A plasmonic resonance detection method for liver-specific methylation sites

By constructing a thiol-modified DNA capture probe and a methylation-binding domain protein co-interface on a surface plasmon resonance sensor, combined with magnetic bead extraction and fragment screening, the problems of rapid, low-cost, and high-specificity DNA methylation detection in existing technologies are solved. This enables non-destructive, real-time detection of trace DNA methylation in blood, improving the sensitivity and stability of the detection.

CN122128404APending Publication Date: 2026-06-02THE FIRST AFFILIATED HOSPITAL OF WENZHOU MEDICAL UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
THE FIRST AFFILIATED HOSPITAL OF WENZHOU MEDICAL UNIV
Filing Date
2026-04-28
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing technologies are insufficient for achieving rapid, low-cost, non-destructive sample processing, real-time and highly specific DNA methylation detection in clinical practice, especially in the detection of trace amounts of circulating cell-free DNA in blood. Traditional surface plasmon resonance technology cannot distinguish between base sequences and epigenetic modifications, and existing methods suffer from problems such as chemical treatment that damages DNA, complex operation, and high cost.

Method used

By constructing an interface on a surface plasmon resonance sensor where a thiol-modified DNA capture probe and a methylation-binding domain protein work synergistically, and combining magnetic bead extraction and fragment screening enrichment techniques, label-free, real-time detection of blood samples can be achieved, avoiding bisulfite treatment, ensuring DNA integrity, and identifying methylation status through real-time signal analysis.

Benefits of technology

It achieves high sensitivity, stability and repeatability in the detection of low-abundance DNA methylation targets, avoids DNA damage caused by chemical processing, simplifies the operation process, reduces costs, adapts to complex biological samples, and provides a rapid and reliable methylation analysis tool.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128404A_ABST
    Figure CN122128404A_ABST
Patent Text Reader

Abstract

This invention discloses a plasmon resonance detection method for hepatobiliary-specific methylation sites. The method first immobilizes a sequence-specific DNA capture probe on a gold membrane surface and covalently couples it with a methylation-binding domain protein, constructing a sensor interface with dual functions of sequence capture and methylation recognition. During detection, a pre-treated plasma circulating cell-free DNA single-stranded sample is introduced into the sensor. The target DNA first hybridizes with the capture probe, and then its methylation site is specifically bound by the adjacent methylation-binding domain protein, triggering two consecutive specific surface plasmon resonance signal responses. By analyzing the increment between the two stable signal values ​​and comparing it with a preset threshold, label-free, real-time, and highly specific determination of the methylation status of the target site can be achieved. This invention eliminates the need for bisulfate treatment, effectively preserving DNA integrity, and is particularly suitable for high-sensitivity detection of hepatobiliary disease-related epigenetic markers in trace circulating cell-free DNA.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical detection technology, and in particular to a plasma resonance detection method for liver and gallbladder-specific methylation sites. Background Technology

[0002] DNA methylation is a key epigenetic modification that plays a crucial role in gene expression regulation, cell differentiation, and disease development. Abnormal methylation at specific gene loci is an early molecular event in various hepatobiliary malignancies, including liver cancer and cholangiocarcinoma. Therefore, detecting the specific methylation status of circulating free DNA derived from diseased hepatobiliary tissues in bodily fluids such as blood is of significant value for early disease screening, molecular subtyping, treatment monitoring, and prognostic assessment.

[0003] Currently, the main techniques for detecting DNA methylation include bisulfite sequencing, methylation-specific PCR, and mass spectrometry. Bisulfite sequencing is considered the gold standard, but its process is cumbersome and time-consuming, involving the harsh chemical treatment of bisulfite, which can lead to severe DNA degradation. Furthermore, subsequent PCR amplification may introduce bias and errors, making absolute quantification difficult. While methylation-specific PCR has high sensitivity, it also relies on bisulfite treatment and cannot achieve multiplexing or real-time quantification. Mass spectrometry offers high precision, but the equipment is expensive and the operation is complex, making it difficult to routinely implement in clinical settings. None of these methods meet the clinical demand for rapid, low-cost, non-destructive sample processing, real-time, and highly specific methylation detection.

[0004] Surface plasmon resonance (SPR) is a label-free, real-time analytical technique for monitoring biomolecular interactions. It reflects molecular binding events by measuring minute changes in the refractive index of a sensor surface, offering advantages such as high sensitivity, label-free operation, and real-time dynamic monitoring. However, traditional SPR techniques lack the ability to distinguish between base sequences and epigenetic modifications, making them unsuitable for direct application to the specific identification of DNA methylation. The core challenge in using SPR for DNA methylation detection lies in constructing a sensor interface capable of simultaneously and specifically capturing target DNA sequences and accurately distinguishing their cytosine methylation status. Existing attempts often employ proteins or antibodies that bind to methylated CpG dinucleotides as recognition elements. However, in complex biological sample contexts, avoiding non-specific adsorption, improving capture efficiency for low-abundance methylation targets, and ensuring detection stability and reproducibility in continuous flow systems remain unresolved technical challenges. Particularly for trace amounts of circulating blood-free DNA, establishing a highly efficient technical pathway that seamlessly integrates with SPR detection from sample pretreatment while maximizing the preservation of target methylation information is a critical bottleneck that urgently needs to be overcome in this field. Summary of the Invention

[0005] To achieve the above objectives, the present invention provides a method for detecting hepatobiliary-specific methylation sites using plasma resonance, comprising the following steps: Step 1: Prepare the methylation-sensitive capture interface of the surface plasmon resonance sensor; the preparation process includes immobilizing a thiol-modified DNA capture probe on the surface of a gold film, and then covalently coupling a methylation-binding domain protein to the DNA capture probe; Step 2: Obtain and preprocess the blood sample to be tested to obtain a single-stranded DNA sample to be tested; the preprocessing process includes extracting circulating cell-free DNA from plasma, screening and enriching the circulating cell-free DNA for fragments, and performing heat denaturation treatment on the enriched DNA; Step 3: The single-stranded DNA sample to be tested is passed into the surface plasmon resonance sensor for hybridization capture and methylation state recognition; the hybridization capture is achieved by the complementary base pairing of the DNA capture probe with the target DNA; the methylation state recognition is achieved by the specific binding of the methylation binding domain protein to the methylated cytosine site on the target DNA; Step 4: Analyze the real-time signal of surface plasmon resonance to determine the methylation state of the target site; the analysis process includes calculating the response value increment caused by the methylation binding event and comparing the response value increment with a preset determination threshold.

[0006] Preferably, in step 1, the sequence design of the thiol-modified DNA capture probe satisfies the following conditions: The sequence of the DNA capture probe is completely complementary to the downstream unmethylated recognition region of the genomic region where the liver and gallbladder-specific methylation site to be tested is located; The DNA capture probe is 20 to 30 nucleotides in length; The DNA capture probe is modified with a thiol group at its 3' or 5' end, and a heterobifunctional cross-linking agent is attached to the nucleotide adjacent to the thiol group. One end of the heterobifunctional crosslinking agent is used to form a gold-sulfur bond with the thiol group to fix it on the gold film surface, and the other end of the heterobifunctional crosslinking agent is used to form a covalent link with the amino group of the methylation binding domain protein. The specific process of immobilizing the DNA capture probe on the gold membrane surface includes: The cleaned and activated surface plasmon resonance sensor chip was immersed in the DNA capture probe solution with a concentration of 0.5 μmol / L to 2 μmol / L and incubated at 25 degrees Celsius for 12 to 16 hours. After incubation, the surface of the sensor chip is thoroughly rinsed with a buffer solution containing dithiothreitol and then with pure water to remove probe molecules that are nonspecifically adsorbed through disulfide bonds. The methylated binding domain protein is a methylated CpG binding domain protein domain, which is derived from the MBD2 protein. The specific process of covalently coupling the methylation-binding domain protein to the DNA capture probe includes: The sensor chip with the DNA capture probe fixed thereon was placed in the reaction cell of the surface plasmon resonance spectrometer. A solution of the methylation-binding domain protein with a concentration of 50 μg / mL to 200 μg / mL was introduced at a flow rate of 10 μL / min to 30 μL / min for 10 to 20 minutes. Through the heterogeneous bifunctional crosslinking agent, the amino groups of the methylated binding domain protein undergo a covalent coupling reaction with the DNA capture probe, and the surface plasmon resonance angle response signal monitored in real time rises and reaches a plateau; A blocking buffer containing 1% bovine serum albumin and 0.1 μmol / L random sequence single-stranded DNA was introduced for 30 to 60 minutes to block non-specific binding sites on the sensor surface.

