Application of NSUN2 / SFRP4 / Wnt signal axis in diagnosis and / or treatment of cervical cancer

Abstract

The invention provides application of an NSUN2 / SFRP4 / Wnt signal axis in diagnosis and / or treatment of cervical cancer, and relates to the technical field of biological medicines. The invention discloses a new mechanism that RNA methyltransferase NSUN2 activates a Wnt / beta-catenin signal channel by regulating and controlling the expression of SFRP4, systematically clarifies the action mechanism of the molecular axis for promoting the development of cervical cancer, and provides a new theoretical basis for deeply understanding the occurrence and development of cervical cancer. The discovery not only deepens the understanding of the RNA epigenetic regulation mechanism in the tumor, but also provides a new thought and a potential intervention target for accurate diagnosis and targeted therapy of cervical cancer. The in-depth research aiming at the regulation and control axis in the future is expected to convert the fundamental research into a clinical intervention strategy, so that a new treatment choice is brought to cervical cancer patients.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of the NSUN2 / SFRP4 / Wnt signal axis in the diagnosis and / or treatment of cervical cancer. Background Technology

[0002] Cervical cancer, a malignant tumor that seriously threatens women's health, has a high mortality rate among women worldwide, with poor prognosis for patients in advanced stages. According to the latest statistics from the World Health Organization, in 2020, there were over 600,000 new cases of cervical cancer globally, with as many as 340,000 deaths, making it the fourth most common malignant tumor among women worldwide. In developing countries, the disease burden of cervical cancer is particularly heavy, accounting for approximately 90% of global cervical cancer deaths. Although the widespread use of HPV preventative vaccines and screening programs have reduced the incidence of cervical cancer to some extent, the prognosis for patients with advanced and recurrent / metastatic cervical cancer remains grim, with a 5-year survival rate of only 15-30%. Currently, clinical treatment for cervical cancer mainly relies on comprehensive treatment methods such as surgery, radiotherapy, and chemotherapy; however, treatment resistance and severe toxic side effects significantly limit the improvement of treatment effectiveness. Therefore, elucidating the molecular mechanisms of cervical cancer development and progression, and identifying new diagnostic biomarkers and therapeutic targets, is of significant clinical importance for improving patient prognosis.

[0003] In recent years, the role of epigenetic regulation in tumorigenesis and development has attracted widespread attention from researchers. Among these, RNA methylation modification, as one of the important epigenetic regulatory mechanisms, plays a crucial role in gene expression regulation. 5-methylcytosine (m5C) modification is one of the most common types of RNA modification, mainly catalyzed by NSUN (NOP2 / Sun) family methyltransferases. As a key catalytic enzyme in m5C modification, NSUN2 participates in important biological processes such as cell proliferation, differentiation, and apoptosis by regulating mRNA stability, translation efficiency, and subcellular localization. Numerous studies have shown that NSUN2 is abnormally highly expressed in various malignant tumors, including liver cancer, breast cancer, and gastric cancer, and promotes tumor cell proliferation, invasion, and metastasis by regulating the expression of downstream target genes. However, current research on the expression characteristics, biological functions, and molecular mechanisms of NSUN2 in cervical cancer remains limited. This significantly restricts our understanding of the mechanisms of action of RNA methylation modification in cervical cancer and hinders the development of related targeted therapy strategies. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides the application of the NSUN2 / SFRP4 / Wnt signal axis in the diagnosis and / or treatment of cervical cancer, which can effectively promote the development of related targeted therapy strategies.

[0005] To achieve the above objectives, the present invention provides the following technical solution: Application of inhibitors of NSUN2 / SFRP4 / Wnt signaling axis targets in cervical cancer in the preparation of drugs for treating cervical cancer.

[0006] Preferably, the inhibitory agent comprises an inhibitor targeting NSUN2.

[0007] Preferably, the inhibitor targeting NSUN2 includes at least one of siRNA, small molecule inhibitors, and gene editing systems; The nucleotide sequence of the si-RNA is as follows: Forward primer:GCTGCTACCTGCTCGTCCATC; Reward primer:TTTCCTGCCGTCCACATCTATCTG.

[0008] Preferably, the inhibitor inhibits the expression of NSUN2 to increase the expression level of SFRP4, thereby inhibiting the activity of the Wnt / β-catenin signaling pathway and affecting the proliferation and migration of cervical cancer cells.

