Targeted detection probe set, kit and method for related genes of oral maxillofacial tooth / bone-derived lesions

Abstract

The invention discloses a probe group for targeted capture and detection of 65 gene variation related to oral and maxillofacial tooth / bone-derived lesions. The probe group comprises sequences as shown in SED ID No. 1 to SED ID No. 130. The invention also provides a kit containing the probe group, and application of the kit in preparation of products for targeted capture and detection of oral and maxillofacial tooth / bone-derived lesion related genes. The invention also provides a method for constructing an oral maxillofacial tooth / bone-derived lesion related gene detection model by using the probe group, and the method comprises the following steps: preparing a pre-library, preparing a probe hybridization capture library, sequencing, analyzing a sequencing result, and classifying obtained mutation sites to construct the model. According to the obtained sequencing result and model, the oral and maxillofacial tooth / bone-derived lesions which are difficult to distinguish in histomorphology can be accurately classified, accurate pathological diagnosis can be conveniently obtained, and help is provided for subsequent treatment and prognosis evaluation of patients.

Description

Technical Field

[0001] This invention relates to the field of gene detection. More specifically, it relates to a probe set, kit, and method for constructing detection / classification models for gene targeting and detection related to dental / bone lesions of the oral and maxillofacial region. Background Technology

[0002] Oral and maxillofacial dental / bone lesions are diverse and overlap in their histomorphology, making them a challenge for pathological diagnosis.

[0003] With the development of molecular biology and sequencing technologies, an increasing number of dental / bone lesions have been confirmed to have characteristic gene alterations. For example, approximately 90% of ameloblastomas have mutations in genes related to the MAPK signaling pathway, the most common being the BRAFV600E mutation. Meanwhile, adenoid ameloblastomas, which are morphologically very similar to ameloblastomas, have mutations in genes related to the WNT signaling pathway. Other tumors or cysts, such as odontogenic adenoid tumors, odontoblastomas, and odontogenic calcified cysts, also have high-frequency mutations in their characteristic genes. However, currently, there is a lack of a comprehensive and systematic technique for accurately classifying dental / bone lesions that are difficult to distinguish morphologically through gene testing. Summary of the Invention

[0004] This invention provides a gene-targeted detection probe set, kit, and classification model construction method for oral and maxillofacial dental / bone lesions. Based on targeted sequencing technology containing 65 genes, the probe set covers the entire coding regions of these 65 genes. According to the sequencing results, dental / bone lesions that are difficult to distinguish morphologically can be accurately classified, facilitating precise pathological diagnosis and aiding in subsequent treatment and patient prognosis assessment. The 65 genes selected in this invention correspond to different diagnoses of dental / bone lesions, covering a wide range of dental / bone lesion types. Furthermore, these 65 genes encompass the gene mutation sites of commonly seen dental / bone tumors, balancing the cost-effectiveness and sensitivity of the detection. By effectively combining these genes and employing targeted next-generation sequencing, this invention enables precise classification of lesions based on the detection results.

[0005] A first aspect of the present invention provides a probe set for targeting and detecting gene variants related to dental / bone lesions of the oral and maxillofacial region, the probe set comprising sequences shown in SED ID No. 1-SED ID No. 130.

[0006] Preferably, the oral and maxillofacial dental / bone lesion-related genes are the following 65 genes: ACTB gene, ALK gene, APC gene, ARAF gene, ARID1A gene, AXIN1 gene, BRAF gene, CDC73 gene, CDK11B gene, CDK4 gene, CDKN2A gene, CREBBP gene, CTNNB1 gene, CYLD gene, EXT1 gene, EXT2 gene, FGFR1 gene, FGFR2 gene, FGFR3 gene, FGFR4 gene, GDD1 gene, GNAQ gene, GNAS gene, GRM1 gene, H3F3A gene, H3F3B gene, HRAS gene, IDH1 gene, IDH2 gene, JAK1 gene, JAK2 gene, and JAK3 gene. The probe set covers the exon regions of the following 65 genes: KDR, KIT, KRAS, KRT13, MDM2, MED12, MEN1, MET, MLL2, MYOD1, NEDD4L, NF1, NF2, NRAS, PIK3CA, PRKAR1A, PTCH1, PTEN, RASAL1, RB1, SDHA, SDHB, SDHC, SDHD, SH3BP2, SMARCA4, SMARCB1, SMO, SMURF1, TP53, TRPV4, TWIST1, and UBR5.

[0007] A second aspect of the present invention provides a kit comprising any of the probe sets described above.

[0008] A third aspect of the present invention provides the use of the aforementioned kit in the preparation of products that target and capture genes related to dental / bone lesions of the oral and maxillofacial region.

[0009] A fourth aspect of the present invention provides a method for constructing a gene detection model related to dental / bone lesions of the oral and maxillofacial region using the aforementioned probe set or kit, comprising: (1) DNA extraction from the sample to be tested; (2) Pre-library preparation, probe hybridization capture library preparation, sequencing, and sequencing result analysis; The probe set from the aforementioned kit is used in the probe hybridization capture library preparation step.

[0010] Preferably, the sequencing includes: sending the hybridization capture library to a sequencing company, performing paired-end sequencing reaction using NovaS4, and requiring a data volume greater than 2G and a data format of fastq; The sequencing results analysis includes: First, the returned data was quality controlled using FastQC software. Skwer was used to remove adapters and related low-quality fragments to reduce their impact on subsequent data analysis. After the connectors were repaired, FastQC was used again for quality control to analyze the data quality in order to improve the relevant experimental procedures. The BWA MEM algorithm was used to align the adapter-trimmed sequences with the HG38 standard human genome data, and samtools was used to convert the resulting .sam files into binary .bam files. Use samtools sort to sort the bam files, then use gatk mark duplication to mark duplicate sequences, and picard to remove duplicate sequences; gatkBaseRecalibrator performs base correction; gatk applies BQSR to correct the re-alignment region; Then, the variant calling step was performed using gatk mutect2, lofreq, and freebayes software, combined with 65 panel gene probe sequence files, to obtain .vcf format files. Finally, the mutation sites were filtered using relevant filtering commands to generate filtered .vcf files. Use Annovar to convert the .vcf file to .avinput format, and then use Annovar to annotate each mutation site.