[0007] Preferably, in step 2, the specific process of extracting circulating cell-free DNA from plasma includes: Mix 1 to 5 ml of plasma with 3 times the volume of lysis buffer containing guanidine isothiocyanate and a surfactant, and incubate the mixture at 60 degrees Celsius for 15 minutes. Add silica-modified magnetic beads with a diameter of 0.5 to 1 micrometer to the lysis mixture and incubate at room temperature for 15 minutes at a salt concentration of 1.0 to 2.0 mol / L and a pH of 4.5 to 5.5 to allow DNA to adsorb onto the surface of the magnetic beads. The magnetic beads were separated using a magnetic rack, and the supernatant was discarded. The magnetic beads were washed twice with a 70% volume fraction ethanol solution, using 500 μL of ethanol solution each time. After vortexing and mixing, the ethanol was removed by magnetic separation. Open the tube cap and allow the magnetic beads to dry at room temperature for 3 to 5 minutes to completely remove residual ethanol; Resuspend the magnetic beads in 50 to 100 μL of low-salt buffer or molecular biology grade pure water, incubate at 55°C for 5 minutes, then place the magnetic beads on a magnetic rack and collect the supernatant containing circulating cell-free DNA.

[0008] Preferably, in step 2, the specific process of fragment screening and enrichment of the circulating cell-free DNA is as follows: A fragment screening kit based on magnetic beads is used, wherein the surface of the magnetic beads is modified with polymers that have differential affinity for DNA fragments of different lengths; The extracted circulating free DNA solution was mixed with the fragment screening magnetic beads at a volume ratio of 1:1 and incubated at room temperature for 10 minutes. Place the mixture on a magnetic rack and let it stand for 1 minute. Carefully aspirate the supernatant, which contains DNA fragments with a length of less than 150 base pairs. Add elution buffer to the remaining solution containing magnetic beads, vortex to mix, and place it on the magnetic rack again to collect the supernatant. The supernatant contains a target DNA fragment with a length of 150 to 200 base pairs. The target DNA fragment was concentrated using ethanol precipitation, and the DNA precipitate was resuspended in 20 to 30 μL of elution buffer.

[0009] Preferably, in step 3, the specific process of hybridization capture and methylation state identification includes: The sensor chip prepared in step 1 was installed in a surface plasmon resonance spectrometer. The sensor surface was rinsed with a running buffer at a constant flow rate of 20 μL per minute until a stable baseline signal with fluctuations of less than 0.1 arcseconds was obtained for 5 minutes. Inject 10 to 50 μL of the single-stranded DNA sample obtained in step 2 into the reaction chamber at a flow rate of 10 μL per minute, with a sample inlet time of 1 to 5 minutes. After the sample is introduced, immediately switch to the running buffer and continue rinsing the sensor surface at the same flow rate for 5 to 10 minutes to remove non-specifically bound DNA. At this time, the monitored signal response value stabilizes at the first stable value. Under the continuous flow of the running buffer, the methylation binding domain protein pre-fixed on the sensor surface specifically binds to the methylated CpG sites on the successfully hybridized DNA target strand. This binding process triggers a second rise in the surface plasmon resonance angle response signal. Continue flushing with the running buffer until the signal reaches the second stable plateau, obtaining the second stable value.

[0010] Preferably, in step 4, the specific process of analyzing the real-time signal of surface plasmon resonance includes: From the real-time combined sensor image obtained in step 3, extract the first stable value, denoted as R1; extract the second stable value, denoted as R2; Calculate the methylation-specific response value increment ΔR, where ΔR = R2 - R1; The preset judgment threshold is obtained through the standard curve method, and the process of establishing the standard curve method is as follows: A target DNA sequence that is completely complementary to the DNA capture probe sequence is synthesized, wherein the target DNA sequence contains the downstream unmethylated recognition region and the upstream methylated CpG site to be tested; Prepare fully methylated and fully unmethylated standards for the target DNA sequence, wherein in the fully methylated standard, both cytosines at the CpG site to be tested are replaced by 5-methylcytosine; Steps 1 to 3 were performed independently and repeatedly using the fully methylated standard and the fully unmethylated standard diluted with a concentration gradient. For each standard at each concentration point, calculate the mean ΔR and standard deviation of at least three repeated experiments; The judgment threshold is the maximum value of the average ΔR obtained at all test concentrations of the fully unmethylated standard, plus three times the standard deviation corresponding to the concentration point of the maximum value.

[0011] Preferably, the method further includes simultaneously injecting an internal reference capture probe competition sequence during the hybridization capture process in step 3, for standardizing and correcting the hybridization efficiency; The internal control capture probe competing sequence is a single-stranded DNA segment complementary to the middle portion of the DNA capture probe sequence, wherein the complementary portion is 8 to 12 nucleotides in length. The internal control capture probe competition sequence is mixed with the single-stranded DNA sample to be tested and then co-injected. The injection concentration of the internal control capture probe competition sequence is fixed at 1 nanomolar per liter. In the signal analysis of step 4, the ratio of the theoretical response value to the actual response value of the sensor to the known concentration of the internal reference capture probe competitive sequence is calculated at the end of the hybridization capture stage, i.e., when R1 is obtained, and is used as the hybridization efficiency correction factor for this detection. The calculated ΔR value is multiplied by the hybridization efficiency correction factor to obtain the corrected methylation-specific response value increment, which is then compared with the determination threshold.

[0012] Preferably, the method further includes a step of regenerating the methylation-sensitive capture interface of the surface plasmon resonance sensor after the methylation state identification step in step 3; The specific process of the regeneration treatment is as follows: A regeneration solution, which is a buffer solution containing 10 mmol / L to 50 mmol / L glycine and a pH of 1.5 to 2.5, is injected into the reaction tank at a flow rate of 30 μL to 50 μL per minute for 1 minute to 2 minutes. The regeneration solution can disrupt the specific binding between the methylation-binding domain protein and methylated cytosine, while not affecting the gold-sulfur bond between the DNA capture probe and the gold membrane surface, or the covalent connection between the DNA capture probe and the methylation-binding domain protein. After the regeneration solution is injected, the running buffer is continued to be introduced at the same flow rate for 5 to 10 minutes until the surface plasmon resonance angle response signal recovers to a baseline level similar to that before the start of step 3. The regeneration process enables the same methylation-sensitive capture interface to be used for the detection of multiple consecutive test samples.

[0013] Preferably, the running buffer used in the method comprises the following components: a Tris-HCl buffer system of 10 mmol / L to 50 mmol / L with a pH of 7.4; sodium chloride of 100 mmol / L to 150 mmol / L; magnesium chloride of 5 mmol / L to 10 mmol / L; and surfactant Tween-20 at a volume fraction of 0.01% to 0.05%. The running buffer is used continuously in the blocking step of step 1, the hybridization capture and recognition step of step 3, and the signal stabilization step of step 4, and is degassed and filtered through a 0.22-micron pore size filter membrane before use.

[0014] Preferably, the hepatobiliary-specific methylation site to be tested is located in the promoter region or enhancer region of a gene associated with malignant transformation of liver or bile duct cells; The genes include the SFRP1 gene, RASSF1A gene, APC gene, or P16 gene; For each different methylation site to be tested, a specific DNA capture probe complementary to a specific downstream sequence of that site needs to be designed. However, the immobilization and coupling methods in step 1, the sample pretreatment methods in step 2, the hybridization and recognition process in step 3, and the signal analysis principles in step 4 remain unchanged.

