Characterization of the epigenetic landscape in complex fluids

Abstract

This disclosure relates to methods of phase separating fragmented DNA in a complex fluid sample (such as a complex biological sample, without the need for substantial preparation or purification of that sample). Such methods involve obtaining a complex fluid sample that contains fragmented DNA; subjecting the sample to poly-cation molecule mediated condensation phase separation in the presence of a nucleic acid scaffold; substantially separating the resultant dilute phase from the resultant condensed phase; and characterizing fragmented DNA from each of the dilute phase and the condensed phase (after decondensing the condensed phase), with or without extraction. Also provided are methods that further characterize the fragmented DNA, including to calculate pseudo-accessibility scores, and / or to use the separated fragmented DNA to characterize the epigenetic landscape of the complex fluid sample.

Description

Filed: November 14, 2025 CHARACTERIZATION OF THE EPIGENETIC LANDSCAPE IN COMPLEX FLUIDSCROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims priority to and the benefit of the earlier filing of U.S. Provisional Application No. 63 / 720,690, filed on November 14, 2024, which is incorporated by reference herein in its entirety.INCORPORATION BY REFERENCE OF SEQUENCE LISTING

[0002] A computer readable text file, entitled “0046-6002PCT_SeqList.xml” created on or about November 13, 2025, with a file size of 4,096 bytes, contains the sequence listing for this application and is hereby incorporated by reference in its entirety.FIELD OF THE DISCLOSURE

[0003] The present disclosure relates generally to methods to differentiate or partition epigenetic modification(s) on DNA and / or histones or other DNA-binding proteins. More specifically, it relates to detecting, analyzing, and / or measuring epigenetic modification(s) of nucleosome proteins or DNA, directly in complex samples including biological fluid samples and other specimens containing fragmented DNA bound or unbound to proteins.BACKGROUND OF THE DISCLOSURE

[0004] There is currently no single method that can capture the entirety of the epigenetic landscape in specimens containing fragmented (or degraded) chromatin and DNA, such as fluid samples. This landscape is regulated and marked by DNA cytosine and histone modifications that cumulatively alter chromatin structure and control gene expression. Aberrant epigenetic changes are believed to be one of the first genomic alterations during disease initiation and have been shown to reveal clinically actionable changes in treatment response. Cell-free DNA (cfDNA) allows minimally invasive analysis of these epigenetic modifications, making liquid biopsy an attractive method to diagnose and monitor patients.

[0005] Analysis of epigenetic markers in circulation is currently restricted to three techniques: (1) base protection or conversion sequencing to profile DNA cytosine modifications, (2) immunocapture to measure histone modifications, and (3) statistical inference of these modifications from sequence features. Each current method has limitations including sample degradation, low capture rates, and an inability to be multiplexed. This is in part due to the high fragmentation of cfDNA, which survives complete degradation in the bloodstream by the protection of histone proteins forming a cell-free nucleosome (cf-nucleosome) which retains both DNA methylation and histone modifications.Filed: November 14, 2025 SUMMARY OF THE DISCLOSURE

[0006] Described herein is a polyamine-mediated phase separation sequencing method (referred to as “CHROMAPS” or, in some embodiments, “cfCHROMAPS”) useful to induce epigenetic contrast of cf-nucleosomes and cfDNA in body fluid or other complex samples. Polyamines have a high positive charge, causing them to interact with the negative phosphate backbone of DNA. Polyamines link neighboring DNA molecules together and form small polyamine-DNA particles that can be physically separated (e.g., by centrifugation or other means) into two phases: a dilute phase (supernatant) and condensed phase (pellet) (FIG. 1). Data described herein demonstrate that polyamine-induced phase separation is dependent upon the epigenetic status of cf-nucleosomes and cfDNA. Thus, active and repressive chromatin states can be differentially enriched in a label-free manner directly in patient fluid specimens. This is achieved by whole genome sequencing of the supernatant and pellet following polyamine-based phase separation. Comparing to the total cfDNA pool enables assignment of a “pseudo-accessibility” score to each cfDNA fragment across the genome. Utilizing this method, this report shows that nucleosomes in regulatory regions associated with active genes are enriched in the supernatant and regulatory regions associated with repressed genes are depleted from the supernatant. Additionally, CHROMAPS can broadly reconstruct the previously held chromatin architecture from cf-nucleosomes on a genome wide scale in bodily fluids, which enables recapitulation of cell- and tissue-of-origins epigenetic dynamics.

[0007] A first embodiment is a method of phase separating fragmented DNA and nucleosomes in a complex fluid sample, including: obtaining a complex fluid sample including fragmented DNA and nucleosomes; adding a capture scaffold; subjecting the complex fluid sample to polycation molecule mediated condensation phase separation in the presence of the capture scaffold (also referred to as a “phase separation scaffold; e.g., a DNA scaffold, nucleic acid scaffold, or solid support scaffold), to produce a dilute phase and a condensed phase; substantially separating the dilute phase from the condensed phase; and extracting fragmented DNA from each of the dilute phase and the condensed phase.

[0008] Another embodiment is a non-invasive system to reconstruct epigenetic landscape, chromatin features, and / or regulatory elements from DNA in a complex fluid, including: obtaining a complex fluid sample including fragmented DNA and nucleosomes; adding a scaffold; subjecting the complex fluid sample to poly-cation molecule mediated condensation phase separation in the presence of the scaffold, to produce a dilute phase and a condensed phase; substantially separating the dilute phase from the condensed phase; extracting fragmented DNA from each of the dilute phase and the condensed phase; and characterizing the fragmented DNA to reconstruct the epigenetic landscape, the chromatin features, and / or the regulatory elements from the DNA.Filed: November 14, 2025

[0009] Yet another embodiment is a method of detecting or diagnosing in a subject a disease or condition mediated by epigenetic modification of nucleosomes and DNA, the method including: obtaining a complex fluid sample including fragmented DNA and nucleosomes; adding a scaffold; subjecting the complex fluid sample to poly-cation molecule mediated condensation phase separation in the presence of the DNA scaffold, to produce a dilute phase and a condensed phase; substantially separating the dilute phase from the condensed phase; extracting fragmented DNA from each of the dilute phase and the condensed phase; and analyzing the fragmented DNA to identify characteristics of a target disease or condition.

[0010] In examples of the provided method embodiments, the fragmented DNA extracted from the dilute phase is enriched for active chromatin regions and fragmented DNA extracted from the condensed phase is enriched for repressive chromatin regions.

[0011] Also provided is a method for DNA analysis in a complex fluid, including: obtaining a complex fluid sample including fragmented genomic DNA; adding a DNA-capture scaffold to the complex fluid sample; subjecting the complex fluid sample to poly-cation molecule mediated phase separation in the presence of the DNA-capture scaffold, to produce a dilute phase and a condensed phase; substantially separating the dilute phase from the condensed phase, thereby separating the fragmented genomic DNA into dilute phase DNA and condensed phase DNA; and analyzing the dilute phase DNA and the condensed phase DNA, wherein the analyzing includes detecting and / or measuring at least one characteristic of each of the dilute phase DNA and the condensed phase DNA and generating a comparison of the at least one DNA characteristic between the phases. By way of example, such methods may further including calculating a pseudo-accessibility score at one or more genomic locations based on differential enrichment of DNA between the dilute phase and the condensed phase for DNA fragments at the one or more genomic locations.

[0012] Another embodiment is a method of phase separating fragmented DNA in a complex fluid sample, including: obtaining a complex fluid sample including fragmented DNA; adding a capture scaffold; subjecting the complex fluid sample to poly-cation molecule mediated phase separation in the presence of the scaffold, to produce a dilute phase and a condensed phase; substantially separating the dilute phase from the condensed phase; and extracting DNA from each of the dilute phase and the condensed phase.

[0013] Yet another embodiment is a minimally-invasive system to reconstruct epigenetic landscape, chromatin features, and / or regulatory elements from DNA in a complex fluid, including: obtaining a complex fluid sample including fragmented DNA; adding a capture scaffold; subjecting the complex fluid sample to poly-cation molecule mediated phase separation in the presence of the scaffold, to produce a dilute phase and a condensed phase; substantially separating the dilute phase from the condensed phase; extracting DNA from each of the dilute phase and / or the condensed phase; and characterizing the DNA toFiled: November 14, 2025 reconstruct the epigenetic landscape, the chromatin features, and / or the regulatory elements from the DNA.

[0014] Also described are methods of detecting, diagnosing, and / or molecularly characterizing a disease or condition in a subject, the method including: obtaining a complex fluid sample including fragmented DNA; adding a capture scaffold; subjecting the complex fluid sample to poly-cation molecule mediated condensation phase separation in the presence of the scaffold, to produce a dilute phase and a phase; substantially separating the dilute phase from the condensed phase; extracting DNA from the dilute phase and / or the condensed phase; and analyzing the DNA to identify characteristics of a target disease or condition.

