Integrated micro-fluidic chip for multiple eccDNA detection for lung cancer diagnosis

Abstract

The invention belongs to the technical field of medical biological detection, and particularly relates to an integrated micro-fluidic chip for multiple eccDNA detection for lung cancer diagnosis. The integrated micro-fluidic chip is formed by integrating a plurality of micro-fluidic detection units on a substrate, and each micro-fluidic detection unit comprises a DNA pre-enrichment area, a DNA purification area and a DNA detection area which are communicated in sequence. According to the present invention, the microfluidic chip technology is combined with the CRISPR / Cas12a system for the first time, such that the bottleneck that the single eccDNA detection sensitivity is insufficient is solved, and the high-sensitivity and high-specificity parallel detection of the multiple eccDNA is achieved so as to provide the reliable technical platform for the clinical conversion application of the eccDNA.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology and relates to microfluidic detection of eccDNA, specifically to an integrated microfluidic chip for multiplex eccDNA detection for lung cancer diagnosis and the corresponding detection method. Background Technology

[0002] Extrachromosomal circular DNA (ECCDNA) is widely present in various types of tumor tissues and peripheral fluids (such as blood, urine, and cerebrospinal fluid), participating in and driving malignant progression through multiple mechanisms during tumor development. Due to its circular topology, ECCDNA is resistant to nuclease degradation and is more stable in the peripheral circulation than linear DNA. With ongoing research, ECCDNA is showing increasing potential as a biomarker in clinical oncology applications, and is expected to be used in multiple stages, including early screening and diagnosis, prognostic assessment, efficacy monitoring, and the development of personalized treatment strategies.

[0003] However, due to the high randomness and uncertainty of eccDNA formation, relying solely on a single eccDNA as a biomarker for detection often results in lower sensitivity than conventional tumor markers, which limits its independent application value in clinical practice.

[0004] Microfluidic chips, as a highly integrated micro-analysis platform, have demonstrated great potential in fields such as disease diagnosis, environmental monitoring, and life science research. Meanwhile, CRISPR / Cas12a technology, with its highly efficient trans-cleavage activity of the Cas enzyme, has been widely used for highly specific nucleic acid detection. Combining microfluidic chips with a CRISPR / Cas12a system can fully leverage the technological advantages of both in precise fluid manipulation and efficient target recognition, thereby significantly improving the sensitivity and specificity of detection. More importantly, this integrated system features high throughput and full automation, enabling parallel detection of multiple eccDNA targets, effectively mitigating the false negative problem caused by the randomness of individual eccDNA samples, thus improving the reliability of the detection.

[0005] Therefore, in order to enhance the potential of eccDNA as a biomarker in tumor diagnosis and to achieve efficient and simultaneous detection of multiple eccDNA targets, this invention develops a novel multiplex detection strategy based on microfluidic chip and CRISPR / Cas12a technology. Summary of the Invention

[0006] Based on the aforementioned research, this invention provides an integrated microfluidic chip for multiplex eccDNA detection in lung cancer diagnosis. It is the first to combine microfluidic chip technology with a CRISPR / Cas12a system, aiming to overcome the bottleneck of insufficient sensitivity in single eccDNA detection. By achieving highly sensitive and specific parallel detection of multiplex eccDNA, it provides a reliable technological platform for the clinical translational application of eccDNA.

[0007] The research process of this invention is as follows:

[0008] (1) Sample collection and sequencing: plasma samples were collected from patients with lung adenocarcinoma and healthy controls, and eccDNA sequencing was performed;

[0009] (2) Screening and validation of eccDNA: Based on sequencing data, the NPCC method was used to screen and validate eccDNA markers that exist only in the plasma of patients with lung adenocarcinoma, and to evaluate the diagnostic value of a single molecule.

[0010] (3) Chip construction and detection: Based on the four eccDNA markers obtained by screening, four sets of primers were designed to prepare a microfluidic chip and use it to specifically detect the screened target eccDNA;

[0011] (4) Results analysis and comparison: The detection results were comprehensively analyzed and compared with the previous screening and validation data to confirm the consistency of the method. The results showed that the microfluidic chip detection results and the sequencing results showed good consistency.