[0011] Preferably, the method for constructing a gene detection model related to dental / bone lesions of the oral and maxillofacial region further includes: classifying the obtained mutation sites into four categories using the following mutation site screening criteria: (1) Sequencing depth: greater than 100X; (2) Remove mutations located at non-exon sites, synonymous mutations; (3) Rating the remaining mutation sites: 1) Type 1 mutation: The mutation site has been reported in the literature, and the reported cases have the same site and histological type; there is an FDA-approved targeted drug for the mutation site; 2) Type 2 mutations: The mutation site has been reported in the literature, but the reported cases are in different locations / histological types or have appeared in the cosmic database; 3) Type 3 mutations: No relevant literature has been reported on this mutation site, and it does not appear in the cosmic database. However, based on the database and functional prediction tool results, it is further divided into the following subcategories: 3A: Pathogenic or Likely Pathogenic; 3B: Uncertain_significance or Conflicting_classifications_of_pathogenicity; 3C: Benign, Likely benign; 4) Category 4 mutations: No relevant literature reports or database reports are available for this mutation site; among the nine protein function prediction tools (SIFT, Polyphen-2, LRT, Mutation Taster, Mutation Assessor, FATHMM, RadialSVM, LRscore, and VEST3), if four or more tools predict that the mutation site may be pathogenic, it is classified as 4A; if fewer than four tools predict that the mutation site is benign, it is classified as 4B.

[0012] Preferably, in the method for constructing a gene detection model related to dental / bone lesions of the oral and maxillofacial region, the working concentration of the probe group is 50-150 ng / ul.

[0013] Preferably, the adapter is a short Y-type adapter with the following base sequences: 5'AATGATACGGCGACCACCGAGATCTACAC-XXXXXXXX-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3' and 3'-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-XXXXXXXX-ATCTCGTATGCCGTCTTCTGCTTG-5', where XXXXXXXX is an 8-base sequence index (Dynegene). Attached Figure Description

[0014] Figure 1 This is a flowchart of mutation data analysis according to a specific embodiment of the present invention; Figure 2 This is a screening criterion for mutation sites according to a specific embodiment of the present invention. Detailed Implementation

[0015] This invention is based on targeted next-generation sequencing technology containing 65 screened genes. It can accurately classify dental / bone lesions that are difficult to distinguish morphologically based on sequencing results, which facilitates accurate pathological diagnosis and helps with subsequent treatment and patient prognosis assessment.

[0016] Currently, besides targeted next-generation sequencing (NGS), first-generation sequencing (1GS) can also be used to detect gene alterations in lesions. 1GS, also known as Sanger sequencing, works by incorporating ddNTPs during DNA replication, which generates a series of terminal DNA strands. These strands are then separated by high-resolution denaturing gel electrophoresis to obtain the final DNA sequence of the sample. The reagents required for 1GS include primers targeting specific gene sequences, DNA polymerase, and fluorescently labeled deoxyribonucleotide triphosphates (DRPs). Therefore, the main drawback of 1GS is its low throughput. Sequencing can only be completed by designing targeted primers for a specific segment of a gene. For genes with a large number of base sequences, it may be necessary to design dozens of primer pairs to cover the entire gene sequence. For this reason, 1GS is mainly used to detect single-site mutations in known genes in diagnosed diseases. For samples requiring detection of multiple genes for definitive diagnosis, 1GS is time-consuming and costly, making it unsuitable for screening potential gene mutations.

[0017] In view of the above-mentioned shortcomings of first-generation sequencing, this invention provides a probe set for targeted capture and detection of gene variants related to dental / bone lesions of the oral and maxillofacial region, and a kit containing the probe set. The probes in the probe set cover the exon regions of the following 65 genes: ACTB gene, ALK gene, APC gene, ARAF gene, ARID1A gene, AXIN1 gene, BRAF gene, CDC73 gene, CDK11B gene, CDK4 gene, CDKN2A gene, CREBBP gene, CTNNB1 gene, CYLD gene, EXT1 gene, EXT2 gene, FGFR1 gene, FGFR2 gene, FGFR3 gene, FGFR4 gene, GDD1 gene, GNAQ gene, GNAS gene, GRM1 gene, H3F3A gene, H3F3B gene, and HRAS gene. The probe set includes the following genes: IDH1, IDH2, JAK1, JAK2, JAK3, KDR, KIT, KRAS, KRT13, MDM2, MED12, MEN1, MET, MLL2, MYOD1, NEDD4L, NF1, NF2, NRAS, PIK3CA, PRKAR1A, PTCH1, PTEN, RASAL1, RB1, SDHA, SDHB, SDHC, SDHD, SH3BP2, SMARCA4, SMARCB1, SMO, SMURF1, TP53, TRPV4, TWIST1, and UBR5. Specifically, the probe set contains the sequences SED IDNo. ​​1-SED ID No. 130 as shown in Table 1 below. In addition, other probes covering the exon regions of the above 65 genes can be obtained by consulting gene databases for the exon regions of each gene and designing them using conventional probe design methods.

[0018] Table 1

[0019]

[0020]

[0021]

[0022]

[0023]

[0024] In one specific embodiment, the kit containing the above-described probe set includes: ① DNA extraction kit: QIAamp DNA FFPE Advanced UNG Kit (56704, QIAGEN); ② Quality control kit: Qubit 1X dsDNA HS Assay Kit, 500 assays (Q33231, Thermo Scientific); D1000 Ladder(5067-5586, Agilent Technologies); D1000 ScreenTape Analysis (5067-5582, Agilent Technologies); D1000 Sample Buffer (5067-5602, Agilent Technologies); ③Library construction kit: QuarPrep EZ DNA Library Kit 1.0 (NL1002, Dynegene); Y Truncated Adapter with pre index primer dual Set A(NA2002,Dynegene); QuarAcces Hyper Pure beads (ND3001A, Dynegene); ④ Hybrid capture kit: QuarHyb One Reagent Kit Box1 of 2(NC1003,Dynegene); QuarHyb One Reagent Kit Box2 of 2(NC1003,Dynegene); QuarAcces Universal Blocker with cot-1 2.0(NF2006,Dynegene); QuarAcces Human cot-1 DNA (NF4001, Dynegene); 65 gene probe sets (concentration 50-150 ng / ul), which is the probe set mentioned above; QuarAcces Hyper Enrichment Beads(ND3008C,Dynegene); QuarAcces Hyper Pure beads (ND3001A, Dynegene).