[0015] In examples of the provided method and system embodiments, characterizing or analyzing the DNA includes performing fragmentomics analysis on DNA from the dilute phase, DNA from the condensed phase, or DNA from each of the dilute phase and the condensed phase. For instance, n the fragmentomics analysis includes analysis of one or more of: fragment length in the dilute phase, the condensed phase, or the dilute phase and condensed phase; ratio of fragment lengths in the dilute phase, the condensed phase, or the dilute phase and condensed phase; variance of fragment lengths in the dilute phase, the condensed phase, or the dilute phase and condensed phase: fragment location in the genome, or in different regions across chromosomes, the dilute phase, the condensed phase, or the dilute phase and condensed phase; fragment abundance in the dilute phase, the condensed phase, or the dilute phase and the condensed phase:, and end motif analysis of the fragments, such as determination of end locations within the genome, in the dilute phase, the condensed phase, or the dilute phase and condensed phase.

[0016] Yet another embodiment is a method to differentially enrich for epigenetic states in cell free DNA (cfDNA) present in a complex fluid sample, including: obtaining a complex fluid sample including cfDNA; subjecting the complex fluid sample to poly-cat ion-mediated phase separation in the presence of a capture scaffold, to produce a dilute supernatant phase and a condensed phase; substantially separating the dilute supernatant phase from the condensed phase; and optionally extracting cfDNA from each of the dilute supernatant phase and the condensed phase; wherein cfDNA from the dilute supernatant phase is enriched for active chromatin regions and cfDNA from the condensed phase is enriched for repressive chromatin regions.

[0017] In examples of any of the method or system embodiments, the cfDNA or fragmented DNA in each phase may be enriched for one or more characteristics of the genome.

[0018] In examples of any of the method or system embodiments, the cfDNA or fragmented DNA in one phase is enriched for active chromatin regions and fragmented DNA in the other phase is enriched for repressive chromatin regions.Filed: November 14, 2025

[0019] In examples of any of the method or system embodiments, the cfDNA or fragmented DNA extracted from the dilute phase is enriched for active chromatin regions, and cfDNA or fragmented DNA extracted from the condensed phase is enriched for repressive chromatin regions.

[0020] In examples of any of the method or system embodiments, the e poly-cation molecule used for condensation may include at least one of a polyamine, a positively charged peptide, a positively charged protein, or a positively charged protein domain. By way of example, the polyamine may include at least one of spermine, spermidine, or putrescine.

[0021] Examples of any of the method or system embodiments may further include quantifying DNA fragments from the dilute phase, from the condensed phase, or from both phases.

[0022] In examples of any of the method or system embodiments, the quantifying may include one or more of a sequencing-based method, a PCR-based method, a fluorescent-quantification based method, or a spectroscopy-based method.

[0023] Examples of any of the method or system embodiments may further include calculating a pseudo-accessibility score for cfDNA or DNA fragments from the dilute phase, from the condensed phase, or from both. By way of example, the pseudo-accessibility score is defined as differential enrichment of DNA at each genomic location between phases.

[0024] In examples of any of the method or system embodiments, the method is carried out with labeling any components in the complex fluid sample.

[0025] In examples of any of the method or system embodiments, the complex fluid sample may include cfDNA or fragmented DNA bound to one or more DNA binding proteins, cfDNA or fragmented DNA unbound by any DNA binding proteins, or both. For instance, the one or more DNA binding proteins can include: at least one histone; at least two different histones; at least two differentially modified histones; or at least one DNA binding protein that is not a histone.

[0026] In examples of any of the method or system embodiments, the cfDNA or fragmented DNA may include mammalian DNA, bird DNA, insect DNA, plant DNA, fungal DNA, or a mixture of two or more thereof.

[0027] In examples of any of the method or system embodiments, the cfDNA or fragmented DNA may include at least one of cell-free DNA (cfDNA), cell-free nucleosomes (cf-nucleosomes), fragmented chromatin, fragmented extra-chromosomal DNA, or fragmented DNA unbound by any DNA binding proteins.

[0028] Examples of any of the method or system embodiments may further include decondensing the condensed phase before extracting fragmented DNA from the condensed phase. For instance, decondensing the condensed phase may include at least one of heating the condensed phase, adding a chelator, or adding a high salt buffer and optionally, at least one of: the heating occurs at 30-90°C for at least 5 minutes; the chelator may includeFiled: November 14, 2025 ethylenediaminetetraacetic acid (EDTA), metachelate, egtazic acid (EGTA; ethylene glycol-bis(p-aminoethyl ether)-N,N,N',N'-tetraacetic acid), ethydronic acid (HEDP), diethylenetriaminepentaacetic acid (DTPA) nitrilotriacetic acid (NTA), iminodisuccinic acid (IDS), polyaspartic acid, S,S-ethylenediamine-N,N'-disuccinic acid (EDDS), methylglycinediacetic acid (MGDA), or L-Glutamic acid N,N-diacetic acid, tetrasodium salt (GLDA); or the high salt buffer may include at least 150 mM monovalent cation and / or at least 1 mM divalent cation.

[0029] In examples of any of the method or system embodiments, the capture scaffold may include: a nucleic acid or a solid surface (e.g., a bead, such as a magnetic bead) substantially non-reactive or reversibly reactive to DNA; or naturally occurring or synthetic DNA or RNA molecules. For instance, the scaffold may include one or more of: unbound DNA of at least 100 bases in length in linear form, circular form, or both; DNA of any length bound to a solid substrate in linear form, circular form, or both; unbound RNA of at least 100 bases in length; RNA of any length bound to a solid substrate; mono- or oligo-nucleosomes bound or unbound to a solid substrate; non-naturally occurring nucleic acids of at least 100 bases in length; non-naturally occurring nucleic acids of any length bound to a passivated or unpassivated solid substrate; solid surface substantially non-reactive or reversibly reactive to DNA, optionally coated with a passivating substance; and solid surface with or without bound nucleic acids.

[0030] In examples of any of the method or system embodiments, a solid surface is used and characterization or analysis of the separated DNA may include direct measurement of or amplification of sequences of DNA bound to the solid surface.

[0031] In examples of any of the method or system embodiments, the complex fluid sample may include naturally-occurring salt(s), and the method further may include diluting the sample prior to subjecting the complex fluid sample to poly-cation molecule mediated phase separation, to produce a diluted sample. For instance, the diluted sample may include no more than 150 millimolar monovalent and divalent cations, or at 25-75% concentration of the complex fluid sample before dilution.

[0032] In examples of any of the method or system embodiments, the complex fluid sample may include: a bodily fluid sample; a clinical sample; a laboratory sample; an environmental sample; an agricultural sample; an archaeological sample; or a forensic sample.

[0033] Examples of any of the method or system embodiments further include adding one or more contrast modulators before subjecting the complex fluid sample to poly-cation molecule mediated phase separation. For instance, in examples the one or more contrast modulators include: a histone-modification-specific binding molecule; a DNA binding molecule; a nucleosome binding molecule; achromatin binding molecule; a modified histone; or a complex of two or more proteins including at least one of these. Optionally, the histone-modification-Filed: November 14, 2025 specific binding molecule may include a histone modification binding antibody, a bromodomain protein, or a chromo-domain protein.

[0034] In examples of any of the method or system embodiments, the poly-cation molecule mediated phase separation may include: gravity-based separation of phases; or solid surfacebased separation of phases. Optionally, the gravity-based separation of phases includes centrifugal separation. In representative examples, the solid surface-based separation of phases may include bead capture, such as magnetic bead capture. Also contemplated are method or system embodiments involving solid surface-based separation of phases, wherein at least a portion of the capture scaffold is nucleic acid bound directly or indirectly to the solid surface. In various of these method or system embodiments, the nucleic acid is covalently bound to the solid surface.

[0035] Also contemplated are method and system embodiments that further include adding polyethylene glycol (PEG) or another crowding polymer or passivating agent to the complex fluid sample before subjecting the complex fluid sample to poly-cation molecule mediated phase separation.

[0036] Yet additional embodiments include any of the provided systems or methods, for use one or more in: health surveillance; disease surveillance; disease diagnosis; molecular subtyping; treatment stratification; treatment selection; clinical decision making; predicting treatment response; monitoring treatment response; genome characterization; or drug discovery or characterization.

[0037] Also provided herein are databases that include DNA fragment sequences or cfDNA sequences produced by sequencing some or all of the DNA phase separated into dilute and condensed phases, using one of the methods or systems taught herein. Such databases may include, in addition to primary sequence information, additional characterization of the sequences including but not limited to their abundance or relative abundance in one or the other phase, their position within a corresponding genome, or any of the other characterizations described herein.

[0038] An embodiment also provides a method for characterizing an epigenetic landscape in a complex fluid, essentially as described herein.

[0039] Kits for carrying out a method or system described herein are also provided, which kits include at least one of: a scaffold; a phase separation contrast modulator; a DNA condensation agent; or a fragmented DNA control sample.