[0012] Based on the above research process, the present invention provides the following technical solution:

[0013] In a first aspect, this invention provides an integrated microfluidic chip for multiplex eccDNA detection in lung cancer diagnosis. The chip comprises multiple microfluidic detection units integrated on a substrate, each including a sequentially connected DNA pre-enrichment region, a DNA purification region, and a DNA detection region. The specific implementation is as follows:

[0014] (i) DNA pre-enrichment region

[0015] It consists of three layers of test strips. The first and second layers are both made of glass fiber paper, and the third layer is a nucleic acid enrichment strip. The first and third layers overlap at both ends of the second layer. The three layers of test strips are separated by 3M tape.

[0016] Preferably, the first and second layers of the test strip are both Fusion 5 glass fiber paper with a thickness of 0.37 mm and a width of 0.5 cm; the surface of the second layer of the test strip is spin-coated with a Triton-100 solution mixed with proteinase K, and then vacuum-dried at room temperature for one hour, wherein the final concentration of proteinase K is 0.1 mg / mL; the third layer of the test strip is a Whatman FTA card nucleic acid enrichment disc with a width of 0.5 cm. All three layers of the test strip are batch-cut using a microfluidic cutter.

[0017] (ii) DNA purification region

[0018] The surface is immobilized with exonucleases and RNase A for degrading linear DNA and RNA. The method for immobilizing the exonucleases and RNase A is as follows: First, a 100 nm gold layer is electroplated onto the surface of the region using an ion sputtering apparatus at 10 mA and 600 s. Then, the surface is incubated with 1 mM mercaptoacetic acid at 4 °C for 10–15 hours (preferably 12 hours). Subsequently, ATP-dependent DNase and RNase A are incubated in the region under the action of 200 mM 1-(3-dimethylaminopropyl)-3-ethylcarbazolamide (EDC) and 50 mM N-hydroxysuccinimide (NHS) at 37 °C for 2 hours. Finally, the surface is washed with 0.01 M PBS at pH 7.4.

[0019] Furthermore, the DNA purification area is simultaneously connected to an external micro-circulating peristaltic pump for circulating flow treatment, promoting the reaction.

[0020] (iii) DNA detection area

[0021] The DNA detection region is a sensor array used to detect eccDNA provided upstream; the RPA amplification mixture, CRISPR-Cas12a reaction solution, and universal fluorescent probe are pre-coated in this region using freeze-drying technology.

[0022] The RPA amplification mixture contains RPA primer lyophilized powder, prepared as follows: four sets of forward and reverse primer solutions with a final concentration of 400 nM are transferred into centrifuge tubes, lyophilized in a freeze dryer, and then mixed with the RPA lyophilized powder in the kit.

[0023] Preferably, the sequences of the four primer sets are as follows:

[0024]

[0025] The preparation method of CRISPR-Cas12a lyophilized powder is as follows: 100 nM LbCas12a and 150 nM crRNA are vortexed and mixed evenly, placed at room temperature for 15 minutes, and then 8 μL of 5 μM FQ single-stranded DNA reporter molecule is added. The reaction buffer and ultrapure water are mixed to 30 μL, transferred to 0.5 mL centrifuge tubes, and placed in a freeze dryer for lyophilization.

[0026] There are four crRNAs in total, and their sequences are shown below: EccDNA-1: UAAUUUCUACUAAGUGUAGAUUGGACUUGAUGUCCUCCUAC (SEQ ID NO. 9); EccDNA-2: UAAUUUCUACUAAGUGUAGAUUGGACUUGAUGUCCUCCUAC (SEQ ID NO. 10); EccDNA-3: UAAUUUCUACUAAGUGUAGAUAGACUCUAGGGUUUAUCAUU (SEQ ID NO. 11); EccDNA-4: UAAUUUCUACUAAGUGUAGAUCACUCCAGCCUAUGCUCUGUC (SEQ ID NO. 12).

[0027] Finally, the prepared RPA and CRISPR-Cas12a lyophilized powder were mixed evenly with the probe and then placed into the DNA detection area.