[0015] The beneficial effects of this invention are: 1. This invention innovatively constructs a dual-functional interface on the sensor surface, synergistically combining a "sequence-specific DNA capture probe" and a "proximity-anchored methylation recognition protein," integrating target sequence hybridization capture and in-situ recognition of methylation status into a single step. This design eliminates the bisulfite chemical treatment step, which is severely destructive to DNA and is required by existing gold standard methods, thereby maximizing the preservation of the integrity and original information of DNA, especially trace amounts of circulating free DNA. This not only significantly improves the detectability of low-abundance targets but also avoids false negatives and quantitative biases caused by incomplete chemical treatment or DNA degradation, providing a more reliable technical foundation for precise epigenetic analysis based on liquid biopsy. 2. This invention is not a single detection step, but a deeply optimized system method. Its technical solution encompasses a complete chain, from magnetic bead extraction of circulating cell-free DNA from plasma, screening and enrichment of fragments of specific lengths, to single-strand pretreatment, and finally to real-time detection via surface plasmon resonance. Each step is designed to address the extremely low concentrations of target substances and complex backgrounds in blood. For example, fragment screening enriches nucleosome-protected fragments associated with target methylation signals, and single-strand pretreatment ensures hybridization efficiency. This streamlined design with clear inputs and outputs significantly enhances the adaptability of the entire method to complex biological samples and its stable detection capability for methylation targets at concentrations as low as nanomolar or even picomolar, meeting the stringent sensitivity requirements of early clinical diagnosis. 3. This invention fully utilizes the advantages of surface plasmon resonance (SPR) technology for real-time monitoring of biomolecular interactions, enabling continuous, label-free observation of DNA hybridization and protein-methylation site binding events. By analyzing real-time sensor maps, not only can the methylation state be accurately determined (qualitatively) based on the final signal increment (ΔR), but semi-quantitative analysis can also be performed by establishing a correlation between the magnitude of ΔR and the concentration of standards. Furthermore, it is expected to obtain information such as affinity parameters from the binding kinetic curve. The entire detection process is automated in a flowing solution, is fast (approximately 30 minutes for core detection of a single sample), and highly objective. It avoids the bias errors introduced by PCR amplification and the complexity introduced by labeling operations, providing clinical practice with a rapid, stable, and more information-rich new tool for methylation analysis. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in this invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, those skilled in the art can obtain other drawings based on these drawings without creative effort.

[0017] Figure 1 This is a flowchart of the steps of the method of the present invention; Figure 2 This is a flowchart illustrating the specific steps of the method of the present invention for fragment screening and enrichment of circulating cell-free DNA; Figure 3 This is a flowchart illustrating the specific steps of the hybridization capture and methylation state identification process of the method of the present invention. Detailed Implementation

[0018] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. It should also be noted that, to make the embodiments more comprehensive, the following embodiments are the best and preferred embodiments, and those skilled in the art can use other alternative methods to implement some well-known technologies; moreover, the accompanying drawings are only for more specific description of the embodiments and are not intended to specifically limit the present invention.

[0019] Please see Figures 1-3 This invention provides a plasma resonance detection method for liver and gallbladder-specific methylation sites. By constructing a sensor interface that integrates sequence capture and methylation recognition functions, and with a specially optimized sample processing flow, label-free, real-time detection of trace target DNA methylation status in blood is achieved.

[0020] The method comprises four main stages. The first stage is the preparation of a methylation-sensitive capture interface. This process begins by immobilizing a thiol-modified single-stranded DNA capture probe on a gold membrane surface. The sequence of this probe is designed to be precisely complementary to the unmethylated region downstream of the target methylation site. Subsequently, a methylation-binding domain protein with high affinity for 5-methylcytosine is covalently attached to the end of the capture probe. After the interface is constructed, it is blocked using a solution containing inert proteins and irrelevant nucleic acids to eliminate nonspecific adsorption.

[0021] The second stage involves processing blood samples. After extracting total circulating cell-free DNA from the plasma, a magnetic bead screening method is used to enrich fragments with lengths between 150 and 200 base pairs. This length range corresponds to the main mononuclear nucleotide DNA and can effectively concentrate targets that may originate from diseased cells. The DNA is then subjected to heat denaturation to obtain single-stranded DNA.

[0022] The third stage involves hybridization capture and methylation recognition. A single-stranded DNA sample is passed through a prepared sensor interface, where the target DNA is specifically immobilized by the capture probe through base complementarity pairing. Subsequently, pre-immobilized methylation-binding domain proteins bind to methylated CpG sites on the successfully captured DNA strand; this binding event is monitored in real time.

[0023] The fourth stage is signal analysis. By calculating the difference in signal response before and after protein binding, a specific methylation response increment is obtained. This increment is compared with a pre-determined threshold obtained through standard experiments, thereby objectively determining the methylation status of the target site in the sample. This method avoids bisulfite treatment, maximizing the protection of trace DNA integrity, and ensures high sensitivity and specificity of detection through dual specificity recognition (sequence and modification).

[0024] In one possible implementation, the design and immobilization process of the thiol-modified DNA capture probe is fundamental to constructing a highly specific capture interface. The nucleotide sequence of the capture probe needs to be perfectly complementary to a downstream region of approximately 25 bases in length within the genomic region containing the methylation site to be detected, and which does not contain CpG sites. This design ensures that the probe recognizes only the specific DNA sequence and does not cross-react with the methylation modification itself. A thiol group is attached to the 3' end of the probe via a carbon spacer arm, and a heterobifunctional cross-linking agent SMCC is pre-coupled to the spacer arm. The maleimide end of this cross-linking agent is stably bound to the thiol group, while its succinimidyl ester end remains activated.

[0025] The cleaned gold-coated chip was immersed in a probe solution with a concentration of 1 μmol / L and incubated at 25°C for 14 hours. Under these conditions, thiol groups form strong gold-sulfur covalent bonds with gold atoms, causing the probe to self-assemble into a monolayer with an upright orientation. After incubation, the chip was washed with a buffer solution containing 10 mmol / L dithiothreitol to reduce and remove probe dimers physically adsorbed through disulfide bonds, ensuring the quality of the surface probe monolayer. Subsequently, the probe-fixed chip was placed in the instrument's flow cell, and a solution of MBD2 protein methylation-binding domains with a concentration of 100 μg / mL was passed through it. The solution flowed over the chip surface at a flow rate of 20 μL / min for 15 minutes. During this process, the primary amino groups on the protein surface reacted with the activated ester groups of the probe's terminal SMCC to form stable amide bonds, thereby covalently and directionally anchoring the protein near the probe.

[0026] This invention creates two spatially adjacent and functionally independent recognition sites: a DNA capture probe is responsible for precisely "capturing" the target sequence from a complex mixture, while a covalently linked methylation-binding domain acts as a specific "detection switch," responding only to specific methylation modifications on the captured sequence. Working together, they form the core of highly specific detection.

[0027] In one possible implementation, efficient extraction of intact circulating cell-free DNA from plasma is a key pretreatment step to ensure detection sensitivity. The process begins by mixing 2 mL of plasma with a lysis buffer containing a high concentration of guanidine isothiocyanate and a surfactant at a volume ratio of 1:3. The mixture is incubated at 60°C for 15 minutes, a step that thoroughly disrupts microvesicle structures that may encapsulate DNA and inactivates nucleases in the plasma. After incubation, silica-modified magnetic microspheres, approximately 0.7 μm in diameter, are added to the lysis buffer. Under the provided high salt concentration and acidic pH conditions, the DNA phosphate backbone strongly adsorbs to the silica surface via cation bridges.

[0028] After gentle incubation at room temperature for 15 minutes, the container was placed on a magnetic rack, where the magnetic microspheres in the solution were rapidly adsorbed onto the tube wall. All supernatant containing impurities such as proteins and lipids was removed. While the container remained on the magnetic rack, 500 μL of 70% ethanol solution was added twice to wash the aggregated microspheres, thoroughly removing the waste liquid after each wash. The container was left to stand at room temperature for 5 minutes to allow residual ethanol to evaporate completely. Finally, 80 μL of low-salt elution buffer preheated to 55°C was added to resuspend the dried microspheres, and the solution was maintained at 55°C for 5 minutes. This low ionic strength and elevated temperature weakened the interaction between DNA and silica, allowing for efficient desorption and dissolution of DNA in the buffer. The microspheres were then separated again using a magnetic rack, and the supernatant rich in purified circulating free DNA was collected.