[0040] Yet further there is provided herein a system to phase separate DNA from a complex biological or other complex fluid sample, the system including: a sample isolation device, which is adapted to isolate a biological sample from a subject; a separation device, which is adapted to subject the complex fluid sample to poly-cation molecule mediated condensation phase separation in the presence of a scaffold, to produce a dilute phase and a condensedFiled: November 14, 2025 phase; one or more DNA analysis devices, which is / are adapted to analyze and / or characterize DNA in the dilute and condensed phases, thereby obtaining one or more DNA information results; and an alignment device, which is adapted to align one or more of the DNA information results between the dilute and condensed phases in order to determine or provide a pseudo-accessibility score for one or more locations within a DNA genome based on the alignment result. In examples, at least one DNA analysis device of the system is a sequencing device. In such system embodiments, the complex biological or other complex fluid sample may include a substantially unpurified bodily fluid from a subject, such as a human or other mammalian subject. Optionally, the systems may further include an information delivery device capable of delivering to a receiver information about the results of the analysis. Where the system includes an information delivery device, the information may include one or more of: identity and / or relative or absolute quantity of DNA fragments mapping to a specified locus within a genome, proportional amount of any such locus that is found in the dilute and condensed phases from an analyzed sample, and fragmentomic information about DNA in the dilute and condensed phases.BRIEF DESCRIPTION OF THE DRAWINGS

[0041] FIG. 1. The CHROMAPS method, cf-nucleosomes are incubated with polyamine inducing phase separation. The phases are then physically separated (for instance, by centrifugation or binding to a solid surface, such as a bead). Whole genome sequencing (WGS) is then performed on DNA in each phase. The “pseudo-accessibility” score is defined herein as a differential enrichment of DNA between the supernatant and pellet. By way of example, the differential enrichment is calculated as>but it may be calculatedby any means that estimate DNA amount differences between the phases at each genomic location.

[0042] FIGs. 2A-2D. Epigenetic modifications determine phase behavior. FIG. 2A Mononucleosomes vs. bare DNA: Synthetic mononucleosomesand bare DNA were incubated with varying concentrations of polyamine then centrifuged. The gel-band intensity of the supernatant was quantified and normalized to the total input. FIG. 2B Methylated vs. Unmethylated bare DNA: Bare unmethylated DNA and synthetically methylated DNA were phase separated in isolated reactions and the supernatant fraction of DNA was measured by spectrophotometry then normalized to total input. FIG. 20 Epigenetically modified nucleosomes: Synthetic nucleosomes with various lysine tail modifications were phase separated in isolated reactions and the supernatant fraction was measured by gel-band intensity. Each modification type is normalized to its total input. FIG. 2D Data from FIG. 20 grouped by modification type (acetylation vs. methylation). Significance determined byFiled: November 14, 2025 Wilcoxon rank-sum test (* p<= 0.05, ** p<= 0.01, *“ p<=0.001, **** p<=0.0001). Error bars represent sample mean ± standard error across three independent replicates in each panel where shown.

[0043] FIGs.3A-3D. Dependence of DNA phase separation on ion and buffer conditions. FIG.3A Inhibition of DNA condensation to the pellet by EDTA can be rescued by MgCL. FIG. 3B Inhibition of phase separation in plasma can be attenuated by titration and an addition of Tris buffer to stabilize pH. FIG. 3C 55% dilution with pH 6.5 polyamine buffer yields optimal DNA phase separation in plasma. FIG. 3D DNA was phase separated using varying concentrations of polyamine [0 mM-5 mM] and the pellet was recovered under varying conditions. The addition of EDTA and heat treatment achieve recovery of condensed DNA > 90%. Error bars represent sample mean ± standard error across three independent replicates where shown.

[0044] FIGs. 4A-4F. Recovery of pelleted DNA from plasma and use of DNA filler. FIG. 4A DNA ladder was spiked into 0.25 ml of wildtype mouse plasma and phase separated with 1 mM polyamine dissolved in water. Pelleted DNA was resuspended and analyzed by gelcapillary electrophoresis before and after proteinase K digestion. FIG. 4B DNA ladder was spiked into 0.25 ml of wildtype mouse plasma and phase separated with 1 mM polyamine with or without either Bis-Tris pH 6.5 buffer or 55% plasma dilution. Pelleted DNA was recovered, purified following proteinase K digestion, and analyzed by gel-capillary electrophoresis. FIG.4C Low molecular weight DNA ladder (25 bp-766 bp) was phase separated and the supernatant analyzed by gel-electrophoresis. FIG. 4D Shown is the quantification of the gel assay in FIG. 40 run in triplicate and stratified by length (short [<100 bp], medium [150 bp-350 bp], long [500 bp-766 bp]). FIG. 4E Varying lengths of DNA: 150 bp, 300 bp, and 766 bp, were phase separated in isolated reactions and the supernatant quantified by fluorometry. FIG. 4F To phase separate endogenous cfDNA, 200 ng of a 766 bp section of the lambda genome was spiked in as DNA filler to 0.25 ml of mouse plasma. Pelleted DNA was analyzed by gel-capillary electrophoresis and PCR of housekeeping mouse genes (ACTB, PSAT1, B2M). Error bars represent sample mean ± standard error across three independent replicates where shown. Significance determined by Wilcoxon rank-sum test (* p<= 0.05, ** p<= 0.01, “* p<=0.001,Hitp<=0.0001).

[0045] FIG. 5. Graphic illustration of the CHROMAPS protocol; an exemplified description is provided beginning at paragraph

[0110] .

[0046] FIGs. 6A-6D. CHROMAPS of cf-nucleosomes in conditional cell culture media. FIG.6A MDA-MB-231 conditioned media containing cf-nucleosomes was collected for direct polyamine phase separation followed by whole genome sequencing. FIG. 6B The pseudoaccessibility of cf-nucleosomes across chromosome 2 displays a similar pattern to publicly available MDA-MB-231 ATAC-seq. FIG. 60 Pseudo-accessibility is increased near TSS across chromosome 2, similar to the ATAC-seq. FIG. 6D Pseudo-accessibility shows anFiled: November 14, 2025 increase at promoters and enhancers and a decrease at heterochromatic and repetitive elements. Each state is previously annotated by the ChromHMM model trained on publicly available ChlP-seq data.

[0047] FIGs. 7A-7C. Transcription factor binding site enrichment. (FOXA1, ESR1, and FOSL1). FIG. 7A Publicly available ATAC-seq data averaged over all binding sites of the listed transcription factors. FIG. 7B Supernatant (using the exemplary calculation log2(supe™) and pellet (using the exemplary calculation Zo.g2(^^)) enrichment at all binding sites of the listed transcription factors following phase separation of isolated mononucleosomes using the previously reported technique. In brief, nucleosomes are isolated by Mnase digestion, concentrated, and phase separated by polyamine in Tris NaCI buffer. The pellet was recovered utilizing optimum parameters shown in FIGs. 4A-4F. FIG. 70 Supernatant (using the exemplary calculation log2^suve™^ant^anc| pellet (using the exemplary calculation ^02(7^7)) enrichment at all binding sites of the listed transcription factors following use of CHROMAPS method on condition cell culture media cf-nucleosomes.

[0048] FIGs.8A-8C. CHROMAPS of endogenous cf-nucleosomes in human plasma. FIG. 8A Sequencing libraries of DNA recovered from the total input, and supernatant and pellet following phase separation of 0.5 ml healthy human plasma. FIG. 8B Average normalized enrichment of the supernatant, pellet, and the calculated pseudo-accessibility at TSSs across chromosome 2. FIG. 80 Average pseudo-accessibility across genome regions with different chromatin states as annotated by the ChromHMM model which was trained on lymphoblastic ChlP-seq data.

[0049] FIGs. 9A-9E: Clinical application of CHROMAPS to lung adenocarcinoma, hepatocellular carcinoma, and non-cancer control patients. CHROMAPS was performed with 0.5 ml of plasma from 60 non-cancer controls, 30 lung cancer, and 52 HCC patient draws. Shown is the mean pseudo-accessibility across the 200 most statistically significant ENCODE annotated promoters (FIG. 9A) or Vista Enhancers (FIG. 9B) ranked by significance following a Wilcoxon rank sum test across all patients. The distribution of all patients at select sites, promoters or enhancers is shown in (FIG. 9C) and (FIG. 9D), respectively. (FIG. 9E) Shown are the resulting leave-one-out cross validation receiving operating curves of logistic regression models predicting disease status in pairwise comparisons using either promoters or enhancers as follows: HCC vs. Control [solid] (Promoters AUC=0.712, Enhancers AUC=0.738), Lung cancer vs. Control [dashed] (Promoters AUC=0.792, Enhancers AUC=0.786), and HCC vs. Lung cancer [dotted] (Promoters AUC=0.686, Enhancers AUC=0.801).Filed: November 14, 2025

[0050] FIGs. 10A-10B. HCC pre- and post-treatment CHROMAPS profiles. (FIG. 10A) Pseudo-accessibility profiles over the top 200 most statistically significant promoters or enhancers following a Wilcoxon rank sum test between pre- and post-treatment HCC samples. (FIG. 10B) Pseudo-accessibility distributions between pre- and post-treatment HCC samples of representative promoters (BAFF and MYO1G) and enhancers (PBX1 and ZNF521). Lines connect corresponding pre- and post-draws. Significance determined by Wilcoxon rank sum test (* p<= 0.05, ** p<= 0.01 , *** p<=0.001 , p<=0.0001).