[0028] The microfluidic chip in this invention is ring-shaped with a hollow center, and multiple microfluidic detection units are arranged at intervals on the ring-shaped substrate for simultaneous detection of multiple samples.

[0029] To improve reaction efficiency, each microfluidic detection unit is equipped with a microheater to ensure the reaction proceeds at 37°C. Since the optimal reaction temperature for RPA is 37°C, the microheater is attached to the DNA detection area.

[0030] In a second aspect, the present invention provides a method for multiplex eccDNA detection using the above-described microfluidic chip, comprising the following steps:

[0031] (1) DNA pre-enrichment: Peripheral blood samples are dropped directly onto the inlet and separated through the first layer of test paper in the DNA pre-enrichment area. The size of the pores restricts the movement of blood cells. At the same time, under the action of capillary force, the plasma containing various biochemical substances moves along the paper chip to the second layer. The sample continues to degrade proteins or nucleases under the action of proteinase K coated in the second layer. At the same time, under the action of gravity, it continues to flow to the third layer, which has the function of enriching nucleic acids and adsorbing total DNA.

[0032] (2) DNA purification: The DNA purification area is simultaneously connected to an external micro-circulating peristaltic pump for circulation. By controlling the micro-valve, PBS with a pH of 7.4 and a concentration of 0.01M is introduced into the area under the action of the external circulating peristaltic pump. The DNA pre-enriched sample is extracted and enriched in the area for linear DNA degradation. The degradation reaction is carried out for 30 minutes at room temperature to enrich high-purity ecccDNA.

[0033] (3) DNA detection: A micro heater is attached to the DNA detection area and heated to 37°C. The DNA purification area is enriched with high-purity ecccDNA and reacted. As the reaction proceeds and the product increases, CRISPR-Cas12a continuously recognizes the specific target ecccDNA, triggering its transverse cleavage ability, shearing the fluorescent probe, resulting in enhanced fluorescence. The green fluorescence of multiple channels is directly visualized by irradiation with a 365nm portable ultraviolet flashlight to obtain qualitative detection results and realize the joint detection of ecccDNA.

[0034] The innovative aspects of this invention are as follows:

[0035] 1. For the first time, microfluidic chip technology was combined with the CRISPR / Cas12a system for multiplex eccDNA detection.

[0036] This invention creatively integrates the miniaturization and automation advantages of microfluidic chips with the high specificity and sensitivity advantages of CRISPR / Cas12a systems to construct a novel eccDNA detection platform. This approach is not a simple aggregation of technologies, but rather a specialized and integrated design tailored to the molecular characteristics of eccDNA (circular structure, low abundance, heterogeneity), addressing the core pain points of existing technologies (such as single PCR or single sequencing) in eccDNA detection, including cumbersome procedures, insufficient sensitivity, and limited throughput.

[0037] 2. A multiple parallel detection system was designed to effectively overcome the randomness and heterogeneity of eccDNA.

[0038] Addressing the industry challenge of low sensitivity and high false negative rates when using single eccDNA markers, this invention integrates multiple independent detection units on a microfluidic chip, enabling simultaneous parallel amplification and CRISPR detection of a group (≥4 types) of lung cancer-related eccDNA targets. This "multiplex detection" strategy, through signal complementarity and mutual verification, significantly reduces the risk of false negatives caused by the random occurrence of single eccDNA markers, fundamentally improving the reliability of test results and the robustness of clinical applications.

[0039] 3. Achieved end-to-end integration and automation of the "sample input - result output" process.

[0040] This invention highly integrates traditionally dispersed steps—including nucleic acid extraction, linear DNA removal, multiplex isothermal amplification (such as RPA / RCA), and CRISPR fluorescence detection—onto a single microchip. Through the ingenious design of microchannels and functional chambers, the detection process is fully automated and operates in a "closed-tube" manner. This not only greatly simplifies the operation process and reduces the technical requirements for operators, but also effectively avoids aerosol contamination caused by opening the cap, thereby improving detection sensitivity and specificity while ensuring high repeatability and stability of results.