[0025] The following is an example of using the above kit for gene detection and classification model construction: (1) DNA extraction from the sample to be tested DNA extraction from the sample to be tested includes cutting paraffin-embedded tissue rolls, followed by dewaxing, enzymatic digestion, phenol extraction, precipitation, drying, and dissolution to extract DNA. An exemplary procedure is as follows: (a) Selection of DNA samples: Formalin-fixed paraffin-embedded samples (i.e., FFPE samples) diagnosed as odontogenic tumors were selected from the sample library. Each sample was reviewed by a pathologist. The FFPE samples selected for next-generation sequencing contained more than 80% tumor components.

[0026] (b) DNA Extraction and Quality Inspection: DNA was extracted and quality inspected for each FFPE sample. The specific procedures are as follows: ① DNA extraction: For each sample with a tumor component greater than 80% after screening, use a microtome to cut 5-6 4μm wax rolls into a labeled 1.5ml EP tube. Using the QIAamp DNA FFPE Advanced UNG Kit (56704, QIAGEN), a total volume of 30 μL of DNA with a total concentration of 200-1000 ng was extracted from FFPE samples. The specific procedures included: adding 300 μL of Deparaffinization Solution to a pre-labeled EP tube containing a waxed roll, vortexing for 10 seconds, and centrifuging briefly; then placing the EP tube in a 56°C water bath for 3 minutes; subsequently, adding 25 μL of Buffer FTB, 55 μL of RNase-free Water, and 20 μL of Proteinase K to each sample mixture, vortexing, centrifuging briefly, and placing in a 56°C water bath for 1 hour; then placing in a 90°C water bath for 1 hour; after incubation, discarding the supernatant blue liquid, adding 115 μL of RNase-free Water and 35 μL of UNG to the remaining reaction mixture, and incubating at 50°C for 5 minutes; finally, adding 2 μL of RNase K to the reaction mixture. A. After vortexing and simple centrifugation, incubate at room temperature for 2 min. Then, add 20 μL of Proteinase K to the reaction system, vortex and simple centrifuge, and then place in a 65°C metal water bath for 15 min. After incubation, add 250 μL of Buffer AL and 250 μL of anhydrous ethanol to each sample, vortex and simple centrifuge. Then, transfer 450 μL of the reaction solution to a QIAamp UCP MinElute column (in a 2 ml collection tube) and centrifuge at 15000 g for 30 s. After centrifugation, add the remaining reaction solution to the QIAamp UCP MinElute column and centrifuge at 15000 g for 1 min, discarding the filtrate. Then, add 500 μL of Buffer AW1 to the centrifuge column and centrifuge at 15000 g for 30 s, discarding the filtrate. Then, add 500 μL of Buffer AW1. Centrifuge AW2 in a centrifuge column at 15000g for 30s and discard the filtrate. Then add 250ul of anhydrous ethanol to the centrifuge column and centrifuge at 15000g for 30s, discarding the filtrate. Place the centrifuge column in a new collection tube and centrifuge at full speed for 3min to remove liquid from the column membrane. Then place the centrifuge column in a new 1.5ml centrifuge tube, add 30ul of Buffer ATE to the center of the column membrane, and centrifuge at full speed for 1min to dissolve the DNA. After centrifugation, transfer the DNA sample to a labeled 1.5ml EP tube.

[0027] ② DNA sample quality control: The extracted DNA was quality controlled using a micro spectrophotometer (Nano300, RJ-Y204) and an Invitrogen™ Qubit™ 4 fluorometer (Thermo Scientific). 1.5 μL of TE was used for blank calibration. After successful calibration, 1.5 μL of DNA sample was pipetted into the test well for testing. The concentration and purity of the extracted DNA for each sample were recorded. After each sample was tested, the residual liquid on the test well was wiped off with a clean paper towel. The DNA concentration was greater than 20 ng / µl and the DNA purity (A260 / A280 value) was greater than 1.7, as measured by a micro-spectrophotometer, meeting the requirements for pre-library construction. Simultaneously, the DNA concentration was further precisely measured using the Qubit 1X dsDNA HS Assay Kit, 500 assays (Q33231, Thermo Scientific) reagents and an Invitrogen™ Qubit™ 4 fluorometer (Thermo Scientific). A sample DNA concentration greater than 20 ng / µl met the requirements for library construction, allowing for further experiments. During pre-library construction, the DNA concentration detected by the Qubit™ 4 fluorometer was used as the standard for DNA feeding; if the DNA concentration or purity did not meet these conditions, subsequent experiments were not performed.

[0028] (2) Pre-library preparation, including DNA sample PCR amplification and library construction, quality control, among which, For the extracted sample DNA, fragmentation, end-filling with A, and Y-adaptor ligation were performed, followed by amplification and purification. The amplified and purified DNA was used as the pre-library for capture. For library construction, 200 ng of DNA with a purity greater than 1.7 was used. Using a library construction kit, sample DNA was fragmented to approximately 300 bp. Y-adaptor sequences were then added to both ends of the fragments for PCR. After adapter ligation, an index sequence was added to each sample, and the results were recorded. The Y-adaptor was a 5 μL short Y-adaptor with the following base sequence: AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC*T-insert-GATCGGAAGAGCACACGTCTGAACTCCAGTCACXXXXXXXXATCTCGTATGCCGTCTTCTGCTTG, where XXXXXXXX is an 8-base sequence index (Dynegene), insert is the fragmented genomic DNA from the previous step, and the remainder is the adapter sequence. See Table 2 below for detailed index sequences. Table 2 shows the index primer sequences used for paired-end sequencing. I5 is the forward sequencing primer sequence, and I7 is the reverse sequencing primer sequence. A total of 96 primers correspond to the 96-well plates used for sequencing. Each well contains index sequences 1-96, which are used as tags to identify the sample from which data was obtained during subsequent analysis. Table 2

[0029]

[0030]

[0031] After library construction, use qubit4.0 to check the library quality. The library concentration must be greater than 25 ng / ul before proceeding to the next hybridization capture step.

[0032] An exemplary detailed operation of this step (2) is as follows: (A) Enzyme digestion method to break down the genome: Using the enzyme digestion method of the QuarPrep EZ DNA Library Kit 1.0 (NL1002, Dynegene), 9 μL of Frag Buffer and 10 μL of Frag Enzyme Mix were added to the extracted sample DNA. After mixing by pipetting, the genome was fragmented using the set PCR program: 4℃, 1 min; 32℃, 15 min; 65℃, 30 min; 4℃, Hold; until the sample was fragmented to approximately 300 bp.