[0029] The magnetic bead-based extraction method is simple to operate and easy to automate. The strategy of high salt adsorption and low salt elution has high DNA recovery efficiency and can effectively remove PCR inhibitors, providing high-quality DNA templates for subsequent high-sensitivity detection.

[0030] In one possible implementation, the extracted circulating cell-free DNA is enriched by fragment size screening to increase the relative abundance of the target analyte and improve subsequent hybridization efficiency. Specifically, commercially available fragment screening magnetic beads are used, whose surface-modified polymers exhibit differential affinity for DNA fragments of different lengths. 80 μL of DNA solution obtained in the preceding steps is mixed thoroughly with an equal volume of magnetic bead binding buffer, followed by the addition of a precisely measured amount of fragment screening magnetic bead suspension. The mixture is gently incubated at room temperature with gentle inversion for 10 minutes to allow sufficient interaction between the DNA fragments and the polymer on the magnetic bead surface. After incubation, the mixture is placed on a magnetic rack and allowed to stand for 1 minute.

[0031] At this point, the supernatant initially collected mainly contains short DNA fragments less than 150 base pairs in length and impurities, which are discarded. While maintaining adsorption on a magnetic rack, a specially formulated elution buffer is added to the tube, and the beads are gently resuspended by pipetting, followed by another period of separation. The supernatant collected this time is the target product, rich in DNA fragments ranging from 150 to 200 base pairs in length, a range that closely matches the length of mononuclear nucleotide DNA produced by apoptosis. Finally, the target DNA fragments are precipitated by centrifugation at low temperature with the addition of an appropriate amount of co-precipitant and cold ethanol, and the precipitate is redissolved using 25 μL of low-salt buffer.

[0032] This step has two beneficial effects: First, by removing excessively short and long DNA fragments, it significantly enriches nucleosome-derived DNA most likely originating from diseased cells, thereby increasing the relative concentration of the target methylated sequence in the total DNA. Second, controlling the length of the hybridization target within a relatively uniform and moderate range facilitates the formation of a spatially consistent hybridization complex on the sensor surface, reducing binding kinetic fluctuations caused by fragment length differences, thus improving the repeatability and accuracy of the detection.

[0033] In one possible implementation, the real-time detection process of hybridization capture and methylation state identification is performed continuously and automatically in a surface plasmon resonance spectrometer. First, the prepared sensor chip is loaded into the instrument, and the running buffer is continuously flowed over the chip surface at a constant flow rate of 20 μL per minute until the monitored resonance angle signal fluctuates by less than 0.1 arcseconds within 5 minutes, at which point the baseline is considered stable.

[0034] Next, 15 μL of heat-denatured single-stranded DNA sample was injected into the flow cell at a flow rate of 10 μL / min for 1.5 minutes. As the sample flowed across the sensor surface, single-stranded target DNA that was perfectly complementary to the capture probe sequence was specifically captured and hybridized through base pairing. This process caused a change in surface refractive index, resulting in a real-time increase in the resonance angle signal. After sample injection, the flow buffer was immediately switched back to the running buffer, and the sample was continuously rinsed at a flow rate of 20 μL / min for 10 minutes to elute unbound or weakly bound non-specific DNA. The signal then stabilized at the first plateau value, denoted as R1, which quantifies the total amount of target DNA captured.

[0035] With the buffer continuously flowing, the MBD2 methylation-binding domain protein, covalently immobilized near the probe, begins to function without the introduction of any new reagents. If a specific CpG site on the captured target DNA strand is methylated, the protein will bind with high affinity and specificity, leading to a further increase in the sensor surface mass and triggering a second significant rise in the resonance angle signal. After rinsing with run buffer for 5 to 10 minutes, the signal reaches a second stable plateau, denoted as R2. The beneficial effect of this process is that, through real-time monitoring, two key signals—"hybridization capture amount" and "methylation binding amount"—can be obtained sequentially and uninterruptedly in a single injection. This stepwise signal generation mechanism not only intuitively distinguishes between sequence binding events and methylation recognition events but also provides two interrelated readings for quantitative analysis, where the increment of the second-step signal directly and specifically corresponds to the methylation state of the target site.

[0036] In one possible implementation, signal analysis and the establishment of a decision threshold are crucial for objectively interpreting the detection results. After accurately reading the first stable value R1 and the second stable value R2 from the real-time sensor image, the difference between the two is calculated to obtain the methylation-specific response value increment ΔR. The physical meaning of this increment is the additional signal caused by the methylation binding event, and its magnitude is positively correlated with the degree of methylation of the target CpG site on the captured DNA. The decision threshold is determined through systematic standard experiments.

[0037] First, fully methylated and fully unmethylated target DNA sequences were synthesized as standards. These standards were diluted to four concentration gradients: 1 picomoles per liter (PdL), 10 PdL, 100 PdL, and 1 nanomoles per liter (NmL). Each standard at each concentration point was independently tested three times according to the complete detection procedure. For the fully unmethylated standard, theoretically, no ΔR signal should be generated; the small measured value actually arises from instrument noise or trace amounts of non-specific adsorption. The test data for all unmethylated standards were analyzed to find the maximum ΔR value across all concentration points, and the standard deviation of the three replicate experiments at that concentration point was calculated. The decision threshold was set as this maximum average value plus three times its standard deviation. For example, if the experimentally measured maximum ΔR value for the 1 NmL unmethylated standard was 0.5 arcseconds, and the standard deviation was 0.23 arcseconds, then the decision threshold was 0.5 plus 0.69, or 1.19 arcseconds, which can be approximated as 1.2 arcseconds.

[0038] The beneficial effect of this threshold setting method is that it is based on statistical analysis of actual experimental data and has clear statistical significance (approximately 99.7% confidence level). It can effectively distinguish between real methylation-specific signals and background noise, thus providing an objective and repeatable standard for determining "positive" and "negative" results and avoiding errors caused by subjective judgment.

[0039] In one possible implementation, an internal control capture probe competing sequence is introduced to monitor and correct hybridization efficiency in real time, thereby improving quantitative accuracy. This internal control sequence is a 10-nucleotide single-stranded DNA segment whose sequence is perfectly complementary to the middle portion of the DNA capture probe. During sample detection, a known concentration (e.g., 1 nanomolar per liter) of the internal control sequence is pre-mixed with the single-stranded DNA sample to be tested and then co-injected into the flow cell. During the hybridization phase, the internal control sequence competes with the target DNA in the sample for binding to the capture probe on the sensor surface. Since the concentration of the internal control sequence is fixed and known, its theoretical binding response under ideal conditions can be obtained in advance through separate calibration.

[0040] In step 4, when analyzing the signal, in addition to calculating ΔR, it is also necessary to calculate the ratio of the actual response value of the sensor to the internal reference sequence to the theoretical response value at the end of the hybridization phase (i.e., when R1 is obtained). This ratio is the hybridization efficiency correction factor for this detection. If the hybridization conditions are ideal, this factor is close to 1; if the hybridization efficiency is reduced due to factors such as sample matrix effects, this factor will be less than 1. Finally, the calculated original ΔR value is multiplied by this hybridization efficiency correction factor to obtain the corrected methylation-specific response value increment, which is then compared with the judgment threshold.

[0041] By introducing a built-in, competitive internal standard of known concentration, the efficiency loss in the hybridization step caused by factors such as fluid fluctuations, minor temperature changes, or differences in sample matrix can be reflected and corrected in real time for each detection. This makes the detection results between different batches and different samples more comparable, especially for more accurate and reliable quantification of low-concentration targets.

[0042] In one possible implementation, regenerating the methylation-sensitive capture interface after each detection allows for the reuse of the same sensor chip, significantly reducing detection costs. The regeneration process is performed immediately after the R2 signal is acquired and recorded. First, the flow buffer is switched to the regeneration solution, a 50 mmol / L glycine hydrochloride buffer solution at pH 2.0. The regeneration solution is injected into the flow cell at a flow rate of 40 μL / min for 90 seconds. This strongly acidic condition efficiently disrupts the specific hydrogen-bonded and hydrophobic interactions between the methylation-binding domain protein and methylated cytosine, forcing the protein to dissociate from the DNA, while the continuous flow of the buffer carries away the dissociated components.

