an incomplete muscular layer; a small number of lymphocytes and granulocytes infiltrated, and inflammatory cells infiltrated into the submucosa. In contrast, the GS115 / pPICZαA-6MPX lysate group showed abundant intestinal villi, basically intact epithelium, and numerous densely arranged intestinal glands in the lamina propria, with no obvious inflammatory cell infiltration.

[0044] ② Intestinal colony measurement: Mice infected with Salmonella CVCC541 were sacrificed on day 3. The jejunum was harvested and weighed using an electronic balance. 1 mL of PBS was added based on the jejunum weight, and the mixture was aseptically ground and diluted 10 μL with PBS. -2 200 μL of each sample was taken for plate counting. Figure 12 Analysis revealed that after 3DPI treatment with Salmonella, the average number of intestinal colonies in mice increased significantly, indicating a high level of Salmonella infection. The number of colonies in the GS115 / pPICZαA lysate group increased significantly again, indicating that the Salmonella infection was still high and also promoting the growth of intestinal flora. In contrast, the number of colonies in the GS115 / pPICZαA-6MPX lysate group decreased significantly, highlighting a significant inhibitory effect on Salmonella.

[0045] Among them, Pichia pastoris GS115 was purchased from Zhuangmeng Biotechnology Co., Ltd.; pPICZαA expression vector and Escherichia coli TOP10 were purchased from Weidi Biotechnology Co., Ltd.

[0046] This invention successfully expressed the tandem antimicrobial peptide MPX in Pichia pastoris and optimized the inducing agent concentration and induction time for the recombinant strain. This provides a new approach for the expression of antimicrobial peptides in yeast. The animal experimental results show that this invention has the potential to be used as an animal feed additive, reducing the use of antibiotics and chemicals, slowing the development of bacterial resistance, improving animal immunity, and alleviating Salmonella-induced intestinal inflammation.

[0047] The above description, in conjunction with specific preferred embodiments, provides a further detailed explanation of the present invention, enabling those skilled in the art to understand and apply it. However, it should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the inventive concept, without requiring creative effort. Therefore, any simple improvements made to the present invention by those skilled in the art based on the disclosure of this invention should be within the scope of protection of this invention.

Claims

1. A method for constructing a recombinant Pichia pastoris strain expressing the six-tandem antimicrobial peptide MPX, characterized in that, The construction methods include: Design the coding sequence of the hexatandem antimicrobial peptide MPX, wherein the amino sequence of the hexatandem antimicrobial peptide MPX is shown in SEQ ID NO. 2; Construct a recombinant plasmid pPICZαA-6MPX for expressing the six-tandem antimicrobial peptide MPX; The linearized recombinant plasmid pPICZαA-6MPX was transformed into Pichia pastoris GS115 competent cells to obtain the initial recombinant Pichia pastoris strain GS115 / pPICZαA-6MPX. The initial recombinant Pichia pastoris strain GS115 / pPICZαA-6MPX was screened on bleomycin medium to obtain positive recombinant strains, which were then identified. Positive recombinant Pichia pastoris strain GS115 / pPICZαA-6MPX was cultured under methanol-induced conditions, including a final methanol concentration of 1%, 28°C, 180 rpm / min, and culture for 3–5 days, so that the expression product of the six-tandem antimicrobial peptide MPX was present in the cultured yeast GS115 cells. The expression product of the six-tandem antimicrobial peptide MPX was identified using Western blot.

2. The construction method according to claim 1, characterized in that, The construction of the MPX encoding sequence for the six-tandem antimicrobial peptide includes the following steps: Using the gene unit encoding the antimicrobial peptide MPX as the basic repeat unit, and the enterokinase cleavage site DDDK as the linking sequence between adjacent MPX units, six MPX gene units were tandemly linked, and a His tag coding sequence was added to the end of the tandem structure to obtain the original nucleotide sequence of six-tandem MPX. Based on the codon preference of Pichia pastoris, the original hexatandem MPX nucleotide sequence was codon optimized, and EcoRI and KpnI restriction endonuclease sites were introduced at its 5' and 3' ends, respectively. At the same time, a stop codon was set to obtain the hexatandem MPX coding sequence for subsequent ligation into the expression vector pPICZαA.

3. The construction method according to claim 1, characterized in that, The recombinant plasmid pPICZαA-6MPX was constructed as follows: the hexagonal MPX coding sequence fragment and the pPICZαA vector were digested with EcoRI and KpnI enzymes, respectively, and the hexagonal MPX coding sequence fragment was directionally inserted between the EcoRI and KpnI sites of pPICZαA to obtain the recombinant plasmid pPICZαA-6MPX.

4. The construction method according to claim 1, characterized in that, The induction time for methanol induction is 3 days.

5. A recombinant Pichia pastoris strain expressing the six-tandem antimicrobial peptide MPX, characterized in that, The recombinant Pichia pastoris strain was prepared using the construction method described in any one of claims 1-4.

6. The use of the recombinant Pichia pastoris strain expressing the six-tandem antimicrobial peptide MPX as described in claim 5 in the preparation of animal feed additives for inhibiting or preventing Salmonella infection.

7. The use of the recombinant Pichia pastoris strain expressing the six-tandem antimicrobial peptide MPX as described in claim 5 in the preparation of a medicament for treating or preventing intestinal inflammation caused by Salmonella infection.