[0041] Based on the above-mentioned innovations, the beneficial effects of this invention compared to existing technologies are as follows:

[0042] (1) Detection performance is significantly improved

[0043] The microfluidic chip of this invention has a sensitivity at the fM level and can stably detect trace amounts of eccDNA; the false negative rate is significantly reduced, and the accuracy of early lung cancer detection is greatly improved.

[0044] (2) Detection specificity is significantly enhanced

[0045] It employs a dual recognition mechanism to effectively distinguish between circular and linear DNA; the closed-tube detection mode avoids contamination and ensures result specificity.

[0046] (3) Operational efficiency has been significantly optimized.

[0047] It achieves integrated testing from "sample in" to "result out", shortening the testing time and simplifying the operation; at the same time, the consumption of reagents is significantly reduced, giving it a cost advantage.

[0048] (4) Clear prospects for clinical translation

[0049] The test results have good repeatability and high precision, making them suitable for developing standardized reagent kits and facilitating their widespread application. Attached Figure Description

[0050] Figure 1 A schematic diagram of the microfluidic chip of the present invention is shown. Detailed Implementation

[0051] The present invention will now be described in detail with reference to the embodiments and accompanying drawings, but the implementation of the present invention is not limited thereto.

[0052] All reagents and raw materials used in this invention are commercially available or can be prepared according to literature methods. Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions or as recommended by the manufacturer.

[0053] I. Technology Research Process

[0054] 1. Sample collection and sequencing

[0055] Plasma samples were collected from patients pathologically diagnosed with lung adenocarcinoma and healthy individuals from Tongji Hospital, Shanghai, and stored at -80°C. Cell-free DNA was extracted from the plasma using a Serum / Plasma Circulating DNA Kit (TIANGEN, DP339), followed by digestion of linear DNA from 500 ng of total DNA using Plasmid Safe ATP-dependent DNase (Epicenter, E3110K). The eccDNA was amplified by rolling circles using phi29 DNA polymerase and random primers (NEB, E1603S), and finally, 150 bp paired-end high-throughput sequencing was performed using the Illumina NovaSeq sequencing platform. The eccDNA sequencing data were then analyzed.

[0056] 2. eccDNA screening and validation:

[0057] Based on sequencing results, four eccDNAs that are only present in the plasma of lung adenocarcinoma patients were screened. The results are shown in Table 1.

[0058] Table 1. Detection results of eccDNA in plasma samples from cancer patients.

[0059]

[0060] The NPCC method (nested PCR combined with CRISPR / Cas12a) was used for validation. Nested PCR primers and crRNA were designed for the target eccDNA (Table 2). 2 μL of cell-free plasma DNA was used for nested PCR amplification (Sangon Biotech, B532073). Subsequently, the target eccDNA was identified using a CRISPR / Cas12a system (TOLOBIO, 32108) guided by specific crRNA, and the fluorescence signal was finally detected by a quantitative real-time PCR instrument. The NPCC detection results were compared with the sequencing results to screen target eccDNAs for subsequent microfluidic chip construction and detection.

[0061] Table 2. Location of eccDNA and NPC primer and crRNA sequences

[0062]

[0063] 3. Evaluation of the diagnostic efficacy of eccDNA

[0064] To evaluate the diagnostic efficacy of eccDNA, we included plasma samples from 50 suspected cases of lung adenocarcinoma and used the NPCC method to detect the target eccDNA in all samples. The NPCC results were compared blinded with clinicopathological diagnostic results (gold standard) to calculate and analyze the sensitivity and specificity of each target eccDNA and the combined use of multiple eccDNAs in diagnosing lung adenocarcinoma. The results showed that the specificity of individual eccDNA detection was 110% in all 50 samples, while the sensitivity was below 55%, as detailed in Tables 3-6.