[0043] Because the amide bonds between the linker protein and the capture probe, as well as the gold-sulfur bonds between the linker probe and the gold membrane, are very stable under these pH conditions, the regeneration process does not disrupt the basic structure of the sensor interface. Immediately after the regeneration buffer is injected, switch back to the original running buffer and continue rinsing for 5 to 10 minutes until the resonance angle signal stabilizes and returns to a baseline level similar to that before the start of the assay. Testing has shown that sensor interfaces prepared in the same manner can typically withstand more than 20 such regeneration cycles without significant performance degradation.

[0044] It enables the reuse of core detection components, avoiding the cost of replacing expensive sensor chips for each test. Simultaneously, the regeneration process is rapid and gentle, without damaging the immobilized capture probes and proteins, ensuring the stability and consistency of subsequent tests. This is particularly important for applications requiring continuous testing of multiple clinical samples or the determination of standard curves.

[0045] In one possible implementation, precise formulation of the run buffer is crucial for ensuring stability and low background noise throughout the detection process. The run buffer used in this method comprises the following components: 25 mmol / L Tris hydrochloride to maintain a physiologically similar pH of 7.4; 150 mmol / L sodium chloride to provide adequate ionic strength to maintain the salt concentration required for DNA hybridization and to shield against electrostatic interference; 10 mmol / L magnesium chloride, as a divalent cation, to stabilize the DNA double-strand structure and promote the binding of methylation-binding domain proteins to DNA; and 0.02% (v / v) of the nonionic surfactant polysorbate 20 to reduce the adsorption of proteins and nucleic acids on fluid lines and nonspecific sites on the sensor.

[0046] Before use, the buffer solution must be filtered through a 0.22-micron pore size filter to remove particulates and thoroughly degassed to eliminate small air bubbles that may be generated during flow, as these bubbles can severely interfere with the optical signal. This specific formulation of the running buffer begins after the blocking step in step 1, continues throughout the entire hybridization capture and methylation recognition process in step 3, and ends in step 4 when the signal stabilizes. Its beneficial effect is that it provides an optimal reaction environment for DNA hybridization and protein binding, ensuring the stability and reproducibility of binding kinetics. Simultaneously, the added surfactant and optimized salt concentration combination effectively suppress the non-specific deposition of common impurities in complex biological samples on the sensor surface, thereby minimizing background signal and significantly improving the signal-to-noise ratio and detection sensitivity.

[0047] In one possible implementation, the detection method of the present invention serves as a universal platform, flexibly applicable to the detection of multiple different hepatobiliary disease-related methylation biomarkers. For example, in addition to the RASSF1A gene detailed in the examples, this method is also suitable for detecting specific methylation sites in the promoter regions of the SFRP1, APC, or P16 genes. For each new site, the only technical feature that needs to be changed is the nucleotide sequence of the DNA capture probe. This sequence must be redesigned to ensure complete complementarity with a unique, CpG-free, unmethylated recognition region downstream of the target methylation site. For example, for a specific site in the SFRP1 gene, a corresponding specific capture probe needs to be designed and synthesized.

[0048] However, all other core steps and conditions of the method remained unchanged. These included the cleaning and activation standards for the gold microarray, the immobilization process and concentration of thiol-modified probes, the coupling method and dosage of the MBD2 methylation-binding domain protein, the composition of the blocking buffer, the extraction and fragment enrichment process of circulating cell-free DNA, the temperature and time of thermal denaturation, the flow rate and time control during hybridization and recognition, the formulation of the running buffer, the signal analysis method, and the principles for determining the decision threshold.

[0049] This invention provides a highly standardized and modular detection platform. Once a mature interface preparation and detection process is established, expansion to new detection targets only requires changing the probe sequence, significantly saving time and cost in method development. This highlights that this invention is not only innovative in solving the problem of detecting specific methylation sites, but also provides a powerful and universal technical solution for the entire field of epigenetic biomarker detection.

[0050] Example The following examples illustrate the implementation process of this method by taking the detection of the methylation status of specific CpG island sites in the promoter region of the RASSF1A gene, which is associated with the early occurrence of hepatocellular carcinoma.

[0051] Preparation of methylation-sensitive trapping interfaces; First, the core component of the surface plasmon resonance sensor—the methylation-sensitive trapping interface—is fabricated. This embodiment uses a surface plasmon resonance spectrometer equipped with a flow cell and a temperature control system, and its sensor chip is a chip with a 50-nanometer-thick gold film deposited on a glass substrate.

[0052] The first step is the cleaning and activation of the gold film surface. The new gold film chip is sequentially ultrasonically cleaned in acetone, ethanol, and ultrapure water for 10 minutes each, then dried with nitrogen. Subsequently, the chip is placed in a UV ozone cleaner for 15 minutes to thoroughly remove organic contaminants and activate the gold surface, improving its hydrophilicity and the efficiency of subsequent molecular fixation.

[0053] The second step involves designing and immobilizing the DNA capture probe. A 25-nucleotide unmethylated recognition region sequence is designed downstream of the target methylated CpG site in the RASSF1A gene promoter region (e.g., the xth CpG dinucleotide upstream of the transcription start site). This region itself does not contain a CpG site and its sequence is: 5'-ATCGTAGCTAGGATCTACGATCAGAT-3'. Based on this, a fully complementary capture probe sequence is designed: 5'-ATCTGATCGTAGATCCTAGCTACGAT-3'. A thiol group (-SH) is modified at the 3' end of this capture probe, and a heterobifunctional crosslinking agent—succinimidyl-4-(N-maleimidemethyl)cyclohexane-1-carboxylic acid ester—is covalently linked to the nucleotide immediately adjacent to the thiol group via a carbon chain linker. The maleimide end of this crosslinking agent pre-reacts with the thiol group on the probe to form a stable thioether bond, while the N-hydroxysuccinimidyl ester end remains activated for subsequent amino reactions with the protein.

[0054] The cleaned chip was immersed in a 1.0 µM solution of the aforementioned thiol-modified capture probe (dissolved in 10 mM phosphate buffer, pH 7.4, containing 1.0 M NaCl) and incubated at 25°C in the dark for 14 hours. During this process, the thiol groups at the probe tips formed strong gold-sulfur covalent bonds with gold atoms, causing the probe to self-assemble and fix onto the gold film surface in a near-vertical orientation. After incubation, the chip surface was rinsed for 5 minutes with a buffer containing 10 mM dithiothreitol to reduce and remove probe dimers or oligomers non-specifically adsorbed on the surface via disulfide bonds. The chip was then thoroughly rinsed with ultrapure water and dried under nitrogen. This step ensured that the capture probes were arranged in a high-density, monolayer-like orderly manner on the sensor surface.

[0055] The third step involves coupling and surface blocking of the methylation-binding domain protein. In this embodiment, the methylation CpG-binding domain of the recombinant human MBD2 protein was selected as the methylation state recognition element. This domain consists of approximately 70 amino acids and can specifically bind to methylated CpG sites in double-stranded DNA, while having extremely low affinity for unmethylated CpG.

[0056] The chip immobilized with the capture probe was loaded into the flow cell of a surface plasmon resonance (SPR) spectrometer. A stable baseline was established by first introducing run buffer (25 mM Tris-HCl, pH 7.4, 150 mM NaCl, 10 mM MgCl2, 0.02% v / v Tween-20) at a constant flow rate of 20 µL / min. Then, the flow was switched to a solution containing 100 µg / mL MBD2 methylated CpG binding domain protein (dissolved in coupling buffer: 10 mM sodium phosphate, pH 7.2), and introduced at the same flow rate for 15 minutes. During this process, the primary amino groups on the protein surface (such as the ε-amino group of lysine residues) undergo a highly efficient nucleophilic substitution reaction with the activated N-hydroxysuccinimide ester at the end of the capture probe, forming a stable amide bond, thereby covalently and directionally immobilizing the protein near the probe. The resonance angle signal, monitored in real-time, increased significantly during protein injection and plateaued at the end of the flow, indicating that the coupling reaction tended to saturate.