[0033] (B) Connector connection: The fragmented sample was ligated with adapters by adding 5 μL of short Y-type adapters (base sequences: 5'AATGATACGGCGACCACCGAGATCTACAC-XXXXXXXX-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3' and 3'-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-XXXXXXXX-ATCTCGTATGCCGTCTTCTGCTTG-5', where XXXXXXXX is an 8-base sequence index (Dynegene)), as shown in Table 2 above, 20 μL of ligation buffer, 10 μL of ligase, and 5 μL of ultrapure water (without DNase or RNase, the same below), and mixing thoroughly by pipetting. Adapter ligation was performed using the set PCR program: 25℃, 15 mins; 4℃, Hold. After the PCR program is completed, add 80 μL (0.8×) QuarAcces Hyper Pure beads that have been incubated at room temperature for 30 min to the sample, mix well by pipetting, let stand at room temperature for 5 min, then adsorb on a magnetic rack, discard the supernatant, wash twice with 200 μL 80% alcohol, discard the liquid, dry the magnetic beads, add 18 μL of ultrapure water and mix well, incubate at room temperature for 2 min, adsorb on a magnetic rack, and take 17 μL of supernatant into a new tube; (C) Pre-PCR reaction: Add 25 μL of PCR Mix and 5 μL of a unique UDI Pre-Primer (index sequence) to a new tube containing 17 μL of sample. Label each sample with UDI-PrePCR-P5 / P7. The UDI-PrePCR-P5 / P7 index sequence is an 8-base sequence from Dynegene, used to distinguish sequencing data from different samples. Then, perform the following PCR program: 98℃, 45 s; 98℃, 15 s; 60℃, 30 s; 72℃, 30 s; repeat steps 2-4 for 17 cycles; 72℃, 5 mins; 4℃, Hold. After the PCR program is complete, add 50 μL (1.0×) of QuarAcces Hyper Pure beads that have been incubated at room temperature for 30 min to the reaction mixture. Mix well by pipetting, incubate at room temperature for 5 min, then adsorb onto a magnetic rack. Discard the supernatant and wash twice with 200 μL of 80% ethanol, discarding the liquid. After drying the magnetic beads, add 9 μL of ultrapure water and mix well. Incubate at room temperature for 2 min, then adsorb onto a magnetic rack. Take 8 μL of the supernatant into a new tube and label it. The pre-library is now constructed.

[0034] (D) Pretext library quality control: Using the Qubit 1X dsDNA HS Assay Kit, 500 assays (Q33231, Thermo Scientific), the concentration of the pre-library was determined to be greater than 20 ng / µl using an Invitrogen™ Qubit™ 4 fluorometer (Thermo Scientific). If this concentration was found to meet the requirements for probe hybridization capture, the next step of the experiment could proceed. If the pre-library concentration did not meet this requirement, subsequent experiments were not performed.

[0035] (3) Preparation and sequencing of probe hybridization capture library Probe hybridization capture library preparation includes probe hybridization capture and library quality control, specifically including DNA sample PCR amplification, library construction, quality control, and sequencing. The pre-library is used to target and capture the exon regions of 65 selected genes using a probe set. The captured DNA is then subjected to PCR amplification and magnetic bead purification; the resulting product is the prepared DNA library. Hybridization capture and quality control mainly include: Add a DNA pre-library library of more than 100 ng as required, and perform a targeted capture overnight amplification step using a designed 65-gene panel probe set. The amplification step uses a ThermoVeritiPro™ Thermal Cycler, 96-well PCR program: 95℃, 30s; 65℃, hold; hybridization 16-20 hours. After washing with streptavidin beads, perform a post-PCR program using a ThermoVeritiPro™ Thermal Cycler: 98℃, 45s; 98℃, 15s; 60℃, 30s; 72℃, 30s; repeat steps 2 to 4 10-14 times; 72℃, 5mins; 4℃, hold. Detect the quality of the hybridization-captured library using qubit and Agilent 4200 / 2100, respectively. A qubit concentration greater than 1 ng / µl and an Agilent 4200 / 2100 concentration greater than 1 ng / µl, along with a fragment length greater than 140 bp, are considered acceptable and ready for sequencing.

[0036] An exemplary detailed operation of this step (3) is as follows: (i) Probe hybridization Using the hybridization capture kits QuarHyb One Reagent Kit Box 1 of 2 (NC1003, Dynegene); QuarHyb One Reagent Kit Box 2 of 2 (NC1003, Dynegene); QuarAcces Universal Blocker with cot-1 2.0 (NF2006, Dynegene); and QuarAcces Human cot-1 DNA (NF4001, Dynegene), mix the pre-librium library (total volume not exceeding 8 μL and total content greater than 200 ng) with the following prepared hybridization mixture: 5 μL Universal Blocker with cot-1 2.0; 18 μL 2X Hyb Buffer; 0.5 μL RNase Inhibitor; and 2 μL 65 genomic probes (50-150 ng / μL). After rapid centrifugation, place the reaction mixture on a PCR instrument and complete the following program: 95°C, 30 s; 65°C, Hold; and hybridize at 65°C for 15-20 hours according to the above program.

[0037] (ii) Preparation of streptavidin magnetic beads Add 170 μL of Wash Buffer 3 to each PCR tube. Prepare three tubes for each reaction and place them on a PCR instrument at 65°C for subsequent use. After equilibrating the QuarAcces Hyper Enrichment beads at room temperature for more than 30 min, vortex and mix for 30 s to fully reset the magnetic beads. Then, add 50 μL of QuarAcces Hyper Enrichment beads to each labeled EP tube, followed by 150 μL of Wash Buffer 1 (the reagent prepared in the QuarHyb OneReagent Kit Box 1 of 2 (NC1003, Dynegene)). Mix by pipetting and place on a magnetic rack. After clarification, discard the supernatant. Repeat the Wash Buffer 1 washing operation three times. After washing, add 150 μL of Wash Buffer 1 to each tube.