[0065] Table 3. Diagnostic sensitivity and specificity of eccDNA-1

[0066]

[0067] Sensitivity (true positive rate) = 9 / (9 + 11) = 45%

[0068] Specificity (true negative rate) = 30 / (0 + 30) = 100%

[0069] Table 4. Diagnostic sensitivity and specificity of eccDNA-2

[0070]

[0071] Sensitivity (true positive rate) = 11 / (9 + 11) = 55%

[0072] Specificity (true negative rate) = 30 / (0 + 30) = 100%

[0073] Table 5. Diagnostic sensitivity and specificity of eccDNA-3

[0074]

[0075] Sensitivity (true positive rate) = 11 / (9 + 11) = 55%

[0076] Specificity (true negative rate) = 30 / (0 + 30) = 100%

[0077] Table 6. Diagnostic sensitivity and specificity of eccDNA-4

[0078]

[0079] Sensitivity (true positive rate) = 3 / (3 + 17) = 15%

[0080] Specificity (true negative rate) = 30 / (0 + 30) = 100%

[0081] 4. Development of the microfluidic chip:

[0082] (1) Template preparation for microfluidic chip: The pattern was designed using AutoCAD software, and a mask was first fabricated. Then, using soft photolithography, a microfluidic template was prepared on a silicon wafer as the substrate through photoresist spin coating, pre-baking, exposure, post-baking, and development steps. Finally, the microfluidic chip was obtained by PDMS molding. The microfluidic chip includes three regions: regions 1 and 2 are the DNA pre-enrichment region and the DNA purification region, respectively, which are responsible for the extraction and enrichment of total DNA samples; region 3 is the DNA detection region, which is responsible for the detection of eccDNA.

[0083] (2) Preparation of the eccDNA sample enrichment and extraction functional area of ​​the microfluidic chip: The first two regions of this microfluidic chip are responsible for sample extraction and enrichment. First is region 1, which contains a three-layer structure: the first layer is Fusion 5 glass fiber paper, used to separate blood cells from peripheral blood samples; the second layer is Fusion 5 glass fiber paper immobilized with proteinase K, used for protein degradation; and the third layer is a Whatman FTA card nucleic acid enrichment disc, used for preliminary pre-enrichment of DNA in the sample. Through the above methods, total DNA is separated from peripheral blood samples and pre-enriched. Next is region 2, which aims to further extract and purify DNA. The surface of this module is immobilized with exonuclease and ribonuclease A (RNase A), which aims to degrade linear DNA and RNA. At the same time, an external micro-circulating peristaltic pump is connected to circulate the flow to improve the efficiency of the enzyme reaction. Through the cyclic degradation of the microfluidic enzyme reactor, highly pure eccDNA (including target and non-target eccDNA) is enriched.

[0084] (3) Fabrication of microfluidic sensors: Region 3 is a sensor array used to detect eccDNA provided upstream. The RPA amplification mixture and CRISPR-Cas12a reaction solution were pre-coated in this region using freeze-drying technology, including a universal fluorescent probe for visual qualitative detection. Using eccDNA as a template, four sets of specific primers were designed for RPA amplification. As the reaction proceeded and the product increased, CRISPR-Cas12a continuously recognized the specific target eccDNA, triggering its lateral cleavage ability, shearing the fluorescent probe, resulting in enhanced fluorescence. Finally, under the illumination of a portable ultraviolet flashlight, the green fluorescence of multiple channels was directly visualized to obtain qualitative detection results, achieving joint detection of eccDNA.

[0085] 5. Result Comparison: Compare the microfluidic detection results with the eccDNA sequencing results to ensure consistency and reliability of the established detection method.

[0086] II. Application Examples

[0087] 1. Sample collection, sequencing, and results analysis

[0088] Seven patients pathologically diagnosed with lung adenocarcinoma and six healthy individuals were selected from Tongji Hospital in Shanghai. Five ml plasma samples were collected from each sample. After extracting cell-free DNA from the plasma, digesting linear DNA, and amplifying eccDNA using phi29 polymerase, 150 bp paired-end high-throughput sequencing was performed using the Illumina NovaSeq sequencing platform. The plasma eccDNA sequencing results were analyzed, and eccDNAs present only in lung adenocarcinoma patients were screened. Finally, the NPCC method was used to verify and identify four eccDNAs found exclusively in the plasma of lung adenocarcinoma patients.