[0051] FIGs. 11A-11H. CHROMAPS fragmentomic approach. (FIG. 11 A) cfDNA fragment length distributions between the supernatant (solid) and pellet (dashed) across all clinical samples calculated from insert size metrics following 7x WGS. (FIG. 11 B) cfDNA fragment length distributions between disease states (HCC - solid, Lung cancer - dashed, Non-cancer Control - dash dot) calculated from insert size metrics following 7x WGS. (FIGs. 11 C, 11 D) The proportion of short (70-150 bp) fragments and long fragments (300-500 bp) between phases or disease states calculated where the total is taken to be the sum of the number of fragments between both phases. (FIGs. 11 E, 11 F) Proportion of short or long fragments present within each phase and compared across disease states. (FIGs. 11G, 11 H) The proportions of fragments within 10 bp bins (68 non-overlapping bins from 25 bp-705 bp) were calculated in each phase and used as feature sets for classification. Shown are the resulting leave-one-out cross validation receiving operating curves of logistic regression models predicting disease status using either the supernatant, pellet, or total bins as feature sets (HCC vs. Control: Supernatant AUC=0.808 [dashed], Pellet AUC=0.882 [solid], Total AUC=0.838 [dotted]. Lung Cancer vs. Control: Supernatant AUC=0.789 [dashed], Pellet AUC=0.768 [solid], Total AUC=0.671 [dotted]).

[0052] FIGs. 12A-12C: Bead-based polyamine-mediated phase separation. (FIG. 12A) Schematic of bead-based assay. (FIG. 12B) 150 bp DNA was phase separated over varying polyamine concentrations in solution with 1 pm carboxyl-coated magnetic beads. Polyamine buffer was supplemented with varying amounts of 8 kDa polyethylene glycol (PEG), and DNA in both the supernatant fraction and pellet fraction were measured by fluorometry and normalized to total input. Error bars represent sample mean ± standard error across two independent replicates. (FIG. 12C) Comparison of phase separation of 150 bp DNA with either bare beads or streptavidin beads conjugated with biotinylated dsDNA. Pellet recovery represents the fraction of DNA eluted from the beads after phase separation where the total possible elution is equal to the amount of DNA which was removed from the supernatant.

[0053] FIGs. 13A-13C: Beads covalently functionalized with phase separation dsDNA scaffold. (FIGs. 13A, 13B) DNA oligos with DBCO and Cy5 modifications were coupled to azide-coated magnetic beads. This was extended to longer DNA by an overhang ligation. Following conjugation, beads were washed three times and imaged at 633 nm excitation. (FIG.Filed: November 14, 2025 13C) Phase separation of DNA over varying polyamine concentrations using magnetic beads covalently coated with dsDNA. Supernatant and pellet fractions were measured by fluorometry and are normalized to total input.

[0054] FIGs. 14A-14C: Induction of epigenetic contrast with bead-based platform. (FIG. 14A) Synthetic nucleosomes with H3K4me3 and H3K9ac modifications were phase separated using PEGylated magnetic beads in isolated reactions and gel-band intensity was measured following electrophoresis of the supernatant fraction. Each modification type is normalized to its total input. Error bars represent sample mean ± standard error across two independent replicates. (FIG. 14B) 0.5 ml of conditioned cell culture media from MDA-MB-231 cells was collected at 80% confluency and various amounts of dsDNA coated magnetic beads were directly added with 1 mM polyamine to induce phase separation of cf-nucleosomes. Phase separated DNA was purified from the beads and measured by digital droplet PGR across 6 primer sets, 3 targeting active regions and 3 sets targeting repressed chromatin regions. Active and repressed regions were determined by publicly available H3K9ac, H3K4me3, H3K9me3, and H3K27me3 ChlP-seq data. The shown pseudo accessibility is calculated by log2(supernatant DNA copies / pellet DNA copies). (FIG. 14C) Mononucleosomes isolated from MDA-MB-231 cells were phase separated utilizing magnetic beads. The supernatant and recovered pellet were sequenced at 12X coverage. Shown is the pseudo-accessibility (log2[supernatant coverage / pellet coverage]) across chromosome 2.

[0055] FIGs. 15A-15B: Modulation of phase separation - blocking of polyamine induced phase separation by targeted antibody. (FIG. 15A) 167 bp free DNA [50 nM] or (FIG. 15B) reconstituted mononucleosomes [200 nM] were incubated with the indicated concentrations of anti-dsDNA antibody (clone 35I9 DNA, BSA- and azide-free). Following incubation and binding of the antibody, polyamine was added to induce phase separation at a final concentration of 1 mM. Both the supernatant and pellet were measured by band fluorescence following gel-electrophoresis and normalized to total input. Error bars represent sample mean ± standard deviation across three independent replicates.

[0056] FIG. 16: Cerebral Spinal Fluid CHROMAPS. Shown is the cfDNA fragment size distribution compared between the supernatant (dashed) and pellet (solid), and the pseudoaccessibility score across chromosome 2 following CHROMAPS of 0.5 ml of cerebral spinal fluid.REFERENCE TO SEQUENCE LISTING

[0057] The nucleic acid and / or amino acid sequences described herein are shown using standard letter abbreviations, as defined in 37 C.F.R. §1 .822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included in embodiments where it would be appropriate.Filed: November 14, 2025

[0058] In the Sequence Listing:

[0059] SEQ ID NO: 1 is a lambda genome forward primer: TATTGTTCCCAGAGTCGCCG

[0060] SEQ ID NO: 2 is a lambda genome reverse primer: TATGTGGTTTCCGTCGTCCGDETAILED DESCRIPTION

[0061] Described herein is a polyamine-mediated phase separation sequencing platform (CHROMAPS) to induce epigenetic contrast of cf-nucleosomes or cfDNA in body fluid or other complex fluid samples or samples that can be suspended in fluid. Polyamines have a high positive charge causing them to interact with the negative phosphate backbone of DNA. Polyamines link neighboring DNA molecules together and form small polyamine-DNA particles which can be physically separated (e.g., by centrifugation or binding to a solid surface, such as a bead) into two phases: a dilute phase (supernatant) and condensed phase (pellet) (FIG.1 ). Data described herein demonstrate that polyamine-induced phase separation is dependent upon the epigenetic status of cf-nucleosomes and cfDNA. Thus, active and repressive chromatin states can be differentially enriched in a label-free manner directly in patient fluid samples for the first time. This is achieved by whole genome sequencing of the supernatant and pellet following phase separation. Comparing to the total cfDNA pool enables assigning a “pseudo-accessibility” score to each cfDNA fragment across the genome. Utilizing this method, it is shown herein that nucleosomes in regulatory regions associated with active genes are enriched in the supernatant and regulatory regions associated with repressed genes are depleted from the supernatant. Additionally, CHROMAPS can broadly reconstruct the previously held chromatin architecture from cf-nucleosomes which allows us to potentially recapitulate the cell- and tissue-of-origins epigenetic dynamics.

[0062] Accessing disease states for clinical management relies on molecular exams of the tissues in many cases. Needle biopsies, which provide direct access to an internal organ, can be problematic due to excessive invasiveness, inability to capture disease heterogeneity, potential seeding for dissemination, and potential accompaniment of morbidity. To overcome the challenges associated with tissue biopsies, emerging liquid biopsy approaches have been developed with the goal of replacing invasive diagnostic or treatment stratification procedures [1-3].

[0063] Cell-free DNA (cfDNA) analysis is among the most widely studied liquid biopsy approaches in oncology. Genetic analysis of circulating cfDNA is challenging due to an underrepresentation of mutated targets compared to a high wild-type background. Within the past decade, the analysis of epigenetic features retained in cfDNA, including DNA methylation and histone modifications, has shown great promise thanks to the genome-wide spread of aberrant modifications [4-7], Epigenetic modifications regulate gene expression through the alteration of chromatin organization and accessibility. Aberrant epigenetic changes areFiled: November 14, 2025 believed to be one of the first genomic alterations during cancer initiation and have been shown to reveal clinically actionable changes in treatment response [6, 8-13].