[0038] (iii) Capture and enrich the magnetic bead library and clean it After incubating the hybridization mixture at 65°C, add at least 20 μL of the hybridization mixture to 150 μL of the labeled Wash Buffer 1 magnetic bead resuspension. Mix thoroughly by pipetting, then place the magnetic hybridization mixture on a vertical spinneret and fix it in place. Incubate at room temperature at 1500 rpm for 30 min. After 30 min, remove the EP tube from the spinneret, centrifuge rapidly for 5 s, and place it on a magnetic rack for 2-5 min. Ensure the liquid is clear, then discard the supernatant. Next, remove the EP tube and add 150 μL of Wash Buffer 2 (the reagent prepared in the QuarHyb One Reagent Kit Box 1 of 2 (NC1003, Dynegene) to each well to resuspend the magnetic beads. Mix thoroughly by pipetting and incubate at room temperature for 15 min, inverting the tube rapidly 15 times every 5 min during incubation. After incubation at room temperature, centrifuge quickly for 5 seconds and place on a magnetic rack. Once the liquid is clear, discard the supernatant and place on a PCR instrument at 65°C. Add 150 μL of preheated Wash Buffer 3 (the reagent prepared in the QuarHyb OneReagent Kit Box 1 of 2 (NC1003, Dynegene)) to each tube, mix by pipetting on the PCR instrument, cap the tubes, and incubate at 65°C for 10 min. After incubation at 65℃, place the container on a magnetic rack until the liquid is clear, then discard the supernatant. Repeat the WashBuffer 3 washing process three times. After three washings, place the container on a magnetic rack to dry the magnetic beads. Finally, add 20 μL of ultrapure water to resuspend the magnetic beads, mix well by pipetting, and then add the following prepared PCR reaction mixture: 25 μL of PCR Mix; 5 μL of Post-primer Mix. Mix well by pipetting and then run the pre-set Post-PCR reaction program: 98℃, 45 s; 98℃, 15 s; 60℃, 30 s; 72℃, 30 s; repeat steps 2-4 14 times; 72℃, 5 mins; 4℃, Hold.

[0039] After the PCR reaction, centrifuge quickly for 5 seconds, place on a magnetic rack, let stand for 1 minute, then aspirate all the supernatant and transfer to a new PCR tube. Add 90 μL (1.8×) of QuarAcces Hyper Purebeads that have been equilibrated at room temperature for at least 30 minutes, mix by pipetting, let stand at room temperature for 5 minutes, then place on a magnetic rack for 5 minutes. Once the liquid is clear, discard the supernatant, then wash twice with 200 μL of 80% ethanol. After washing, remove residual ethanol with a 10 μL pipette, let stand at room temperature for 3 minutes, and once there is no obvious liquid residue on the surface of the magnetic beads, add 30 μL of ultrapure water, mix by pipetting, and let stand at room temperature for 2 minutes. Then place on a magnetic rack and aspirate the supernatant into a new labeled EP tube. At this point, the DNA library captured by probe hybridization is complete.

[0040] (iv) Document Quality Inspection Using the Qubit 1X dsDNA HS Assay Kit, 500 assays (Q33231, Thermo Scientific), the pre-library concentration was determined to be greater than 1 ng / µl using an Invitrogen™ Qubit™ 4 fluorometer (Thermo Scientific). If the pre-library concentration was greater than this, the sequencing requirements were met, and the next step of the experiment could proceed. If the library concentration did not meet this requirement, subsequent experiments were not performed. Subsequently, the fragment length range of the samples was determined using an Agilent Bioanalyzer 4200 instrument. Specifically, 3 µl of D1000 Sample Buffer was added to an eight-tube strip, 1 µl of D1000 Ladder was added to a labeled well, and then 1 µl of the corresponding sample was added to each well. After vortexing and centrifugation at 2000 rpm for 1 min, the samples were equilibrated at room temperature for 30 min using a D1000 ScreenTape analyzer on an Agilent Bioanalyzer 4200 for quality control. The required fragment length range was between 200-400 bp. (v) Sequencing: After quality control, the hybridization capture library was sent to the sequencing company for paired-end sequencing using NovaS4. The sequencing read length was 150 bp, and the sequencing mode was paired-end sequencing. Sequencing primers (Illumina P5 Sequence: 5'-AATGATACGGCGACCACCGAGATCTACAC-3'; Illumina P7 Sequence: 5'-CAAGCAGAAGACGGCATACGAGAT-3') and corresponding index primers (the index primers are complementary to the index sequences added during library construction, and correspond one-to-one) were added, and the data was obtained. The required data volume was greater than 2 GB, and the data format was FastQ.

[0041] (4) Sequencing results analysis After receiving the FastQ format paired-end sequencing files from the sequencing company, I used a Linux server to perform related data analysis.

[0042] First, FastQC software was used to perform quality control on the returned data. Skwer was used to remove adapters and related low-quality fragments to reduce their impact on subsequent data analysis. After trimming the adapters (the adapter sequences from the previous ligation process; trimming adapters is a routine step in data processing, and the resulting sequence is fragmented genomic DNA), FastQC was used again to analyze the data quality in order to improve related experimental procedures.

[0043] The BWA MEM algorithm was used to align the adapter-trimmed sequences with the HG38 standard human genome data. SAM tools were then used to convert the resulting .sam files into binary .bam files.

[0044] The BAM file was sorted using samtools sort, then gatk mark duplication was used to mark repetitive sequences, and picard was used to remove repetitive sequences. gatkBaseRecalibrator was used for base correction, and gatk apply BQSR was used to correct realigned regions. Then, variant calling was performed using gatk mutect2, lofreq, and freebayes software, combined with the designed 65-panel gene probe sequence file, to obtain a .vcf file. Finally, relevant filtering commands were used to filter and obtain mutation sites, generating a filtered .vcf file.

[0045] Use Annovar to convert the .vcf file to .avinput format, and then use Annovar to annotate each mutation site.

[0046] Please refer to the flowchart for mutation data analysis. Figure 1 .

[0047] An example data analysis process is as follows: Sequencing results analysis FastQC is used to assess the quality of raw sequencing data, checking indicators such as the quality distribution, GC content, adapter contamination, and repetitive sequences to ensure that the data quality meets the requirements for subsequent analysis. The raw data was then preprocessed using Skewer, with default parameters used to remove low-quality sequences (such as bases with a quality value below Q20) and sequencing adapter sequences, while retaining high-quality, valid data. The preprocessed data was then subjected to another quality assessment using FastQC to ensure that the data quality met the standards and provided reliable input for subsequent analysis.