[0089] 2. Microfluidic chip fabrication:

[0090] (1) Substrate preparation: The microfluidic chip specifically used in this invention uses SU-8 2027 as the monomer. In the photolithography room, a mold is prepared by a micro-nano lithography machine through the steps of homogenization, pre-baking, exposure, post-baking, development, and hardening. Then, the mold is made by casting PDMS as the substrate. The precursor and curing agent are mixed evenly at a weight ratio of 10:1. This mixture is poured onto the template and vacuumed for 15 minutes to eliminate air bubbles. It is then cured at 80°C for 4 hours. Then, the cured PDMS is gently peeled off from the template. Holes are manually drilled at the inlet, outlet, valve, and vent holes of the formed structure using a punch and scalpel.

[0091] (2) Functional modules

[0092] This microfluidic chip has three functional modules. The first area is the DNA pre-enrichment area, which uses a three-layer test strip to extract total nucleic acid from peripheral blood samples. The first layer of the test strip consists of 0.37 mm thick Fusion 5 glass fiber paper, which is batch-cut using a microfluidic cutter with a width of 0.5 cm. The second layer also consists of 0.37 mm thick Fusion 5 glass fiber paper, which is batch-cut using a microfluidic cutter with a width of 0.5 cm. Then, 50 μL of Triton-100 solution containing proteinase K is spin-coated onto the surface, with a final proteinase K concentration of 0.1 mg / mL. The strip is then vacuum-dried at room temperature for one hour. The third layer uses Whatman FTA card nucleic acid enrichment paper, which is 0.5 cm wide using a microfluidic cutter. The three layers of the test strip are separated by 3M tape.

[0093] The overall experimental procedure in this area is as follows: When a peripheral blood sample is dripped directly onto the inlet, it is separated through a paper chip in the first layer. Due to the limited pore size, the movement of blood cells is restricted. Simultaneously, under capillary action, the plasma containing various biochemical substances moves along the paper chip to the second layer. Because the second layer is coated with proteinase K, it can continue to degrade proteins or nucleases in the sample. At the same time, under the influence of gravity, the sample continues to flow to the third layer, namely the Whatman FTA card layer. This commercially available paper chip has the function of enriching nucleic acids and can adsorb total DNA. Through the above method, total DNA is separated from the peripheral blood sample and pre-enriched.

[0094] The second region is the DNA purification region, immobilized with exonucleases (e.g., PSD) and RNase A. Specifically: First, a 100 nm gold layer (10 mA, 600 s) was electroplated onto the surface of this region using an ion sputtering apparatus; then, the surface was incubated with 1 mM thioglycolic acid at 4°C for 12 hours; optimized concentrations of PSD and RNase A were then incubated in the second region using 1-(3-dimethylaminopropyl)-3-ethylcarbamate (EDC) and N-hydroxysuccinimide (NHS) (concentration 200 mM:50 mM), respectively, at 37°C for 2 hours. Finally, the surface was washed with 0.01 M PBS (pH 7.4).

[0095] By controlling the microvalve and using an external circulating peristaltic pump, PBS (pH 7.4, 0.01M) was introduced into the second region to linearly degrade the DNA extracted and enriched from the first region. The degradation reaction was carried out for 30 minutes at room temperature.

[0096] The third area is the detection area, and the specific operation is as follows: (i) Preparation of RPA lyophilized powder: Isothermal nucleic acid amplification RPA reaction was performed using the TwistAmp™ basic kit (TwistDx, Cambridge, UK). The RPA reaction in this study was slightly modified from the official RPA manual. RPA primers were designed using Primer Premiere Design 5.0 and Gene Runner software (see Table 7). 10 μL of forward and reverse primers (final concentration 400 nM) were transferred to 0.5 mL centrifuge tubes, placed in a freeze dryer, and used for lyophilized powder experiments, mixing with the RPA lyophilized powder in the kit.

[0097] Table 7 RPA primer sequences for eccDNA

[0098]

[0099] (ii) Preparation of CRISPR-Cas12a lyophilized powder: The total reaction volume was 30 μL, containing 100 nM of LbCas12a complex, 400 nM of FQ reporter molecule (FAM-TTATT-quencher group, manufactured by Sangon Biotech), and double-stranded DNA substrate components. Specifically, LbCas12a (final concentration 100 nM) and crRNA (final concentration 150 nM) were vortexed and mixed thoroughly, and placed at room temperature for 15 minutes. Then, FQ single-stranded DNA reporter molecule (8 μL, stock solution 5 μM) was added, and the reaction buffer and ultrapure water were mixed to a final volume of 30 μL. The mixture was then transferred to a 0.5 mL centrifuge tube and placed in a freeze dryer for lyophilized powder experiments.