[0009] Application of NSUN2 / SFRP4 / Wnt signal axis target detection reagents in the preparation of diagnostic kits for cervical cancer prognostic assessment.

[0010] This invention provides the application of the NSUN2 / SFRP4 / Wnt signal axis in the diagnosis and / or treatment of cervical cancer, and its advantages compared with the prior art are: This invention reveals a novel mechanism by which the RNA methyltransferase NSUN2 activates the Wnt / β-catenin signaling pathway by regulating SFRP4 expression, systematically elucidating the mechanism by which this molecular axis promotes cervical cancer development and providing new theoretical support for a deeper understanding of cervical cancer pathogenesis. This discovery not only deepens our understanding of RNA epigenetic regulation mechanisms in tumors but also provides new ideas and potential intervention targets for the precise diagnosis and targeted therapy of cervical cancer. Future in-depth research on this regulatory axis is expected to translate these basic research findings into clinical intervention strategies, bringing new treatment options to cervical cancer patients.

[0011] This invention reveals the crucial role of NSUN2 in cervical cancer progression, suggesting its potential as a molecular target for diagnosis and treatment, as well as a novel biomarker for prognostic assessment. From an epigenetic regulatory perspective, we systematically elucidated the molecular mechanism of the NSUN2-SFRP4-Wnt / β-catenin signaling axis in cervical cancer invasion and metastasis. This discovery not only provides new theoretical support for a deeper understanding of cervical cancer pathogenesis but also lays an important foundation for developing anti-tumor strategies targeting this signaling pathway. Furthermore, upregulating SFRP4 expression or directly targeting key molecules in the Wnt signaling pathway may become a novel strategy for treating cervical cancer. Particularly for advanced patients resistant to conventional therapies, targeting this newly discovered regulatory axis may offer new therapeutic hope. Attached Figure Description

[0012] Figure 1 In the table, A represents NSUN2 mRNA expression in cervical tissue; B represents NSUN2 immunohistochemistry in cervical tissue; C represents NSUN2 mRNA expression in cells; and D represents NSUN2 protein expression in cells. AB: **P < 0.01 compared to normal cervical tissue; CD: **P < 0.01 compared to H8 cells; ##P < 0.01 compared to Ect1 / E6E7 cells; N = 3. Figure 2 In the table, A represents the HeLa cell scratch assay; B represents the SiHa cell scratch assay; C represents the HeLa cell Transwell migration assay; D represents the SiHa cell Transwell migration assay; E represents the mRNA expression of Bax in HeLa cells; F represents the mRNA expression of caspase-3 in HeLa cells; G represents the mRNA expression of Bcl-2 in HeLa cells; H represents the mRNA expression of Bax in SiHa cells; I represents the mRNA expression of caspase-3 in SiHa cells; J represents the mRNA expression of Bcl-2 in SiHa cells. A, C, EG: **P < 0.01, compared with the HeLa group; B, D, HJ: **P < 0.01, compared with the SiHa group; N = 3; Figure 3In the table, A represents the mRNA expression of CCND1 in cervical tissue; B represents the mRNA expression of c-Myc in cervical tissue; C represents the protein expression of CCND1 in tissue; D represents the protein expression of c-Myc in tissue; E represents the protein expression of β-catenin in tissue; F represents the mRNA expression of CCND1 in cells; G represents the mRNA expression of c-Myc in cells; H represents the protein expression of CCND1 in cells; I represents the protein expression of c-Myc in cells; J represents the protein expression of β-catenin in cells. AE: **P < 0.01, compared with normal cervical tissue; FJ: **P < 0.01, compared with H8 cells; ##P < 0.01, compared with Ect1 / E6E7 cells; N=3; Figure 4 In the table, A represents the mRNA expression of CCND1 in HeLa cells; B represents the mRNA expression of c-Myc in HeLa cells; C represents the protein expression of CCND1 in HeLa cells; D represents the protein expression of c-Myc in HeLa cells; E represents the protein expression of β-catenin in HeLa cells; F represents the mRNA expression of CCND1 in SiHa cells; G represents the mRNA expression of c-Myc in SiHa cells; H represents the protein expression of CCND1 in SiHa cells; I represents the protein expression of c-Myc in SiHa cells; and J represents the protein expression of β-catenin in SiHa cells. AE: **P < 0.01, compared with the HeLa group; FJ: *P < 0.05 and **P < 0.01, compared with the SiHa group. N=3; Figure 5 In the table, A represents SFRP4 mRNA expression in cervical tissue; B represents SFRP4 immunofluorescence in cervical tissue; C represents SFRP4 mRNA expression in cells; D represents SFRP4 mRNA expression in HeLa cells; E represents SFRP4 mRNA expression in SiHa cells; F represents SFRP4 immunofluorescence in HeLa cells; and G represents SFRP4 immunofluorescence in SiHa cells. AB: **P < 0.01, compared with normal cervical tissue; C: **P < 0.01, compared with H8 cells; ##P < 0.01, compared with Ect1 / E6E7 cells; D and F: **P < 0.01, compared with the HeLa group; E and G: **P < 0.01, compared with the SiHa group; N=3; Figure 6In the table, A represents the mRNA expression of CCND1 in HeLa cells; B represents the mRNA expression of c-Myc in HeLa cells; C represents the mRNA expression of CCND1 in SiHa cells; D represents the mRNA expression of c-Myc in SiHa cells; E represents the immunofluorescence of β-catenin in HeLa cells; and F represents the immunofluorescence of β-catenin in SiHa cells. AB and E: **P < 0.01 compared with the HeLa group; #P < 0.05, ##P < 0.01 compared with the HeLa+si-NSUN2 group; CD and F: **P < 0.01 compared with the SiHa group; ##P < 0.01 compared with the SiHa+si-NSUN2 group; N=3; Figure 7 In the table, A represents the HeLa cell scratch assay; B represents the SiHa cell scratch assay; C represents the HeLa cell Transwell migration assay; D represents the SiHa cell Transwell migration assay; E represents the mRNA expression of Bax in HeLa cells; F represents the mRNA expression of caspase-3 in HeLa cells; G represents the mRNA expression of Bcl-2 in HeLa cells; H represents the mRNA expression of Bax in SiHa cells; I represents the mRNA expression of caspase-3 in SiHa cells; and J represents the mRNA expression of Bcl-2 in SiHa cells. A, C, EG: **P < 0.01 compared to the HeLa group; #P < 0.05, ##P < 0.01 compared to the HeLa+si-NSUN2 group; B, D, HJ: **P < 0.01 compared to the SiHa group; #P < 0.05, ##P < 0.01 compared to the SiHa+si-NSUN2 group; N=3; Figure 8 This diagram illustrates how the RNA methyltransferase NSUN2 promotes cervical cancer development by regulating SFRP4 expression and activating the Wnt / β-catenin signaling pathway. Detailed Implementation