[0048] The preprocessed sequencing data was aligned to the human reference genome (hg38) using BWA (default parameters) to obtain the location information of each read on the reference genome, generating a .sam file. Samtools was used to convert the .sam file to a binary .bam file to improve data processing efficiency. The .bam file was then sorted using samtools sort for easier subsequent analysis. Based on the sequence alignment position, PCR repetitive sequences were removed from the results. GATKmark duplication was used to mark repetitive sequences (repetitive reads introduced by PCR amplification), and Picard was used to remove repetitive sequences. To reduce the interference of duplicate reads on variant detection and improve its accuracy, GATKBaseRecalibrator was then used in conjunction with multiple high-quality databases, including 1000G Omni, 1000G Phase 1 SNPs, Mills Indels, 1000G Gold Standard Indels, HapMap, WGS Calling Regions, Known Indels, VariantEval Gold Standard, and NIST Calls, to correct the base quality of the sequencing data, thereby reducing systematic errors and improving variant detection accuracy. Subsequently, different software programs with varying parameter settings were used for the Variants Calling step: GATK mutect2 (max-mnp-distance 2, --min-base-quality-score 20, --max-reads-per-alignment-start 60), GATKHaplotypeCaller (default parameters), Lofreq (--min-normal-alt-freq 0.01, --min-tumor-alt-freq 0.005), and Freebayes (--min-base-quality 20, --min-mapping-quality 20, --min-coverage 5, --min-alternate-fraction 0.05). This specifically combined the 65 gene probe sequences designed for this kit to generate .vcf format files. The combination of multiple tools improved the comprehensiveness and accuracy of the detection. Finally, filtering commands were used to filter out mutation sites, generating filtered .vcf files.The .vcf file was converted to .avinput format using Annovarconvert2annovar.pl for subsequent annotation; then, Annovartable_annovar.pl was used in conjunction with various software recommendation databases (knownGene, ensGene, ljb26_all, dbnsfp47a_interpro, AFR.sites.2015_08, ALL.sites.2015_08, AMR.sites.2015_08, intervar_20180118, cosmic70, esp6500siv2_all, exac03, exac03no) The gene denovo201907, gnomad41_exome, gnomad41_genome, kaviar_20150923, hrcr1, abraom, gme, mcap, revel, avsnp151, nci60, icgc28, clinvar_20240611, regsnpintron) performs functional annotation on each mutation site, including gene function, conservation score, database frequency (e.g., gnomAD), pathogenicity prediction (e.g., SIFT, PolyPhen-2), etc., to understand the functional impact and potential pathogenicity of the mutation site.

[0049] The screening and classification of mutation sites are as follows: Please refer to the mutation site screening criteria. Figure 2 .

[0050] Based on the ACMG (American College of Medical Genetics and Genomics) guidelines and related literature, and considering sequencing depth, the functional impact of mutation sites, and clinical significance, mutation sites are classified into the following four categories: Prerequisites: 1. Sequencing depth: The sequencing depth of the mutation site needs to be greater than 100× to ensure the reliability of the detection results; 2. Mutation type screening: Remove mutations in non-exon regions (such as introns and UTR regions); remove synonymous mutations (i.e., mutations that do not change the amino acid sequence). Mutation site classification: For mutation sites that meet the above prerequisites, they are further classified into the following four categories based on their literature support, database records, functional prediction, and clinical significance: Type 1 mutations (clinically significant and directly applicable to guide treatment or diagnosis): The mutation site has been reported in the literature, and the location / histological type of the reported cases is consistent with the current sample; the mutation site has an FDA-approved targeted drug (combined with OncoKB (MSK's Precision Oncology Knowledge Base, An FDA-Recognized Human Genrtic Variant Database) and the Clinical Interpretation of variants in cancer database); Type 2 mutations (potentially clinically significant, but their functional impact in different tissue types needs further validation): This mutation site has been reported in the literature, but the location / histological type of the reported cases is inconsistent with the current sample; This mutation site is recorded in the COSMIC database; Type 3 mutations (unknown clinical significance, requiring experimental verification and further research): No relevant literature reports exist for these mutation sites, but based on database and functional prediction tool results, they are further divided into the following subcategories: 3A: InterVar or CLNSIG predicts Pathogenic or Likely Pathogenic; 3B: InterVar or CLNSIG predicts Uncertain Significance or Conflicting Classifications of Pathogenicity; 3C: InterVar or CLNSIG predicts Uncertain Significance or Conflicting Classifications of Pathogenicity. Four types of mutations (no literature or database support, unknown clinical significance, and their potential impact needs to be verified through functional experiments or further research): Based on the results of protein function prediction tools (SIFT, Polyphen-2, LRT, MutationTaster, MutationAssessor, FATHMM, RadialSVM, LR score, VEST3, a total of nine), they are further divided into the following subcategories: 4A: The number of predicted harmful software is ≥ 4; 4B: The number of predicted harmful software is < 4.

[0051] Example Sixty-five FFPE samples with a clear diagnosis of odontogenic tumors were collected from the sample bank of the inventor's hospital between 2011 and 2023. Each sample was clearly diagnosed as an odontogenic tumor by a pathologist, and FFPE samples with a tumor component of more than 80% were selected. Among them, there were 16 samples diagnosed as odontogenic shadow cell tumors, 8 samples diagnosed as odontogenic calcified cysts, 16 samples diagnosed as adenoid ameloblastomas, 10 cases diagnosed as ameloblastomas, 9 cases diagnosed as odontogenic adenoid tumors, and 8 cases diagnosed as odontogenic tumors but with unclear specific classifications.

[0052] For each sample, the same steps described above were performed to extract DNA, break and fill fragments with A, ligate Y-adapters, and amplify, purify, and quantify the DNA prescript library, which was then used as the sample to be captured. Then, the target genes of the sample to be captured were captured. The target genes were the 65 target genes obtained above. The same steps as above were taken for target gene capture and sequencing.

[0053] For the sequencing data, the same data analysis process as above was used for test data quality control and variant detection tools for SNV and InDel analysis. Among them, the sequencing data quality control analysis showed that the Q30 of the sequencing data of 65 samples was greater than 80%, the comparable sequences exceeded 95%, the average coverage of the targeted capture region reached more than 600×, and the data quality was qualified.

[0054] Subsequently, mutation sites obtained from data analysis of each sample were screened and classified, and a model was constructed to compare the sequencing results of different types of odontogenic tumors. Combined with relevant literature on odontogenic tumors, the diagnosis of odontogenic tumors that are difficult to diagnose was assisted to achieve the goal of making a definitive diagnosis. At the same time, relevant databases (such as OncoKB (MSK's Precision Oncology Knowledge Base, An FDA-Recognized Human Genrtic Variant Database) and Clinical Interpretation of variants in cancer database) were used to explore whether each sample has mutation sites that can be targeted for treatment, in order to assist in precision treatment.