[0057] Immediately afterwards, blocking buffer (based on run buffer, with added 1% w / v bovine serum albumin and 0.1 µM random sequence 20-mer single-stranded DNA) was introduced at a flow rate of 30 µL / min for 40 minutes. This step is crucial, as it aims to saturate the gold membrane surface and potentially unreacted active sites with inert proteins and irrelevant nucleic acid molecules, thereby minimizing non-specific adsorption of non-target components in the sample during subsequent detection and ensuring the specificity of the detection signal. After blocking, the sample was rinsed again with run buffer until the baseline stabilized. At this point, the methylation-sensitive capture interface was prepared. The capture probe on this interface is responsible for "fishing out" specific sequences of single-stranded DNA from complex samples, while the adjacent MBD2 protein acts as a "detector," specifically identifying the methylation status of predetermined sites on the captured DNA.

[0058] Sample pretreatment and target DNA acquisition; This embodiment simulates a clinical testing scenario, using plasma from healthy individuals containing a known proportion of methylated RASSF1A DNA fragments as a simulated sample.

[0059] Step 1: Extraction of circulating cell-free DNA. Take 2 mL of simulated plasma sample and mix thoroughly with 6 mL of lysis buffer containing 4 M guanidine isothiocyanate and 1% sodium dodecyl sarcosinate. Incubate the mixture in a 60°C water bath for 15 minutes to completely lyse the viral capsid and cell membrane remnants, releasing circulating cell-free DNA. After incubation, add a pre-mixed suspension of silica-modified magnetic beads (approximately 0.7 µm in diameter) to the lysis buffer and gently invert at room temperature for 15 minutes. Under high salt and acidic pH conditions, the phosphate backbone of the DNA binds tightly to the silanol groups on the silica surface through salt bridges and hydrogen bonds, thus adsorbing onto the magnetic beads. Subsequently, place the container on a magnetic rack and let it stand for 1 minute to allow the magnetic beads to aggregate. Carefully aspirate the supernatant containing impurities such as proteins and lipids. Keeping the container on the magnetic rack, wash the magnetic beads twice with 500 µL of freshly prepared 70% ethanol solution, thoroughly discarding the ethanol after each wash. Open the tube cap and allow the magnetic beads to dry at room temperature for 5 minutes to ensure complete evaporation of residual ethanol and avoid affecting subsequent elution efficiency. Finally, resuspend the dried magnetic beads in 80 µL of preheated low-salt elution buffer (10 mM Tris-HCl, pH 8.5) and incubate at 55°C for 5 minutes. Under these conditions, the binding force between DNA and silica weakens, and the beads redissolve in the solution. Place the tube back on the magnetic rack and carefully aspirate the supernatant containing purified circulating free DNA into a new centrifuge tube.

[0060] The second step is target fragment enrichment. Since circulating cell-free DNA primarily originates from the regular degradation of nucleosomes in apoptotic cells, its fragment size peaks at ~167 bp (monosomes). To enrich this specific size of target fragment and improve the efficiency of subsequent hybridization capture, a magnetic bead-based fragment selection technique is used. 80 µL of extracted DNA solution is mixed with an equal volume of fragment selection magnetic bead binding buffer, and then a certain amount of fragment selection magnetic beads (whose surface polymers have the best affinity for 150-200 bp DNA fragments) is added. After incubating at room temperature for 10 minutes, the mixture is placed on a magnetic rack. The first collected supernatant (S1) mainly consists of fragments smaller than 150 bp. After discarding S1, fresh elution buffer is added to the tube, the magnetic beads are gently resuspended, and magnetic separation is performed again. The supernatant collected this time (S2) is rich in DNA fragments of 150-200 bp. The DNA in S2 is concentrated by ethanol precipitation, and finally the DNA precipitate is resuspended in 25 µL of TE buffer.

[0061] The third step is DNA single-stranding. The enriched DNA solution is placed in a PCR instrument and heated at 95°C for 5 minutes to completely denature and dissociate all double-stranded DNA into single-stranded DNA. Immediately after heating, the sample tubes are transferred to ice to cool and stand for 2 minutes to prevent annealing. At this point, single-stranded DNA samples are obtained and can be directly used for testing.

[0062] Real-time identification and detection of hybridization capture and methylation status; Install the sensor chip with the prepared capture interface into the instrument, and run the buffer solution continuously over the sensor surface at a constant flow rate of 20 µL / min until a stable baseline with fluctuations of less than 0.1 arcseconds is obtained for more than 5 minutes.

[0063] Step 1: Hybridization and Capture. Take 15 µL of single-stranded DNA sample and inject it into the flow cell at a flow rate of 10 µL / min for 1.5 minutes. As the sample flows over the sensor surface, single-stranded DNA containing the RASSF1A target sequence, which is perfectly complementary to the capture probe (sequence: ATCTGATCGTAGATCCTAGCTACGAT), is specifically captured and hybridized to the sensor surface through base pairing, forming a local double-stranded structure. This binding event leads to an increase in sensor surface mass and a change in refractive index, reflected in a real-time increase in the resonance angle signal. After sample injection, immediately switch back to the running buffer and continue rinsing at a flow rate of 20 µL / min for 10 minutes to remove unbound or weakly bound non-specific DNA. At the end of rinsing, the signal stabilizes at a new plateau value, denoted as R1, which quantitatively reflects the total amount of target DNA successfully captured and hybridized.

[0064] The second step is methylation state-specific recognition. With the running buffer continuously flowing, without any additional reagents, the MBD2 methylated CpG-binding domain protein, previously immobilized near the capture probe, begins to function. If a specific RASSF1A CpG site upstream of the capture probe binding site on the captured DNA target strand is methylated (i.e., 5-methylcytosine), the MBD2 protein domain will bind specifically with high affinity to it. This binding event introduces additional mass to the sensor surface, resulting in a second significant increase in the resonance angle signal. A second round of rinsing with running buffer is continued (approximately 5-10 minutes) until the signal reaches a second stable plateau, denoted as R2. The real-time sensor plot clearly shows the two phases of signal growth: the first plateau corresponds to the amount of DNA captured by hybridization, while the increase in the second plateau is specifically attributed to the methylation binding event.

[0065] The third step is sensor interface regeneration (optional but recommended). To facilitate repeated testing of the same sample or continuous testing of multiple samples, the sensor interface can be regenerated. Inject 50 mM glycine-HCl buffer at pH 2.0 at a flow rate of 40 µL / min for 90 seconds. This acidic condition effectively disrupts the specific binding between the MBD2 protein and methylated cytosine, which is formed by hydrogen bonds and van der Waals forces, causing it to dissociate. Simultaneously, because gold-sulfur bonds and amide bonds are very stable under acidic conditions, the capture probe and the protein itself remain firmly attached to the sensor. After regeneration, rinse with running buffer until the signal recovers to near the initial baseline level, and the interface can be reused.

[0066] Signal analysis and result determination; Analyzing the obtained real-time sensor images is crucial for determining the methylation state.

[0067] The first step is to calculate the increment of the methylation-specific response value. Two stable plateau values, R1 and R2, are precisely read from the sensor plot. The difference between the two is then calculated. ; this The value represents the increment of the methylation-specific response value, which originates directly and specifically from the binding of the MBD2 protein to the methylated CpG site. Theoretically, for completely unmethylated target DNA, ΔR should be close to zero; while for methylated target DNA, It will show a significant positive value.

[0068] The second step is to determine the judgment threshold. The absolute value is affected by various factors such as target DNA concentration and hybridization efficiency, therefore an objective threshold needs to be set to distinguish between "methylated" and "unmethylated" signals. In this embodiment, this threshold is determined by establishing a standard curve.

[0069] Synthetic standards: A target DNA long chain that is completely complementary to the capture probe is synthesized, with its sequence containing a downstream complementary region and an upstream region containing the target CpG site. Fully methylated standards (both Cs at the target CpG site are 5-mC) and fully unmethylated standards (the Cs at the target CpG site are not modified) of this sequence are synthesized separately.

[0070] Gradient concentration test: The two standards were diluted to four concentration points: 1 pM, 10 pM, 100 pM, and 1 nM. For each standard at each concentration point, the experiment was independently repeated three times according to the complete "interface preparation-sample processing-detection" process described above.