[0064] Analyses of epigenetic markers in circulation currently revolve around three approaches: base protection sequencing to measure DNA methylation, immunocapture to measure histone modifications, and statistical inference of modifications from sequence features [4, 5, 14], Size distributions of cfDNA in plasma show that most nucleic acid fragments in circulation are less than 200 bp in length, with peaks at -150 bp indicating that cfDNA in circulation may be bound and protected from degradation as part of a nucleosome complex

[0011] , Indeed, several recent studies have shown that indirect computational analysis of nucleosome footprints and fragmentation of cfDNA in the blood may be valuable for tissue-of-origin decomposition and cancer detection [5, 6, 8, 11 , 15]. Furthermore, chromatin immunoprecipitation and sequencing (ChlP-seq) of plasma cell-free nucleosomes (cf-nucleosomes) demonstrated potential utilities in cancer detection and treatment monitoring [4, 16]. However, statistical methods cannot directly characterize the epigenome, and the capture efficiency of the immunoprecipitation methods is limited due to low levels of cf-nucleosomes in plasma [7],

[0065] In a cellular context, chromatin accessibility (ATAC-Seq) and chromosome conformation capture assays (3C-based methods), and Cleavage Under Targets and Release using Nuclease 90 (CUT&RUN) are powerful tools for the investigation of cell, tissue, and disease states. In body fluids, however, circulating cfDNA is intrinsically fragmented into short fragments, making it incompatible with chromatin accessibility or chromosome-capture domain techniques. Although there is potentially great clinical utility in noninvasively measuring these features, there is currently no method to reconstruct the epigenetic landscape from fluid samples.Chromatin Reconstruction Mediated by Phase Separation (CHROMAPS):

[0066] Described herein are methods that can reconstruct the chromatin landscape from circulating cf-nucleosomes and cfDNA in bodily fluids (and other complex fluids and samples), which may be referred to by the acronym CHROMAPS (Chromatin Reconstruction Mediated by Phase Separation). The method utilizes polyamine-mediated phase separation to induce differential epigenetic contrast of cf-nucleosomes and cfDNA. Polyamines have a high positive charge causing them to interact with the negative phosphate backbone of DNA. In a process analogous to oil separating in water, polyamines link neighboring DNA molecules together and form small polyamine-DNA droplets which can be physically separated by centrifugation into two phases: a dilute phase (supernatant) and condensed phase (pellet) (FIG. 1). Data described herein demonstrate that polyamine-induced phase separation is dependent upon the epigenetic status of nucleosomes and DNA. Recently, it was demonstrated that a singleFiled: November 14, 2025 nucleosome may encode chromatin structure by nature of their intrinsic electrostatic properties

[0017] , However, the technique utilized in that work is not capable of phase separating low concentration circulating chromatin within complex fluids, including complex biological fluids.

[0067] Described herein is the creation of an assay that is specifically developed to perform within patient fluid samples (and other complex fluids) with low abundance cf-nucleosomes and cfDNA. This method can be used to differentially enrich active and repressive chromatin states in a label-free manner directly in complex samples, such as patient blood, for the first time. This is achieved in provided embodiments, by whole genome sequencing of the supernatant and pellet following phase separation directly in the analyzed sample, exemplified by patient plasma. Comparing to the total cfDNA pool enables assignment of a “pseudoaccessibility” score to each cfDNA fragment across the genome. It is shown that nucleosomes in regulatory regions associated with active genes are enriched in the supernatant and regulatory regions associated with repressed genes are depleted from the supernatant. Compared to previous cell-free ChlP-seq methods, a unique advantage of the herein described phase separation method is its efficiency for an ultra-low concentration of native cf-nucleosomes. Furthermore, this method enables the reconstruction of the entire 3D chromatin landscape by measuring pseudo-accessibility in a single experiment in a cost-effective manner without multiple target capture antibodies in separate experiments using a limited blood volume. Additionally, this method has been applied across a multi-cancer clinical cohort of 30 lung adenocarcinoma, 52 hepatocellular carcinoma (HCC), and 60 non-cancer control patient blood samples. It is demonstrated to classify patients as control, lung cancer, or HCC with an average area under the receiver operating curve (AUC) of 0.82. Development of this CHROMAPS method is described here.Epigenetic dependence of DNA and nucleosome phase separation induced by polyamines.

[0068] CHROMAPS leverages the biophysical properties which govern polyamine-DNA interactions. Polyamines are naturally abundant linear polycationic alkylamines which are involved in various nucleic acid cellular processes such as DNA synthesis and transcription

[0018] . Due to their highly positive charge, polyamines interact with the negative phosphate backbone of DNA. In solution, both DNA and single nucleosomes (mononucleosomes) can be forced into a sharp phase transition once neutralized by polyamine. This results in alternating positive and negative charges along the double helix generating short-range attraction, thus, resulting in phase separation [19, 20]. This naturally occurs in the nuclei of cells to aid in organizing chromatin and thus has a dependence on epigenetic modifications

[0021] , Described herein is an assay to mimic this process outside of the cell, and apply it as a tool to analyze the circulating epigenetic landscape.Filed: November 14, 2025Cell-free nucleosome phase separation in blood.

[0069] Computational analyses of cfDNA and cf-nucleosome profiling using sequence features by Dr. Jay Shendure and Dr. Gavin Ha, have demonstrated the clinical utility of assessing the epigenome [5, 12], In addition, Dr. Ronen Sadeh, Dr. Sylvan Baca, and Dr. Efrat Shema have developed methods to target cf-nucleosome post-translational modifications directly [4, 7, 24], Each method has limitations, including high cost, sample degradation, low antibody capture efficiency, and the challenge of multiplexing.

[0070] The methods provided herein will push the boundaries of this growing field because it is efficient in inducing epigenetic contrast for low concentrations of cf-nucleosomes in bodily fluids thanks to the ability to capture all cf-nucleosomes and cfDNA in either condensed or diluted phases.

[0071] Three major challenges to developing an assay in bodily fluids are (1) inhibition of fluid contents (salts, biological molecules, and the like) and collection preservatives, (2) recovery of DNA in the pellet, and (3) low abundance of native cf-nucleosomes in unconcentrated biological fluids, such as naturally occurring biological specimens. Previous phase separation assays used to analyze synthetic DNA or purified nucleosomes at high concentration in simple buffer are not applicable for low concentration circulating chromatin within complex biological fluids. A protocol has been formulated to effectively phase separate low abundant, native cell-free nucleosomes and DNA in bodily fluids (and other complex fluid samples); embodiments of this protocol are described in detail herein.

[0072] Described herein are experiments that led to development of the CHROMAPS assay.The following provides an overview of embodiment of this assay; additional embodiments are described herein.

[0073] Induce cf-nucleosome condensation on a DNA scaffold: Samples, such as plasma or clinical fluid specimens (or other samples) are diluted with ultrapure water or a low salt buffer (e.g., of less than 100 mM monovalent cation), for instance to reach a physiological salt concentration of less than 70 mM (which can be empirically determined or estimated based on known, expected, or standardized parameters). Phase separation inducing buffer (e.g., 1 mM to 100 mM spermine or similar polycation or multivalent positively charged peptides / proteins / protein domains, in 10 mM Bis-Tris or equivalent at pH 5 to 8) is prepared and kept at room temperature for use to induce phase separation. A synthetic (nucleic acid) scaffold (optionally engineered with 5’ inverted dideoxy nucleotides) is added to the plasma. The nucleic acid scaffold can be naturally occurring or synthetic nucleic acid fragments (e.g., DNA or RNA) in the range of 0.15 - 15 kbps, mono or oligonucleosome arrays in a free form, or any of these conjugated (covalently or non-covalently) to a solid surface such as beads, or multivalent positively charged solid substrates. Optionally, phase separation can beFiled: November 14, 2025 modulated by adding histone(s) and / or other DNA binding proteins or synthetic multivalent peptides, which may impact electrostatic and / or steric characteristics of the DNA complexes in the sample being separated. Phase separation inducing buffer is added to the diluted sample to reach a final polycation concentration of 0.1 mM to 10 mM. After mixing, the mixture is incubated at room temperature.

[0074] Separation of the condensed and dilute phases: In exemplary embodiments, centrifugation at room temperature separates the condensed and diluted phases. Alternatively, with the nucleic acid scaffold conjugated on a solid surface (e.g., a bead, such as a magnetic bead), the condensed phase on the solid surface can be separated by use of magnetic bars, fluid flow, or electric sorting (e.g., subject to an electric field), and so forth.

[0075] Recovery of DNA from condensed and dilute phases for quantification by PCR-based or sequencing-based techniques: The supernatant is carefully removed and saved after centrifugation without disturbing the pellet. cfDNA from the supernatant and from 0.5 ml of the total starting material is extracted. The remaining phase-separated pellet is carefully washed twice with ethanol (50%-90%), then allowed to completely dry at room temperature. The dried pellet is resuspended in Tris / EDTA buffer and heated to 37eC for 15 minutes. Following this incubation, proteinase K solution is added (e.g, to a final concentration of 6 mg / ml), mixed (e.g., by high-speed vortex), and incubated for 10 minutes at 56eC. Phase-separated cfDNA from the pellet is purified by AMPURE bead purification.