[0013] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0014] Fetal bovine serum (batch number 16140071), DMEM medium (batch number 6124543), and TRizol reagent (batch number 8123029) were all purchased from Thermo Fisher Scientific (China) Co., Ltd.; NSUN2 (batch number DF12103) was purchased from Jiangsu Qinke Biotechnology Research Center Co., Ltd.; SFRP4 (batch number bs-1331R) was purchased from Beijing Bio-Sens Biotechnology Co., Ltd.; β-catenin (batch number AB32572), CCND1 (batch number AB16663), c-Myc (batch number AB32072), and β-actin (batch number AB8226) were all purchased from Abcam. Horseradish enzyme labeling... Goat anti-rat IgG (batch number ZB-2307) and horseradish enzyme-labeled rabbit anti-goat IgG (batch number ZB-2306) were purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.; ECL chemiluminescence kit (batch number BL520A), PCR kit (batch number BL697A), and reverse transcription kit (batch number BL696A) were purchased from Biosharp; cell lysis buffer (batch number P0013B), penicillin-streptomycin (batch number C0222), and SDS-PAGE protein loading buffer (batch number P0015) were purchased from Beyotime Biotechnology Co., Ltd.; primers were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0015] Cell culture: The human cervical cancer cell lines (HeLa, SiHa) and normal cervical epithelial cell lines (H8, Ect1 / E6E7) used in this study were purchased from the Shanghai Cell Bank, Chinese Academy of Sciences (Shanghai, China). The cell culture medium consisted of 10% fetal bovine serum (Gibco, USA), 1% penicillin-streptomycin antibiotics (Beyotime, China), and DMEM high-glucose medium (Gibco, USA). Cells were cultured routinely in a 37°C, 5% CO2 incubator. Cell passage was performed using 0.25% trypsin-EDTA digestion solution (Beyotime, China).