[0071] Data analysis and threshold calculation: Calculate the average ΔR of three replicate experiments for the completely unmethylated standard at each concentration point. ) and standard deviation ( Since unmethylated DNA should theoretically not bind to MBD2 protein, the small ΔR values ​​actually measured may originate from extremely weak nonspecific adsorption or instrument noise. (Taking all concentration points...) The maximum value (corresponding to the highest concentration of 1 nM) is calculated as follows: ; Based on the experimental data of this embodiment, the calculated decision threshold is 1.2 arcseconds. This threshold has a statistical confidence level of 99.7% (based on the normal distribution assumption) and is used to distinguish specific methylation signals from background noise / non-specific signals.

[0072] The third step is sample determination. This involves calculating the results after testing the samples to be tested. Compare with the decision threshold (1.2 arcseconds): like If the time is ≥1.2 arcseconds, it is determined that the target CpG site of the RASSF1A gene is methylated in the tested circulating cell-free DNA sample.

[0073] like If the time is less than 1.2 arcseconds, it is determined that no methylation has occurred or the methylation level is below the method detection limit.

[0074] To verify the effectiveness of this method, the following experiment was designed for comparison.

[0075] Experimental design: Three groups of simulated plasma samples were prepared, with three replicates for each group.

[0076] Sample group A: 0.1% molar proportion of full-length methylated RASSF1A fragment (simulating trace methylation signals in early lesions) was added to the plasma of healthy individuals.

[0077] Sample group B: 100% molar proportion of unmethylated RASSF1A fragment was added to the plasma of healthy individuals.

[0078] Sample group C: Blank plasma containing only background circulating cell-free DNA from healthy individuals.

[0079] The following three methods were used for detection: The method of this invention: as described above, uses a complete methylation-sensitive capture interface and performs fragment enrichment and blocking steps.

[0080] Comparative Example 1 (Gold Standard Method): Methylation-specific quantitative PCR was performed after bisulfite treatment. Specific steps: Extracted circulating cell-free DNA was treated with a commercially available bisulfite transformation kit. Then, real-time quantitative PCR was performed on the transformed RASSF1A sequence using both methylation-specific and non-methylation-specific primer / probe sets. The methylation ratio was calculated by comparing Ct values.

[0081] Comparative Example 2 (Simplified SPR Method): An SPR sensor with only the MBD2 protein (without a sequence-specific capture probe) immobilized on its surface was used to directly detect single-stranded DNA samples that had not undergone fragment enrichment. This method attempts to directly capture and recognize methylated DNA through protein capture.

[0082] The test results are recorded in the table below: Results analysis: Sensitivity and Specificity: The method of this invention achieved a 3 / 3 detection rate in sample group A, demonstrating its high sensitivity to trace (0.1%) methylated targets. In sample groups B and C, the detection rate was 0 / 3, showing extremely high sequence specificity and methylation state specificity, effectively avoiding false positives. Comparative Example 1 (gold standard) suffered severe degradation of the already trace target DNA due to bisulfite treatment, resulting in a weak signal detected only in one replicate, significantly reducing sensitivity. Comparative Example 2 completely failed to identify the target signal from the background.

[0083] Detection efficiency: The method of this invention can complete the entire process from sample processing to obtaining results in approximately 85 minutes, with most of the time spent on automated fluid control and monitoring. Comparative Example 1 took more than 4 hours and involved multiple manual operation steps, resulting in low efficiency.

[0084] Advantages Summary: This invention, through its dual-functional interface design of "sequence capture + methylation recognition," eliminates the destructive bisulfite treatment step, maximizing the preservation of target DNA integrity; it enhances target concentration through fragment enrichment; and it reduces non-specific adsorption through rigorous blocking. The synergistic effect of these technical features solves the challenge of directly, rapidly, and sensitively detecting specific methylation sites in complex biological sample environments.

[0085] It should be noted that this method has broad applicability. For different hepatobiliary disease-related methylation biomarkers, only the sequence of the DNA capture probe needs to be changed. For example, for specific methylation sites in the SFRP1, APC, or P16 genes, only a capture probe complementary to a specific unmethylated region downstream of the target site needs to be designed. The preparation process (gold-sulfur bond immobilization, protein cross-linking, blocking), sample pretreatment process (magnetic bead extraction, fragment enrichment, thermal denaturation), detection process (hybridization, protein recognition, regeneration), and signal analysis principles (calculation of ΔR, comparison with threshold) remain completely consistent, demonstrating the versatility and stability of this method platform.

[0086] This invention encompasses any substitutions, modifications, equivalent methods, and solutions made within the spirit and scope of this invention. To provide the public with a thorough understanding of this invention, specific details are described in detail in the following preferred embodiments; however, those skilled in the art will fully understand the invention even without these details. Furthermore, to avoid unnecessary misunderstanding of the essence of this invention, well-known methods, processes, procedures, components, and circuits are not described in detail.

[0087] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A plasma resonance detection method for liver and gallbladder-specific methylation sites, characterized in that, Includes the following steps: Step 1: Prepare the methylation-sensitive capture interface of the surface plasmon resonance sensor; the preparation process includes immobilizing the DNA capture probe on the gold film surface with thiol groups, and then covalently coupling the methylation binding domain protein to the DNA capture probe with a heterobifunctional crosslinking agent; Step 2: Obtain and preprocess the blood sample to be tested to obtain a single-stranded DNA sample to be tested; The pretreatment process includes extracting circulating cell-free DNA from plasma, screening and enriching the circulating cell-free DNA for fragments, and performing heat denaturation treatment on the enriched DNA. Step 3: The single-stranded DNA sample to be tested is passed into the surface plasmon resonance sensor for hybridization capture and methylation state recognition; the hybridization capture is achieved by the complementary base pairing of the DNA capture probe with the target DNA; the methylation state recognition is achieved by the specific binding of the methylation binding domain protein to the methylated cytosine site on the target DNA; Step 4: Analyze the real-time signal of surface plasmon resonance to determine the methylation state of the target site; the analysis process includes obtaining the first stable signal value R1 after hybridization capture, obtaining the second stable signal value R2 after the methylation binding event occurs, calculating the response value increment ΔR = R2 - R1, and comparing the response value increment with a preset determination threshold.

2. The plasma resonance detection method for liver and gallbladder-specific methylation sites according to claim 1, characterized in that: In step 1, the sequence design of the thiol-modified DNA capture probe satisfies the following conditions: The sequence of the DNA capture probe is completely complementary to the downstream unmethylated recognition region of the genomic region where the liver and gallbladder-specific methylation site to be tested is located; The DNA capture probe is 20 to 30 nucleotides in length; The DNA capture probe is modified with a thiol group at its 3' or 5' end, and a heterobifunctional cross-linking agent is attached to the nucleotide adjacent to the thiol group. One end of the heterobifunctional crosslinking agent is used to form a gold-sulfur bond with the thiol group to fix it on the gold film surface, and the other end of the heterobifunctional crosslinking agent is used to form a covalent link with the amino group of the methylation binding domain protein. The specific process of immobilizing the DNA capture probe on the gold membrane surface includes: The cleaned and activated surface plasmon resonance sensor chip was immersed in the DNA capture probe solution with a concentration of 0.5 μmol / L to 2 μmol / L and incubated at 25 degrees Celsius for 12 to 16 hours. After incubation, the surface of the sensor chip is thoroughly rinsed with a buffer solution containing dithiothreitol and then with pure water to remove probe molecules that are nonspecifically adsorbed through disulfide bonds. The methylated binding domain protein is a methylated CpG binding domain protein domain, which is derived from the MBD2 protein. The specific process of covalently coupling the methylation-binding domain protein to the DNA capture probe includes: The sensor chip with the DNA capture probe fixed thereon was placed in the reaction cell of the surface plasmon resonance spectrometer. A solution of the methylation-binding domain protein with a concentration of 50 μg / mL to 200 μg / mL was introduced at a flow rate of 10 μL / min to 30 μL / min for 10 to 20 minutes. Through the heterogeneous bifunctional crosslinking agent, the amino groups of the methylated binding domain protein undergo a covalent coupling reaction with the DNA capture probe, and the surface plasmon resonance angle response signal monitored in real time rises and reaches a plateau; A blocking buffer containing 1% bovine serum albumin and 0.1 μmol / L random sequence single-stranded DNA was introduced for 30 to 60 minutes to block non-specific binding sites on the sensor surface.