[0076] Subsequent purified DNA from the total, supernatant, and pellet can be characterized, for instance quantified by quantitative PGR, digital PCR, and / or targeted or whole genome sequencing.

[0077] Though described herein in various specific embodiments and examples, it will be clear that aspects of the provided methods, systems, and kits can be varied.Sources of samples to be analyzed

[0078] In embodiments provided herein, the term “sample” includes any material that contains or is believed to contain cell free DNA and / or cell free nucleosomes. The sample may be a biological sample, such as animal or plant tissue, biopsy, organ, eukaryotic cell(s), cell extracts, secretions, urine or mucous or other secretion(s), tissue extracts or other biological specimens both natural or synthetic in origin. The term sample also includes extracts of single cells, organelles or intracellular materials isolated from a biological specimen, or isolates therefrom. The sample more generally may be any artificial or natural material, that contains cell free DNA and / or cell free nucleosomes, understanding that a liquid sample may be derived from another wise solid sample through washing or other extractive technique.

[0079] The provided CHROMAPS method is a comprehensive liquid biopsy platform that is applicable to analysis of any liquid biopsy sample, including for instance cerebral spinal fluid,Filed: November 14, 2025 urine, saliva, and fluids collected proximal to sites of interest such as pancreatic cyst fluid and pleural fluid. Liquid biopsy samples can be collected, typically with minimally invasive techniques as compared to tissue biopsy, from a variety of bodily fluids as each carry molecular traces of disease and patient specific phenotypes. Blood is the most widely utilized and cfDNA the most studied analyte because it provides a sampling of every major organ in the body giving a temporal snapshot of the current disease state (Bruhm et al., Genomic and fragmentomic landscapes of cell-free DNA for early cancer detection, Nat Rev Cancer2.5 341-358, 2025. Hu et al., Cell-free DNA: a promising biomarker in infectious diseases, Trends in Microbiology, 33: 421 - 433, 2025. Rafiei et al., Circulating-free DNA: A promising tool for early detection of myocardial infarction, IJC Cardiovascular Risk and Prevention, ’ T. 2025. Aydm et al., The Potential of cfDNA as Biomarker: Opportunities and Challenges for Neurodegenerative Diseases, J Mol Neurosci, 75: 34, 2025). Urine provides a completely non-invasive source of cfDNA. It has been shown that urine cf-nucleosomes retain their epigenetic modifications, and these are highly informative for the diagnosis and monitoring of urological cancers (Lotem et al., Urine cf-nucleosomes: A non-invasive window into human physiology and disease, Cell Genomics, 5: 2025). Cerebral spinal fluid is particularly valuable for brain cancer and metastasis where surgery is often not possible and cfDNA is more representative of intracranial disease than plasma (Chai et al., Sequencing of cerebrospinal fluid cell-free DNA facilitated early differential diagnosis of intramedullary spinal cord tumors. NPJ Precis. One., 8: 43, 2024). Pleural and peritoneal effusions accumulate tumor derived cfDNA in patients with thoracic or abdominal malignancies offering a source of genomic profiling when tissue is unavailable (Husain et al., Cell-Free DNA from Ascites and Pleural Effusions: Molecular Insights into Genomic Aberrations and Disease Biology, Mol. Cancer. The , 16: 948-955, 2017). Saliva is another completely non-invasive liquid source of cfDNA which can be leveraged for surveillance of head-and-neck cancer by analysis of epigenetic modifications (Birknerova et al., Circulating Cell-Free DNA-Based Methylation Pattern in Saliva for Early Diagnosis of Head and Neck Cancer, Cancers, 14: 4882, 2022). Together, these fluids give the opportunity of minimally-invasive assessment of disease through cfDNA. A specific advantage of our technique is the intrinsic specificity of polyamine binding to DNA allowing fluids which have not been subjected to purification, are unfiltered, have as low as 50 pg of cfDNA, have a volume as low as 1 pl, or which contain obfuscating materials which would normally inhibit analysis of cf-nucleosome modifications.

[0080] The provided CHROMAPS method is amendable to specimens, such as clinical samples, animal samples, agricultural samples, archaeological samples, and forensic samples, that contain fragmented chromatin and fragmented DNA that is suspended in a complex fluid, including at a low (e.g., physiologically relevant) concentration. The providedFiled: November 14, 2025 methods are specifically designed to work directly in complex fluids with no need for purification of cell-free DNA prior to performing the method.

[0081] Biological samples can be obtained or derived from a subject, and are considered useful in methods provided herein where the sample is substantially fluid (or can be converted into a fluid form) and contains cell free DNA and / or cell free nucleosomes. They are typically considered dilute samples, and generally do not need to have been subject to extensive purification processes before CHROMAPS methods can be applied. Examples of biological fluids include urine, blood, plasma, serum, saliva, semen, stool, sputum, cerebral spinal fluid (CSF), tears, mucus, amniotic fluid, and the like. Also encompassed in the term biological fluids are fluids obtained from a subject through a clinical or other procedure, such as lavage (e.g., respiratory lavage), aspirational samples (e.g., aspirate obtained at or proximal to a target site, such as a tumor or other locus), and the like. Biological tissues are aggregate of cells, usually of a particular kind (or a mixture of two or more kinds) together with their intercellular substance that form one of the structural materials of a human, animal, plant, or fungal structure, including connective tissue, epithelium, muscle tissue, and nerve tissues (where applicable). Examples of biological tissues also include organs, tumors, lymph nodes, and arteries. In some embodiments, the sample can be derived from a tissue (e.g., a fluid preparation made from or extracted from a tissue sample), for example, a connective, epithelium, muscle or nerve tissue, or a body fluid; a tissue selected from the group consisting of brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gall bladder, stomach, intestine, testis, ovary, uterus, rectum, nervous system, gland, and internal blood vessels; or a body fluid selected from the group consisting of blood, urine, saliva, bone marrow, sperm, an ascitic fluid, and subtractions thereof, e.g., serum or plasma.

[0082] In addition to complex liquid biological samples obtained directly or indirectly from a subject, also contemplated are environmental samples (e.g., surface water, ground water, industrial water, wastewater, or other liquid samples, or samples generated by suspending or “washing” a solid sample such as soil, sediment, dust and air particulates, organic material such as leaf litter and decaying wood, tree bark, and so forth), laboratory samples (e.g., culture liquids such as tissue culture supernatants from the culturing of eukaryotic cells, samples from animal experimental models or other cell-based or tissue-based laboratory models, and so forth), forensic samples (that is, biological samples obtained from a forensic analysis, such as materials collected from a crime scene, victim, suspect, or related environment that can be analyzed to provide evidence in legal investigations), archaeological samples (materials collected from ancient or historical sites, which can be organic, inorganic, or mixed, and they often contain DNA), and so forth.Filed: November 14, 2025

[0083] The terms “individual” or “subject” (e.g., from which a sample is obtained) include birds (e.g., chickens, ducks, geese, turkeys, quail, songbirds, and so forth), other non-mammalian vertebrates (e.g., as fish), and mammals (e.g., mice, rats, rabbits, and other rodents; cats and other felines; dogs and other canines; other domesticated animals; pigs, cows, oxen, sheep, goats, horses, and other livestock animals; monkeys and other non-human primates). In certain embodiments, the individual or subject is a human. By way of example, the individual or subject may be suspected of having a disease or condition, for instance for which DNA analysis may provide treatment, diagnosis, and / or prognosis insights.Induction of phase separation and physical separation thereof

[0084] Polyamines induce a spontaneous, but reversable, collapse of DNA, nucleosomes, or chromatin into two distinct phases: a dilute phase and condensed phase. As this occurs naturally within the nuclei of mammalian cells, the DNA, nucleosomes, or chromatin are partitioned between phases with an epigenetic dependence (Gibson et al., Organization of Chromatin by Intrinsic and Regulated Phase Separation, Cell, 179: 470-484, 2019). This phenomenon can be reproduced in complex fluids, as described throughout, by the addition of polycationic molecules and a capture scaffold (also referred to as a phase separation scaffold). The purpose of the scaffold is to provide site(s) for DNA from the analyzed sample to be captured, and thus the phrase DNA-capture scaffold is also appropriate.

[0085] The scaffold can include nucleic acids of varying length or can be any solid surface useful as a nucleation site for phase separated chromatin, or a combination thereof. If no solid surface component is employed in the scaffold, a nucleic acid scaffold can reasonably constitute bare dsDNA, modified or unmodified nucleosomes, intact chromatin, or RNA, as all are known to undergo polyamine-mediated phase separation and will condense with the target cf-nucleosomes or cfDNA, acting to capture the condensed phase (Kang et al., Sequencedependent DNA condensation as a driving force of DNA phase separation, Nucleic Acids Research, 46: 9401-9413, 2018. Wadsworth et al., RNA-driven phase transitions in biomolecular condensates, Mol. Cell., 84: 3692-3705, 2024).