[0016] Example: 1. Experimental Items and Methods 1.1 Scratch Test Cervical cancer cells (HeLa and SiHa) were seeded into 6-well plates and cultured in DMEM medium containing 10% FBS until 80% confluence. A straight scratch was made perpendicular to the bottom of each well using a 200 μL sterile pipette tip. The plates were gently rinsed once with PBS to remove exfoliated cells, and 1 mL of fresh culture medium was added to each well. The plates were then incubated at 37°C in a 5% CO2 incubator. Observations and photographs were taken under an inverted microscope (×10) at 0 and 24 h. The scratch width was measured using ImageJ software, and the migration rate (%) was calculated as (0 h scratch area - 24 h scratch area) / 0 h scratch area × 100%.

[0017] 1.2 Transwell cell migration assay Cell migration ability was assessed using an 8 μm pore size Transwell migration chamber. Specifically, cells were resuspended in 200 μL of serum-free DMEM high-glucose medium and seeded in the upper chamber, while 600 μL of complete medium containing 10% FBS was added to the lower chamber as a chemical inducer. After incubation at 37°C and 5% CO2 for 24 hours, unmigrated cells in the upper chamber were gently removed with a moistened cotton swab, followed by fixation with 4% paraformaldehyde for 15 min and staining with 0.1% crystal violet for 20 min. After rinsing with PBS, images were taken under an inverted microscope, and the number of migrating cells was quantitatively analyzed using ImageJ software.

[0018] 1.3 Immunofluorescence Bake the slides in a desiccant oven at 66°C for 25 min, then pass them through xylene three times, 5 min each time. Pass the slides through a gradient of ethanol three times, 3 min each time, then place them in a beaker and slowly rinse with running water to remove the ethanol. Treat the slides with 2000 mL of citrate solution (pH 6.0) for 2 min, wash three times with distilled water, rinse three times with PBS-T, add 0.5% Triton X-100, cap, and incubate at 37°C for 30-60 min. Rinse three times with PBS-T, add goat serum blocking solution, and incubate at 37°C. Remove the slides, discard the goat serum, add primary antibody, cap, and incubate at 37°C for 60 min. Then remove the slides, rinse three times with PBS-T to remove excess liquid, add immunofluorescence secondary antibody, cap, and incubate at 37°C in the dark for 30 min. Rinse three times with PBS-T. Mount with anti-fluorescence quenching mounting medium (containing DAPI), and scan the fluorescent slides with a digital slide scanner.

[0019] 1.4 Immunohistochemistry Paraffin-embedded tissue was trimmed into blocks and serially sectioned (5 μm). The sections were then spread in 40°C warm water, mounted on glass slides, and baked at 37°C overnight. The slides were dewaxed in xylene, washed with water, and then soaked in 3% H2O2 for 10 minutes to remove endogenous catalase and repair antigens. The slides were then blocked with serum, and primary and secondary antibodies were added separately, followed by chromogenic reagent, dehydration, and sealing.

[0020] 1.5 Immunoblotting Cells and tissues were lysed using cell lysis buffer, and proteins were extracted. After electrophoretic separation, proteins were electrotransferred onto a PVDF membrane. The PVDF membrane was sealed in 5% skim milk solution for 2 h. After washing three times, the membrane was incubated overnight at 4°C with primary antibodies against β-actin, NSUN2, β-catenin, c-Myc, and CCND1. After washing three times, the membrane was incubated with HRP-conjugated secondary antibody at room temperature for 1 h. Detection was performed using an ECL chemiluminescence assay kit, and grayscale analysis was performed using ImageJ software.