3. The plasma resonance detection method for liver and gallbladder-specific methylation sites according to claim 2, characterized in that: In step 2, the specific process of extracting circulating cell-free DNA from plasma includes: Mix 1 to 5 ml of plasma with 3 times the volume of lysis buffer containing guanidine isothiocyanate and a surfactant, and incubate the mixture at 60 degrees Celsius for 15 minutes. Add silica-modified magnetic beads with a diameter of 0.5 to 1 micrometer to the lysis mixture and incubate at room temperature for 15 minutes at a salt concentration of 1.0 to 2.0 mol / L and a pH of 4.5 to 5.5 to allow DNA to adsorb onto the surface of the magnetic beads. The magnetic beads were separated using a magnetic rack, and the supernatant was discarded. The magnetic beads were washed twice with a 70% volume fraction ethanol solution, using 500 μL of ethanol solution each time. After vortexing and mixing, the ethanol was removed by magnetic separation. Open the tube cap and allow the magnetic beads to dry at room temperature for 3 to 5 minutes to completely remove residual ethanol; Resuspend the magnetic beads in 50 to 100 μL of low-salt buffer or molecular biology grade pure water, incubate at 55°C for 5 minutes, then place the magnetic beads on a magnetic rack and collect the supernatant containing circulating cell-free DNA.

4. The plasma resonance detection method for liver and gallbladder-specific methylation sites according to claim 3, characterized in that: In step 2, the specific process of fragment screening and enrichment of the circulating cell-free DNA is as follows: A fragment screening kit based on magnetic beads is used, wherein the surface of the magnetic beads is modified with polymers that have differential affinity for DNA fragments of different lengths; The extracted circulating free DNA solution was mixed with the fragment screening magnetic beads at a volume ratio of 1:1 and incubated at room temperature for 10 minutes. Place the mixture on a magnetic rack and let it stand for 1 minute. Carefully aspirate the supernatant, which contains DNA fragments with a length of less than 150 base pairs. Add elution buffer to the remaining solution containing magnetic beads, vortex to mix, and place it on the magnetic rack again to collect the supernatant. The supernatant contains a target DNA fragment with a length of 150 to 200 base pairs. The target DNA fragment was concentrated using ethanol precipitation, and the DNA precipitate was resuspended in 20 to 30 μL of elution buffer.

5. The plasma resonance detection method for liver and gallbladder-specific methylation sites according to claim 4, characterized in that: In step 3, the specific process of hybridization capture and methylation state recognition includes: The sensor chip prepared in step 1 was installed in a surface plasmon resonance spectrometer. The sensor surface was rinsed with a running buffer at a constant flow rate of 20 μL per minute until a stable baseline signal with fluctuations of less than 0.1 arcseconds was obtained for 5 minutes. Inject 10 to 50 μL of the single-stranded DNA sample obtained in step 2 into the reaction chamber at a flow rate of 10 μL per minute, with a sample inlet time of 1 to 5 minutes. After the sample is introduced, immediately switch to the running buffer and continue rinsing the sensor surface at the same flow rate for 5 to 10 minutes to remove non-specifically bound DNA. At this time, the monitored signal response value stabilizes at the first stable value. Under the continuous flow of the running buffer, the methylation binding domain protein pre-fixed on the sensor surface specifically binds to the methylated CpG sites on the successfully hybridized DNA target strand. This binding process triggers a second rise in the surface plasmon resonance angle response signal. Continue flushing with the running buffer until the signal reaches the second stable plateau, obtaining the second stable value.

6. The plasma resonance detection method for liver and gallbladder-specific methylation sites according to claim 5, characterized in that: In step 4, the specific process of analyzing the real-time signal of surface plasmon resonance includes: From the real-time combined sensor image obtained in step 3, extract the first stable value, denoted as R1; extract the second stable value, denoted as R2; Calculate the methylation-specific response value increment ΔR, where ΔR = R2 - R1; The preset judgment threshold is obtained through the standard curve method, and the process of establishing the standard curve method is as follows: A target DNA sequence that is completely complementary to the DNA capture probe sequence is synthesized, wherein the target DNA sequence contains the downstream unmethylated recognition region and the upstream methylated CpG site to be tested; Prepare fully methylated and fully unmethylated standards for the target DNA sequence, wherein in the fully methylated standard, both cytosines at the CpG site to be tested are replaced by 5-methylcytosine; Steps 1 to 3 were performed independently and repeatedly using the fully methylated standard and the fully unmethylated standard diluted with a concentration gradient. For each standard at each concentration point, calculate the mean ΔR and standard deviation of at least three repeated experiments; The judgment threshold is the maximum value of the average ΔR obtained at all test concentrations of the fully unmethylated standard, plus three times the standard deviation corresponding to the concentration point of the maximum value.

7. The plasma resonance detection method for liver and gallbladder-specific methylation sites according to claim 6, characterized in that: The method further includes simultaneously injecting an internal reference capture probe competition sequence during the hybridization capture process in step 3, for standardizing and correcting the hybridization efficiency; The internal control capture probe competing sequence is a single-stranded DNA segment complementary to the middle portion of the DNA capture probe sequence, wherein the complementary portion is 8 to 12 nucleotides in length. The internal control capture probe competition sequence is mixed with the single-stranded DNA sample to be tested and then co-injected. The injection concentration of the internal control capture probe competition sequence is fixed at 1 nanomolar per liter. In the signal analysis of step 4, the ratio of the theoretical response value to the actual response value of the sensor to the known concentration of the internal reference capture probe competitive sequence is calculated at the end of the hybridization capture stage, i.e., when R1 is obtained, and is used as the hybridization efficiency correction factor for this detection. The calculated ΔR value is multiplied by the hybridization efficiency correction factor to obtain the corrected methylation-specific response value increment, which is then compared with the determination threshold.

8. The plasma resonance detection method for liver and gallbladder-specific methylation sites according to claim 5, characterized in that: The method further includes a step of regenerating the methylation-sensitive capture interface of the surface plasmon resonance sensor after the methylation state identification step in step 3. The specific process of the regeneration treatment is as follows: A regeneration solution, which is a buffer solution containing 10 mmol / L to 50 mmol / L glycine and a pH of 1.5 to 2.5, is injected into the reaction tank at a flow rate of 30 μL to 50 μL per minute for 1 minute to 2 minutes. The regeneration solution can disrupt the specific binding between the methylation-binding domain protein and methylated cytosine, while not affecting the gold-sulfur bond between the DNA capture probe and the gold membrane surface, or the covalent connection between the DNA capture probe and the methylation-binding domain protein. After the regeneration solution is injected, the running buffer is continued to be introduced at the same flow rate for 5 to 10 minutes until the surface plasmon resonance angle response signal recovers to a baseline level similar to that before the start of step 3. The regeneration process enables the same methylation-sensitive capture interface to be used for the detection of multiple consecutive test samples.

9. The plasma resonance detection method for liver and gallbladder-specific methylation sites according to claim 8, characterized in that: The running buffer used in the method comprises the following components: a Tris-HCl buffer system of 10 mmol / L to 50 mmol / L with a pH of 7.4; sodium chloride of 100 mmol / L to 150 mmol / L; magnesium chloride of 5 mmol / L to 10 mmol / L; and surfactant Tween-20 at a volume fraction of 0.01% to 0.05%. The running buffer is used continuously in the blocking step of step 1, the hybridization capture and recognition step of step 3, and the signal stabilization step of step 4, and is degassed and filtered through a 0.22-micron pore size filter membrane before use.

10. A method for detecting hepatobiliary-specific methylation sites according to any one of claims 1 to 9, characterized in that: The liver- and gallbladder-specific methylation sites to be tested are located in the promoter or enhancer regions of genes associated with malignant transformation of liver or bile duct cells. The genes include the SFRP1 gene, RASSF1A gene, APC gene, or P16 gene; For each different methylation site to be tested, a specific DNA capture probe complementary to a specific downstream sequence of that site needs to be designed. However, the immobilization and coupling methods in step 1, the sample pretreatment methods in step 2, the hybridization and recognition process in step 3, and the signal analysis principles in step 4 remain unchanged.