[0086] The generated phases can then be physically partitioned, for instance by gravity or fluid flow analogous to fluorescence-activated cell sorting (Wollny et al., Characterization of RNA content in individual phase-separated coacervate microdroplets, Nat. Common., 13: 262, 2022). Electric field sorting also can be used, as the induction of polyamine-mediated phase separation changes the electrophoretic mobility of DNA causing a charge reversal that could be leveraged for instance within a dielectrophoretic system where an electric field gradient polarizes and collects particles (Manouchehri et al., Dielectrophoretic recovery of DNA from plasma for the identification of chronic lymphocytic leukemia point mutations, Int. J. Hematol. Oncol., 5: 27-35, 2016).Filed: November 14, 2025

[0087] The use of a solid-surface scaffold allows various partitioning strategies such as the magnetic bead-based platform described herein, an affinity column based method where induction of phase separation and subsequent DNA charge reversal cause electrostatic attraction of either the dilute or condensed phase to a charged resin or membrane, and physical size based techniques where phase separation of the DNA to a solid support causes steric limitations analogous to size exclusion chromatography or filtering (Chockalingam etal., DNA affinity chromatography, Mol. Biotechnol., 19: 189-99, 2001. Ebrahimimojarad A. etal., A Robust and Efficient Method to Purify DNA-Scaffolded Nanostructures by Gravity Driven Size Exclusion Chromatography, Langmuir, 40: 8365-8372, 2024). In embodiments that employ a solid support scaffold, it may be beneficial to use of a passivating component to fully or partially coat the solid support, as the high charge of DNA may cause non-specific binding and strong electrostatic interactions resulting in loss of material (that is, inhibiting recovery from the scaffold). The passivating agent, generally an added component bound or unbound to the solid surface which reduces direct interactions between the solid surface and target DNA or nucleosomes, can constitute inert crowding polymers such as polyethylene glycol (PEG) and the like, or surfactants like such as Tween-20 and the like (Hua et al., An improved surface passivation method for single-molecule studies, Wat. Methods, 11 : 1233-1236, 2014).DNA Capture Technologies:

[0088] DNA capture technologies encompass a spectrum of solid supports and chemistries that can be tuned either for efficient elution of purified DNA or for direct, on-bead downstream analyses such as PGR, digital PGR, and sequencing library preparation. DNA capture technologies generally rely on immobilizing nucleic acids onto a surface or surfaces so the DNA can be separated from contaminants, washed, and either eluted or used directly in downstream reactions. Common capture substrates include silica particles or membranes, glass fibers, magnetic beads with silica or polymer coatings, and other functionalized polymers. In high-salt or chaotropic conditions, DNA adsorbs to these surfaces while proteins, salts, and other impurities are removed in the flow-through and wash steps. The retained DNA can then be recovered, for instance in a small volume of low-salt buffer or water, providing both purification and concentration in a single workflow. See, for instance, Boom et al., J Clin Microbio, 28(3):495-503, 1990; Hawkins, et al., Nucleic Acids Res., 22(21 ):4543-4544, 1994; DeAngelis et al., Nucleic Acids Res., 23(22) :4742-3, 1995; and Berensmeier, Appl Microbiol Biotechnol., 73(3):495-504, 2006.

[0089] Silica-based solid-phase extraction is a widely used approach. In a classic method, chaotropic guanidinium salts lyse cells, inactivate nucleases, and promote adsorption of nucleic acids to finely divided silica particles; subsequent ethanol-containing washes remove contaminants, and DNA is eluted under low ionic strength conditions (Boom et al., J ClinFiled: November 14, 2025 Microbiol, 28(3):495-503, 1990). Related silica chemistries are used in spin-column formats and in silica-coated magnetic beads. Solid-phase reversible immobilization (SPRI) extends this concept by using paramagnetic beads in the presence of polyethylene glycol (PEG) and salt to precipitate and reversibly bind DNA; by adjusting PEG and salt concentrations, SPRI enables size-selective capture (e.g., enrichment of fragments above a defined cutoff) and is now standard in many library preparation workflows (Hawkins et al., Nucleic Acids Res., 22(21 ):4543-4544, 1994; DeAngelis et al., Nucleic Acids Res. 23(22) :4742-3, 1995).

[0090] Magnetic bead-based capture offers several advantages, including easy automation and compatibility with microfluidic or continuous-flow systems. Beads can be silica-coated, carboxylated polymers, or other chemistries, and can also be functionalized with affinity ligands such as streptavidin (for biotinylated DNA), oligonucleotide probes, or DNA-binding proteins to enable sequence-specific capture (DeAngelis et al., Nucleic Acids Res., 25;23(22):4742-3, 1995; Berensmeier, Appl Microbiol Biotechnol., 73(3):495-504, 2006; Rudi et al., Biotechniques, 22(3):506-11, 1997). In a typical protocol, the sample is mixed with beads under binding conditions (e.g., high salt and / or crowding agents), beads are immobilized with a magnet, and the supernatant is removed. After one or more washes, DNA is either eluted or retained on the beads. Magnetic silica beads have been used in batch, dynamic, and continuous-flow formats to extract PCR-amplifiable DNA from complex matrices such as blood, bacterial cultures, and environmental samples (Wang et al., Micromachines, 12(38), 2021).

[0091] Elution of DNA from solid supports typically involves disrupting the interactions that promoted binding. For silica and many magnetic bead systems, lowering ionic strength (and often omitting ethanol), adjusting pH, and / or modest heating can be sufficient to desorb DNA into an aqueous buffer. Studies comparing binding and elution conditions have shown that bead surface chemistry, salt composition, and elution time strongly influence DNA recovery, particularly for long fragments or low-input samples (Pearlman et al., ACS Applied Materials & Interfaces, 12(11) , 2020; Vutukuru et al., Sci Rep., 15(1):12479, 2025). In some applications, however, elution is unnecessary or even undesirable. For example, “PCR-ready” DNA can be obtained by binding nucleic acids to magnetic beads, performing wash steps, and then using the beads directly as template in PGR; this approach has been demonstrated across diverse organisms and sample types (Rudi et al., Biotechniques, 22(3):506-11 , 1997) and is particularly useful for analyzing cell free DNA that has been subject to CHROMAPS phase separation.

[0092] On-bead analysis has been extended to more specialized formats such as emulsion PGR and digital PGR, in which individual DNA molecules are immobilized on beads and amplified within microdroplets, turning each bead into a microreactor that carries many copies of a single template (Kojima et al., Nucleic Acids Res., 33(17):e150, 2005; Heinrich et al.,Filed: November 14, 2025 Analytical Chemistry, 95(38) :14175-14783, 2023). Immobilized PGR primers on solid supports can generate amplicons covalently attached to beads, allowing direct downstream readout, sorting, or sequencing without an elution step (Andreadis & Chrisey, Nucleic Acids Research, 28(2), 2000). These “with-bead” workflows reduce sample handling, minimize DNA loss, and allow tight physical linkage between genotype (captured DNA) and bead-based barcodes or other assay components.

[0093] As used herein, the terms “solid support”, “solid surface”, or “solid substrate”, or “sequencing substrate” refers to any solid material, including porous and non-porous materials, to which a polypeptide can be associated directly or indirectly, by any means known in the art, including covalent and non-covalent interactions, or any combination thereof. A solid support may be two-dimensional (e.g., planar surface) or three-dimensional (e.g., gel matrix or bead). A solid support can be any support surface including a bead, a microbead, an array, a glass surface, a silicon surface, a plastic surface, a filter, a membrane, a PTFE membrane, a PTFE membrane, a nitrocellulose membrane, a nitrocellulose-based polymer surface, nylon, a silicon wafer chip, a flow through chip, a flow cell, a biochip including signal transducing electronics, a channel, a microtiter well, an ELISA plate, a spinning interferometry disc, a nitrocellulose membrane, a nitrocellulose-based polymer surface, a polymer matrix, a nanoparticle, or a microsphere. Materials for a solid support include acrylamide, agarose, cellulose, dextran, nitrocellulose, glass, gold, quartz, polystyrene, polyethylene vinyl acetate, polypropylene, polyester, polymethacrylate, polyacrylate, polyethylene, polyethylene oxide, polysilicates, polycarbonates, poly vinyl alcohol (PVA), Teflon, fluorocarbons, nylon, silicon rubber, polyanhydrides, polyglycolic acid, polyvinylchloride, polylactic acid, polyorthoesters, functionalized silane, polypropylfumerate, collagen, glycosaminoglycans, polyamino acids, dextran, or any combination thereof. Solid supports further include thin film, membrane, bottles, dishes, fibers, woven fibers, shaped polymers such as tubes, particles, beads, microspheres, microparticles, or any combination thereof.