[0055] Experimental verification Example 1 This embodiment provides an RNA probe set containing 65 gene exon regions for the diagnosis of odontogenic / bone-derived tumors, the nucleotide sequences of which are shown in Table 1 as SED ID No.1-SED ID No.3500.

[0056] Its preparation method includes the following steps: (1) Selected 65 gene CDS regions, using the hg38 human genome database data as reference sequences; (2) Based on the provided gene list, Dynegene (China) was commissioned to design and synthesize oligopool; (3) The required RNA probe set can be obtained by transcription using the oligo pool as a template.

[0057] Example 2 This embodiment verifies the accuracy of the odontogenic / bone-derived tumor diagnostic RNA probe pool prepared in Example 1 for the diagnosis of odontogenic tumors. The specific methods and steps are as follows: 200 ng DNA was used to test BRAF V600E, KRAS G12V and NRAS Q61R mutant standards. The QuarPrep EZ DNA Library Kit (Dynegene) was used to construct the next-generation sequencing pre-library, and the pre-library construction was carried out in strict accordance with the kit's instruction manual. From each pre-library, take at least 200 ng of a single pre-library with a total volume not exceeding 8 μL as the pre-library for hybridization capture; if the pre-library concentration is high, take at least 200 ng of a single pre-library with a volume not exceeding 4 μL and a total volume not exceeding 8 μL, and mix them to prepare a mixed pre-library for hybridization capture. The pre-library to be hybridized and captured was hybridized with the 65-gene probe set provided by this invention. The hybridization and capture reagent used was the QuarHyb One Reagent Kit (Dynegene), and the operation steps were performed in strict accordance with the operation manual of the kit. The concentration of the 65-gene probes was 100 ng / ul. The hybridized and captured libraries were sequenced using NovaSeq4 according to standard procedures, yielding approximately 2 Gb of data. The mutation status of the standard samples obtained using software such as VARSCAN2, GATK4, and Lofreq is shown in Table 3 below. Table 3

[0058] In Example 2, the detection of standards with different gene mutation sites was used to target the standards with known mutations using the panel designed in Example 2. Data analysis was performed to verify whether the process could accurately find gene mutation sites and to verify the performance of the panel design and the rationality of the process. The results in Table 3 show that the process is accurate and reasonable.

[0059] Example 3 This embodiment verifies the clinical consistency evaluation of the DNA probe set for diagnosing odontogenic / bone-derived tumors prepared in Example 1 with the detection of odontogenic tumors. The specific methods and steps are as follows: We collected 6 samples from each of 5 types of odontogenic tumors whose clinical results had been validated by other methods, for a total of 30 samples. DNA was extracted from the sample using the QIAamp DNA FFPE Tissue Kit (QIAGEN GmbH, Germany, Cat No. 56404). The DNA extraction procedure was performed entirely in accordance with the kit's instruction manual. Next-generation sequencing libraries were constructed using the QuarPrep EZ DNA Library Kit (Dynegene), and the library construction was performed entirely in accordance with the kit's instruction manual. Take 200 ng of each individual library from each library to serve as the pre-library for hybridization capture; if the pre-library concentration is high, take at least 200 ng of each individual pre-library with a volume not exceeding 4 μL and a total volume not exceeding 8 μL to prepare a mixed pre-library for hybridization capture. The pre-library to be hybridized and captured was hybridized with the 65-gene probes provided in this invention. The hybridization and capture reagent used was the QuarHyb One Reagent Kit (Dynegene), and the operation steps were performed entirely in accordance with the instruction manual of the kit. The concentration of the 65-gene probes was 100 ng / ul. The hybridized and captured libraries were sequenced using NovaSeq4 according to standard procedures, with a total output of approximately 2Gb of data. The mutation status of the standard samples was obtained using software such as VARSCAN2, GATK4, and Lofreq, and the odontogenic tumor samples were molecularly classified according to the typing method. The typing results are shown in Table 4 below.

[0060] Table 4

[0061] As can be seen from the table above, the results of the DNA probe pool for diagnosing odontogenic / bone-derived tumors provided by this invention are completely consistent with the results of other clinical methods, indicating that the DNA probe pool for diagnosing odontogenic / bone-derived tumors has a high clinical consistency evaluation in the detection of odontogenic tumors.

[0062] In summary, the DNA probe pool for dentition / bone tumor diagnosis provided by this invention, combined with a relevant next-generation sequencing detection kit and next-generation sequencing, can simultaneously detect multiple gene abnormalities in odontogenic / bone tumors. Compared to the classic Sanger sequencing method, it offers higher throughput, greater convenience, and a shorter detection cycle. Furthermore, as shown in the table, different types of tumors have different gene mutations (Note: COC and DGCT are currently considered different morphologies of the same disease; therefore, there is some overlap in the gene alterations of these two tumors. However, COC is clinically and radiologically completely cystic, while DGCT is solid. Therefore, a definitive diagnosis can be made by combining clinical, radiological, and gene alteration findings). Thus, the results obtained through this invention can serve as an auxiliary means for accurate tumor diagnosis.

[0063] This invention has positive implications for subsequent treatment and patient prognosis assessment. After obtaining the mutation sites using this invention, based on previous research results and literature reports, different disease types have different gene mutation sites. For example, ameloblastoma has BRAF gene mutations, adenoid ameloblastoma has key gene mutations in the WNT signaling pathway, and odontogenic adenoid tumor has KRAS gene mutations. Based on the correspondence between these disease types and specific gene mutations, accurate pathological diagnosis of tumors can be made. After clarifying the disease type based on gene mutations, it can first guide the selection of clinical treatment plans. If it is a cyst, curettage or excision is generally used; if it is a benign tumor, curettage or segmental resection is generally used; if it is a malignant tumor, complete resection is generally used. Secondly, some targets in this 65-gene panel have corresponding targeted drugs. For example, BRAF and KRAS mutations have targeted inhibitors. For some inoperable cases, if the relevant targets are detected, corresponding targeted drug treatment can be used. Prognostic assessment is mainly related to the disease type. If it is a cyst or a benign tumor, routine postoperative follow-up is sufficient. If it is a malignant tumor, the follow-up interval should be shortened, and in addition to examining the primary site, it is also necessary to examine all vital organs and monitor the risk of tumor metastasis. If the mutation is a type 2 mutation, the OncoKB and CIVIC databases should be used to check if there is a corresponding targeted drug for the mutation site. If a targeted therapy drug is found, it can guide clinical medication. At the same time, the Clivar database should be used to check if the gene mutation is related to the occurrence, development, and prognosis of other types of tumors. If a relationship is found, the patient should be closely followed up to improve the prognosis and treatment effect.