[0100] (iii) Mix the RPA and CRISPR-Cas12a lyophilized powder prepared above evenly and place them into the third region of the microfluidic chip.

[0101] (iv) A micro heater (37°C) was attached to the bottom of the third region for heating. Since the optimal temperature for both RPA and CRISPR-Cas12a reactions is 37°C, a one-step reaction can be achieved. The reaction time is 45 minutes. Finally, the third region was irradiated with a portable UV flashlight (365 nm) and the green fluorescence change was directly observed with the naked eye. The qualitative detection results were then read.

[0102] 3. Result Comparison:

[0103] The above four eccDNAs were detected in plasma samples from six patients with lung adenocarcinoma in Part 1 using a microfluidic chip. The results are shown in Table 8 below. The microfluidic chip detection results and sequencing results showed good consistency.

[0104] Table 8 Comparison of microfluidic detection results and eccDNA sequencing results

[0105]

[0106] The undescribed parts of this invention are the same as or implemented using existing technology. The applicant declares that this invention is illustrated through the above embodiments, but the invention is not limited to the above detailed methods, i.e., it does not mean that the invention must rely on the above detailed methods to be implemented. Those skilled in the art should understand that any improvements to this invention, equivalent substitutions of raw materials for the product of this invention, additions of auxiliary components, and selection of specific methods all fall within the protection and disclosure scope of this invention.

Claims

1. An integrated microfluidic chip for multiplex eccDNA detection in lung cancer diagnosis, characterized in that, It is composed of multiple microfluidic detection units integrated on a substrate, each of which includes a sequentially connected DNA pre-enrichment region, a DNA purification region, and a DNA detection region. The DNA pre-enrichment region consists of three overlapping layers of test strips. The first and second layers are made of glass fiber paper, and the third layer is a nucleic acid enrichment strip. The first and third layers overlap the ends of the second layer, respectively. Proteinase K is immobilized on the second layer of test strip. The surface of the DNA purification region is immobilized with exonucleases and ribonuclease A for degrading linear DNA and RNA. The DNA detection region is a sensor array used to detect eccDNA provided upstream; the RPA amplification mixture, CRISPR-Cas12a reaction solution, and universal fluorescent probe are pre-coated in this region using freeze-drying technology.

2. The integrated microfluidic chip for multiplex eccDNA detection in lung cancer diagnosis according to claim 1, characterized in that, The microfluidic chip uses SU-8 2027 as a single unit. In the photolithography room, a mold is prepared by a micro-nano lithography machine through the steps of homogenization, pre-baking, exposure, post-baking, development, and hardening. Then, the mold is made by flipping the mold with PDMS as a substrate and gently peeling the cured PDMS off the template. Holes are manually drilled at the inlet, outlet, valve, and vent of the forming substrate.

3. The integrated microfluidic chip for multiplex eccDNA detection in lung cancer diagnosis according to claim 1, characterized in that, In the DNA pre-enrichment area, both the first and second layers of test paper are Fusion 5 glass fiber paper with a thickness of 0.37 mm and a width of 0.5 cm. The second layer of test paper was spin-coated with a Triton-100 solution containing proteinase K, and then vacuum-dried at room temperature for one hour after spin-coating. The final concentration of proteinase K was 0.1 mg / mL. The third layer of the test strip is a 0.5cm wide Whatman FTA card nucleic acid enrichment strip; The three layers of test strips are separated by 3M tape.

4. The integrated microfluidic chip for multiplex eccDNA detection in lung cancer diagnosis according to claim 3, characterized in that, The method for DNA pre-enrichment using the DNA pre-enrichment region is as follows: Peripheral blood samples are dropped directly onto the injection port and separated through the first layer of test paper. The pore size of the paper restricts the movement of blood cells, while under the action of capillary force, the plasma containing various biochemical substances moves along the paper chip to the second layer. Under the action of proteinase K coated in the second layer, the sample continues to degrade the proteins or nucleases therein. At the same time, under the action of gravity, it continues to flow to the third layer, which has the function of enriching nucleic acids and adsorbing total DNA.