[0021] 1.6 RT-qPCR RNA was extracted from tissues and cells using TRizol reagent and precipitated with isopropanol. RNA was reverse transcribed according to the reverse transcription kit instructions, and the product was stored at -20°C. Quantitative PCR amplification was performed using a real-time PCR kit. The 2-ΔΔCt method was used to calculate the β-actin intrinsic parameter. Primer settings are shown in Table 1. Table 1 1.7 Cell transfection Before transfection, cells were seeded into 6-well plates. Antibiotic-free medium was added to each well according to the lipofectamine 3000 instructions, achieving a cell density of 60-80% at transfection. Lipofectamine 3000, si-SFRP4, and si-NSUN2 were diluted separately in Opti-MEM medium, mixed thoroughly, and incubated at room temperature for 5 min. The diluted lipofectamine 3000 and si-SFRP4 / si-NSUN2 were then mixed and added to the cell culture medium, gently shaken to mix. The plates were incubated for 6 hours, the medium was changed, and the plates were cultured again. RNA and protein were extracted from the cells after 24 hours for subsequent experiments. Primer sequences are shown in Table 2. Table 2 2. Experimental Results and Conclusions 2.1 Abnormally high expression of NSUN2 in cervical cancer First, the expression of NSUN2 in cervical tissue was detected using RT-qPCR and immunohistochemistry. Figure 1 As shown in Figure A, the expression level of NSUN2 mRNA was significantly upregulated in cervical cancer tissue compared to normal cervical tissue. Immunohistochemical results ( Figure 1 B) Further confirmation showed that the proportion of NSUN2-positive cells in cervical cancer tissue was significantly increased, suggesting that NSUN2 may be involved in the occurrence and development of cervical cancer.

[0022] To validate this finding, the expression patterns of NSUN2 in different cervical cell lines were further examined. RT-qPCR ( Figure 1 C) and Western blot ( Figure 1 D) The results showed that, compared with normal cervical cell lines (H8, Ect1 / E6E7), NSUN2 was significantly overexpressed at both the mRNA and protein levels in cervical cancer cell lines (HeLa, SiHa). This result was consistent with the tissue-level detection data and further supported the abnormally high expression of NSUN2 in cervical cancer.

[0023] 2.2 NSUN2 promotes the migration of cervical cancer cells. To elucidate the effect of NSUN2 on cervical cancer cell migration, we performed a series of functional experiments after knocking down NSUN2 expression using siRNA. The scratch assay results showed ( Figure 2 NSUN2 knockdown significantly inhibited the migration ability of cervical cancer cells (HeLa, SiHa) compared to the control group. Transwell migration assays further confirmed this result. Figure 2 CD), the number of transmembrane cells was reduced in the NSUN2 knockdown group compared to the control group. Furthermore, RT-qPCR analysis of apoptosis-related gene expression revealed that NSUN2 knockdown downregulated the expression of the anti-apoptotic gene Bcl-2, while significantly upregulated the expression of pro-apoptotic genes Bax and caspase-3. Figure 2 These results suggest that NSUN2 may promote the migration ability of cervical cancer cells by regulating the expression of apoptosis-related genes.

[0024] 2.3. The Wnt / β-catenin signaling pathway is highly expressed in cervical cancer. We used RT-qPCR and Western blot to detect the expression of key genes in the Wnt / β-catenin signaling pathway in cervical cancer. The results showed that, at the tissue level, compared with normal cervical tissue, the mRNA levels and protein expression of CCND1, c-Myc, and β-catenin were significantly upregulated in cervical cancer tissue. Figure 3 AE). In cells, the mRNA expression levels of CCND1 and c-Myc in cervical cancer cell lines (HeLa, SiHa) were significantly increased compared to normal cervical epithelial cell lines (H8, Ect1 / E6E7), and the protein expression levels of CCND1, c-Myc, and β-catenin were also correspondingly increased. Figure 3 These results indicate that the Wnt / β-catenin signaling pathway is significantly activated in cervical cancer, suggesting that abnormal activation of this pathway may participate in the pathogenesis and development of cervical cancer by regulating biological processes such as cell proliferation.

[0025] 2.4 NSUN2 activates the Wnt / β-catenin signaling pathway NSUN2 expression was knocked down in HeLa and SiHa cells to examine its effect on the Wnt / β-catenin signaling pathway. In HeLa cells, RT-qPCR analysis revealed that knockdown of NSUN2 expression significantly downregulated the mRNA levels of CCND1 and c-Myc. Figure 4 AB). To further clarify its impact, Western blot analysis was used. The results showed that in the NSUN2 knockdown group, the protein expression levels of CCND1, c-Myc, and β-catenin were all significantly reduced (AB). Figure 4 CE).

[0026] Similarly, knockdown of NSUN2 expression in SiHa cells significantly downregulated the mRNA expression of CCND1 and c-Myc. Figure 4 FG), consistent with the results in HeLa cells. Western blot analysis further confirmed that in SiHa cells of the NSUN2 knockdown group, the protein expression levels of CCND1, c-Myc, and β-catenin were significantly decreased (FG). Figure 4 These results indicate that NSUN2 knockdown significantly inhibits the activation of the Wnt / β-catenin signaling pathway, suggesting that NSUN2 may participate in the progression of cervical cancer by regulating this pathway.