[0064] If the mutation site belongs to category 3 or 4, the pathological morphology and immunohistochemical manifestations of tumors with this gene mutation are summarized to explore whether odontogenic tumors with this gene mutation have special morphological manifestations, whether they can be classified as novel odontogenic tumors, or whether a new subtype of existing odontogenic tumors is discovered. Simultaneously, combined with the patient's clinical manifestations and follow-up information, the presence of special clinical manifestations or their impact on prognosis is explored. Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention. The present invention is limited only by the claims and their full scope and equivalents.

Claims

1. A probe set for targeted capture and detection of gene variants related to dental / bone lesions of the oral and maxillofacial region, characterized in that, The probe set includes the sequences shown in SED ID No. 1 to SED ID No.

130.

2. The probe set for targeted capture and detection of gene variations related to dental / bone lesions of the oral and maxillofacial region according to claim 1, characterized in that, The genes related to dental / bone lesions of the oral and maxillofacial region include the following 65 genes: ACTB gene, ALK gene, APC gene, ARAF gene, ARID1A gene, AXIN1 gene, BRAF gene, CDC73 gene, CDK11B gene, CDK4 gene, CDKN2A gene, CREBBP gene, CTNNB1 gene, CYLD gene, EXT1 gene, EXT2 gene, FGFR1 gene, FGFR2 gene, FGFR3 gene, FGFR4 gene, GDD1 gene, GNAQ gene, GNAS gene, GRM1 gene, H3F3A gene, H3F3B gene, HRAS gene, IDH1 gene, IDH2 gene, JAK1 gene, JAK2 gene, JAK3 gene, K The probe set covers the exon regions of the following 65 genes: DR, KIT, KRAS, KRT13, MDM2, MED12, MEN1, MET, MLL2, MYOD1, NEDD4L, NF1, NF2, NRAS, PIK3CA, PRKAR1A, PTCH1, PTEN, RASAL1, RB1, SDHA, SDHB, SDHC, SDHD, SH3BP2, SMARCA4, SMARCB1, SMO, SMURF1, TP53, TRPV4, TWIST1, and UBR5.

3. A kit comprising the probe set as described in claim 1 or 2.

4. The use of the kit described in claim 3 in the preparation of a product that targets and detects genes related to dental / bone lesions of the oral and maxillofacial region.

5. A method for constructing a gene detection model related to dental / bone lesions of the oral and maxillofacial region using the probe set described in claim 1 or 2 or the kit described in claim 3, characterized in that, Includes the following steps: (1) DNA extraction from the sample to be tested; (2) Pre-library preparation, probe hybridization capture library preparation, sequencing and sequencing result analysis, and classification of the obtained mutation sites to construct a model; The probe set is used in the step of preparing the probe hybridization capture library.

6. The method for constructing a gene detection model related to dental / bone lesions of the oral and maxillofacial region according to claim 5, characterized in that, The sequencing includes: sending the hybridization capture library to a sequencing company, performing paired-end sequencing reaction using NovaS4, and requiring a data volume greater than 2G in fastq format. The sequencing results analysis includes: First, the returned data was quality controlled using FastQC software. Skwer was used to remove adapters and related low-quality fragments to reduce their impact on subsequent data analysis. After the connectors were repaired, FastQC was used again for quality control to analyze the data quality in order to improve the relevant experimental procedures. The BWA MEM algorithm was used to align the adapter-trimmed sequences with the HG38 standard human genome data, and samtools was used to convert the resulting .sam files into binary .bam files. Use samtools sort to sort the bam files, then use gatk mark duplication to mark duplicate sequences, and picard to remove duplicate sequences; gatkBaseRecalibrator performs base correction; gatk applies BQSR to correct the re-alignment region; Then, the variant calling step was performed using gatk mutect2, lofreq, and freebayes software, combined with 65 panel gene probe sequence files, to obtain .vcf format files. Finally, the mutation sites were filtered using relevant filtering commands to generate filtered .vcf files. Use Annovar to convert the .vcf file to .avinput format, and then use Annovar to annotate each mutation site.

7. The method for constructing a gene detection model related to dental / bone lesions of the oral and maxillofacial region according to claim 5, characterized in that, The method for classifying the obtained mutation sites to build the model is as follows: using the following mutation site screening criteria, the obtained mutation sites are divided into 4 categories of mutations: (1) Sequencing depth: greater than 100X; (2) Remove mutations located at non-exon sites, synonymous mutations; (3) The remaining mutation sites are rated as follows: 1) Type 1 mutation: The mutation site has been reported in the literature, and the reported cases have the same site and histological type; there is an FDA-approved targeted drug for the mutation site; 2) Type 2 mutation: The mutation site has been reported in the literature, but the reported cases are different in terms of location and / or histological type, or it has appeared in the cosmic database; 3) Type 3 mutations: No relevant literature has been reported on this mutation site, and it does not appear in the cosmic database. However, based on the database and functional prediction tool results, it is further divided into the following subcategories: 3A: Pathogenic or Likely Pathogenic; 3B: Uncertain_significance or Conflicting_classifications_of_pathogenicity; 3C: Benign, Likely benign; 4) Category 4 mutations: No relevant literature reports or database reports are available for this mutation site. Among the nine protein function prediction tools (SIFT, Polyphen-2, LRT, MutationTaster, MutationAssessor, FATHMM, RadialSVM, LR score, and VEST3), if four or more tools predict that the mutation site may be pathogenic, it is classified as 4A; if fewer than four tools predict that the mutation site may be pathogenic, and the mutation site is benign, it is classified as 4B.

8. The method for constructing a gene detection model related to dental / bone lesions of the oral and maxillofacial region according to claim 5, characterized in that, The working concentration of the probe group is 50-150 ng / ul.

9. The method for constructing a gene detection model related to dental / bone lesions of the oral and maxillofacial region according to claim 6, characterized in that, The adapter is a short Y-type adapter with the following base sequences: 5' AATGATACGGCGACCACCGAGATCTACAC-XXXXXXXX-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3' and 3'-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-XXXXXXXX-ATCTCGTATGCCGTCTTCTGCTTG-5', where XXXXXXXX is an 8-base sequence index (Dynegene).

Images