5. The integrated microfluidic chip for multiplex eccDNA detection in lung cancer diagnosis according to claim 1, characterized in that, The method for immobilizing exonuclease and RNase A in the DNA purification region is as follows: First, a 100 nm gold layer is electroplated on the surface of the region using an ion sputtering apparatus; then, the surface is incubated with thioglycolic acid and reacted at 4°C for 10-15 hours; subsequently, ATP-dependent DNase and RNase A are incubated in the region under the action of 1-(3-dimethylaminopropyl)-3-ethylcarbamate (EDC) and N-hydroxysuccinimide (NHS) and reacted at 37°C; finally, the surface is washed with PBS.

6. The integrated microfluidic chip for multiplex eccDNA detection in lung cancer diagnosis according to claim 5, characterized in that, The electroplating conditions for the gold layer were 10 mA for 600 s; the concentration of mercaptoacetic acid was 1 mM; the concentration of EDC was 200 mM; and the concentration of NHS was 50 mM. The concentrations of ATP-dependent DNase and RNase A were 10 U / μL and 10 mg / mL, respectively; the reaction time was 2 hours. The PBS concentration was 0.01 M, pH 7.4; The DNA purification area is simultaneously connected to an external micro-circulating peristaltic pump for circulation. By controlling the micro-valve, PBS with a pH of 7.4 and a concentration of 0.01M is introduced into this area under the action of the external circulating peristaltic pump. The DNA pre-enriched sample is subjected to linear DNA degradation. The degradation reaction is carried out for 30 minutes at room temperature, and high-purity ecccDNA is obtained.

7. The integrated microfluidic chip for multiplex eccDNA detection in lung cancer diagnosis according to claim 1, characterized in that, In the DNA detection area, the lyophilized RPA amplification mixture contains lyophilized RPA primer powder, prepared as follows: four sets of forward and reverse primer solutions with a final concentration of 400 nM are transferred to centrifuge tubes, lyophilized in a freeze dryer, and then mixed with the lyophilized RPA powder from the kit. The sequences of the four primer sets are shown in SEQ ID NO.1~8, respectively.

8. The integrated microfluidic chip for multiplex eccDNA detection in lung cancer diagnosis according to claim 7, characterized in that, The preparation method of CRISPR-Cas12a lyophilized powder is as follows: 100 nM LbCas12a and 150 nM crRNA are vortexed and mixed evenly, placed at room temperature for 15 minutes, and then 8 μL of 5 μM FQ single-stranded DNA reporter molecule is added. The reaction buffer and ultrapure water are mixed to 30 μL, transferred to 0.5 mL centrifuge tubes, and placed in a freeze dryer for lyophilization. There are four crRNAs, and their sequences are shown in SEQ ID NO.9~12 respectively.

9. The integrated microfluidic chip for multiplex eccDNA detection in lung cancer diagnosis according to claim 8, characterized in that, After thoroughly mixing the prepared RPA and CRISPR-Cas12a lyophilized powder with the probe, the mixture was placed into the DNA detection region. During the detection process, a micro heater is attached to the DNA detection area and heated to 37°C. The purified DNA area is enriched with highly pure ecccDNA, which is then reacted. As the reaction proceeds and the product increases, CRISPR-Cas12a continuously recognizes the specific target ecccDNA, triggering its lateral cleavage ability to shear the fluorescent probe, resulting in enhanced fluorescence. The change in green fluorescence can be directly observed with the naked eye, and the qualitative detection results can be read.

10. The integrated microfluidic chip for multiplex eccDNA detection in lung cancer diagnosis according to claim 9, characterized in that, The reaction time was 45 minutes. Finally, a 365 nm portable ultraviolet flashlight was used to irradiate the area, and the green fluorescence of multiple channels was directly visualized to obtain qualitative detection results, thus realizing the joint detection of eccDNA.

Images