[0027] 2.5. NSUN2 inhibits SFRP4 expression. The results of tissue-level testing showed that ( Figure 5 Compared with adjacent normal tissues, the mRNA and protein expression levels of SFRP4 were significantly downregulated in cervical cancer tissues (AB). This result was further validated on a cellular basis, with SFRP4 mRNA expression levels in cervical cancer cell lines (HeLa, SiHa) being significantly lower than those in normal cervical epithelial cell lines (H8, Ect1 / E6E7). Figure 5 C).

[0028] Given the abnormally high expression of NSUN2 in cervical cancer, we used an siRNA knockdown strategy to investigate its regulatory role on SFRP4. Experimental results showed that after NSUN2 knockdown in HeLa and SiHa cells, RT-qPCR analysis revealed a significant increase in SFRP4 mRNA expression; immunofluorescence results further confirmed that SFRP4 protein expression was significantly increased after NSUN2 knockdown. Figure 5 DG).

[0029] 2.6 NSUN2 activates the Wnt / β-catenin signaling pathway via SFRP4. Based on previous findings that NSUN2 knockdown upregulates SFRP4 expression, we further employed a dual-gene knockdown strategy to investigate the role of SFRP4 in NSUN2 regulation of the Wnt / β-catenin pathway. Experimental results showed that in SiHa and HeLa cells with simultaneous NSUN2 and SFRP4 knockdown, the mRNA expression levels of CCND1 and c-Myc significantly increased compared to the NSUN2 knockdown group alone, suggesting that SFRP4 participates in mediating the NSUN2-mediated regulation of the Wnt pathway. Figure 6 AD).

[0030] Immunofluorescence assays revealed that NSUN2 knockdown inhibited β-catenin protein expression, while SFRP4 knockdown reversed this process. Figure 6 These results collectively indicate that NSUN2 activates the Wnt / β-catenin signaling pathway by negatively regulating SFRP4 expression, thereby affecting the expression of β-catenin and the transcription of its downstream target genes CCND1 and c-Myc.

[0031] 2.7. NSUN2 promotes cervical cancer through the SFRP4-Wnt / β-catenin signaling axis. To further investigate the influence of the NSUN2-SFRP4-Wnt / β-catenin regulatory axis on cervical cancer cell migration, we conducted a systematic study using a dual-gene knockdown strategy. Scratch assay and Transwell migration assay results consistently showed that simultaneous knockdown of NSUN2 and SFRP4 in HeLa and SiHa cells significantly reversed the inhibitory effect of NSUN2 knockdown alone on cell migration, manifested as increased migration area and increased number of cells penetrating the membrane. Figure 7 AD).

[0032] RT-qPCR analysis revealed that the double knockout group exhibited significantly greater apoptosis resistance compared to the single knockout NSUN2 group: the expression of the anti-apoptotic gene Bcl-2 was upregulated, while the expression of the pro-apoptotic genes Bax and caspase-3 was decreased. Figure 7 EJ).

[0033] These data fully demonstrate that NSUN2 promotes the migration ability and apoptosis resistance of cervical cancer cells by specifically regulating the SFRP4-Wnt / β-catenin signaling axis. Figure 8 ).

[0034] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of inhibitors of the NSUN2 / SFRP4 / Wnt signaling axis targets of cervical cancer in the preparation of drugs for the treatment of cervical cancer.

2. The application according to claim 1, characterized in that, The inhibitors include those that target NSUN2.

3. The application according to claim 2, characterized in that, The inhibitors targeting NSUN2 include at least one of siRNA, small molecule inhibitors, and gene editing systems; The nucleotide sequence of the siRNA is as follows: Forward primer:GCTGCTACCTGCTCGTCCATC; Reward primer:TTTCCTGCCGTCCACATCTATCTG.

4. The application according to claim 3, characterized in that, The inhibitor inhibits the expression of NSUN2 to increase the expression level of SFRP4, thereby inhibiting the activity of the Wnt / β-catenin signaling pathway and thus affecting the proliferation and migration of cervical cancer cells.

5. Application of NSUN2 / SFRP4 / Wnt signal axis target detection reagents in the preparation of diagnostic kits for cervical cancer prognostic assessment.

Images