[0094] For example, when solid surface is a bead, the bead can include a ceramic bead, a polystyrene bead, a polymer bead, a polyacrylate bead, a methylstyrene bead, an agarose bead, a cellulose bead, a dextran bead, an acrylamide bead, a solid core bead, a porous bead, a paramagnetic bead, a glass bead, a controlled pore bead, a silica-based bead, or any combinations thereof. A bead may be spherical or an irregularly shaped. A bead or support may be porous. A bead's size may range from nanometers, e.g, 100 nm, to millimeters, e.g., 1 mm. In certain embodiments, beads range in size from 0.2 micron to 200 microns, or from 0.5 micron to 5 micron. In some embodiments, beads can be 1 , 1.5, 2, 2.5, 2.8, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 15, or 20 pm in diameter. In certain embodiments, “a bead” solid support may refer to an individual bead or a plurality of beads. In some embodiments, the solid surface is a nanoparticle. In certain embodiments, the nanoparticlesFiled: November 14, 2025 range in size from 1 nm to 500 nm in diameter, for example, between 1 nm and 20 nm, between 1 nm and 50 nm, between 1 nm and 100 nm, between 10 nm and 50 nm, between 10 nm and 100 nm, between 10 nm and 200 nm, between 50 nm and 100 nm, between 50 nm and 150, between 50 nm and 200 nm, between 100 nm and 200 nm, or between 200 nm and 500 nm in diameter. In some embodiments, the nanoparticles can be 10 nm, 50 nm, 100 nm, 150 nm, 200 nm, 300 nm, or 500 nm in diameter. In some embodiments, the nanoparticles are less than 200 nm in diameter.

[0095] The most widely used reaction for the sequential analysis of N-terminal residue of peptides is the Edman degradation method (Edman et al., Acta Chem. Scand. 4: 283-293, 1950). Edman degradation is a method of sequencing amino acids in a peptide (or protein) wherein the amino-terminal residue is labeled and cleaved from the peptide without disrupting the peptide bonds between other amino acid residues). In the Edman procedure, phenyl isothiocyanate (PITC) reacts quantitatively with the free amino group of a peptide to yield the corresponding phenylthiocarbamoyl peptide. On treatment with anhydrous acid, the N-terminal residue is split off as a phenylthiocarbamoyl amino acid; this leaves the remainder of the peptide chain intact. One aspect of the Edman degradation method is that the rest of the peptide chain (after removal of the N-terminal amino acid) is left intact for further cycles of this procedure; thus, the Edman method can be used in a sequential, iterative manner to identify a plurality of consecutive amino acid residues starting from the N-terminal end the peptide being analyzed.Recovery of DNA from condensed and dilute phases

[0096] Representative methods are provided herein for reversing condensation of DNA from the condensed phase after polyamine-mediated phase separation. More generally, there are art recognized techniques available for recovery of DNA that are useful.

[0097] Reversal of the polyamine-mediated phase separation to release the DNA into solution is not strictly required for all embodiments, as it is feasible to perform measurement and analysis of DNA within the condensed phase. For instance, phase separated DNA can be analyzed directly by polymerase chain reaction (PCR) without prior elution from the condensed pellet by first removing the supernatant followed by direct addition of PCR reagents.

[0098] If a solid support DNA capture scaffold is utilized, such as magnetic beads, following phase separation the pellet containing beads may be added directly into a library preparation reaction to perform sequencing or analyzed directly by quantitative PCR or digital droplet PCR. See, e.g., Heinrich et al. (DNA-Binding Magnetic Nanoreactor Beads for Digital PCR Analysis, Analytical Chemistry, 95: 14175-14183, 2023) and Mercier et al. (Solid Phase DNA Amplification: A Simple Monte Carlo Lattice Model, Biophysical Journal, 85: 2075 - 2086, 2003).Filed: November 14, 2025Post-recovery analysis of DNA from condensed and dilute phases

[0099] Whole-genome sequencing of cfDNA enables a multimodal analysis spanning multiple sequence features of the supernatant and pellet DNA following CHROMAPS. This includes the calculation of pseudo-accessibility scores as described herein. A “pseudo-accessibility score” is the enrichment of reads in one phase (supernatant or pellet) of phase-separated DNA as compared to the other in a sliding window across the genome. This score recapitulates chromatin state and accessibility, where regions of active chromatin are enriched in the supernatant and repressed regions enriched in the pellet. cfDNA fragments are primarily produced from apoptosis but also enter bodily fluids through necrosis, active secretion, and NETosis each creating specific fragment features indicative of cell-of-origin biology (Lo et al., Epigenetics, fragmentomics, and topology of cell-free DNA in liquid biopsies, Science, 372:eaaw3616, 2021 ). End motif analysis specifically determines 4-6 bp end sequence motifs which reflect preferred cleavage sites of different nuclease enzymes with differential activity across disease types. Fragmentomic approaches examine genome-wide fragment length patterns, where for instance tumor derived cfDNA is typically shorter in length and has higher variance per genomic location due to a dysregulation in chromatin structure and nucleosome periodicity that can be further assessed between phases, supernatant vs. pellet, adding information to distinguish disease states (Cristiano et al., Genome-wide cell DNA fragmentation in patients with cancer, Nature, 570: 385-389, 2019).

[0100] Nucleosome profiling is a particularly powerful method to assess epigenetic regulation by whole genome sequencing of cfDNA. Nucleosome complexes protect DNA from degradation within bodily fluids thereby leaving a footprint within the sequencing data. By calculating sequencing coverage profiles by summing aligned fragments within a sliding window across the genome, the periodicity of this signal can be assessed. Active chromatin regions with high nucleosome turnover show periodicity not consistent with characteristic 167 bp peaks leads to measurable coverage differences where nucleosome peak amplitudes and widths may be used to determine transcription factor binding activity, gene expression, and the tissue of origin from which the cfDNA originated (Snyder et al., Cell-free DNA Comprises an In Vivo Nucleosome Footprint that Informs Its Tissue of Origin, Cell, 164: 57-68, 2016. Doebley et al., A framework for clinical cancer subtyping from nucleosome profiling of cell-free DNA, Nature Communications, 13:7475, 2022). This same signal may be compared between phases, where it is demonstrated herein that the supernatant (dilute phase) is enriched with active chromatin regions with dysregulated nucleosome profiles, while the pellet is enriched with inactive chromatin with highly periodic nucleosome profiles. This enables the identification of dysregulated regulatory sites as well as determining tissue-of-origin contributions to each phase.Filed: November 14, 2025

[0101] Post-separation analysis of DNA can be carried out using recognized methods and systems, and includes preparation and analysis of sequencing libraries, comparisons of phase content between the dilute and condensed phases, and so forth. In modern workflows, fragmented DNA molecules can be interrogated by massively parallel sequencing technologies that read millions to billions of fragments in a single run. These platforms operate on populations of previously separated DNA fragments, but differ in whether DNA is bound to a surface (e.g., flow-cell glass, zero-mode waveguides) or analyzed in a flow-through geometry (e.g., nanopores in biological or solid-state membranes).

[0102] Short-read systems such as Illumina’s sequencing-by-synthesis use clusters of DNA immobilized on a flow-cell surface. In short-read, surface-based systems, adapter-ligated fragments are first immobilized on a functionalized flow cell, clonally amplified (e.g., by bridge amplification), and then sequenced cycle-by-cycle by incorporation of labeled nucleotides and imaging of each cluster (Moorthie et al., Hugo J., 5(4):1 -12, 2011). Each cluster represents many identical copies of a single starting fragment, enabling highly parallel imaging-based readout across the entire flow-cell surface.

[0103] Long-read “third-generation” platforms such as single-molecule real-time (SMRT) sequencing and nanopore sequencing can be employed to analyze individual DNA molecules as they are synthesized or translocate through a nanoscale pore (Moorthie etal., Hugo J., (1-4):1-12, 2011 ; Ardui et al., Nucleic Acids Res., 46(5):2159-2168, 2018; Mohammadi & Bavi, Biophys Rev., 14(1):99-110, 2021 ; Feng et al., Genomics, Proteomics & Bioinformatics, 13(1 ):4-16, 2015; Haque etal., Nano Today, 8(1):56-74, 2013). Long-read SMRT sequencing starts from size-selected DNA fragments, but instead confines individual molecules and polymerases in thousands to millions of tiny reaction chambers (zero-mode waveguides) and observes nucleotide incorporation in real time, producing continuous reads spanning tens of kilobases (Ardui etal., Nucleic Acids Res., 46(5):2159-2168, 2018). Nanopore sequencing, by contrast, threads DNA fragments through a protein or solid-state nanopore embedded in a membrane while monitoring ionic current disruptions in a flow-through fashion, converting those signals into base calls without the need for surface-bound fluorescent imaging (Mohammadi & Bavi, Biophys Rev., 14(1 ) :99-110, 2021 ; Feng etal., Genomics, Proteomics & Bioinformatics, 13(1 ):4-16, 2015; Haque etal., Nano Today, 8(1):56-74, 2013).

[0104] Post-separation DNA analysis involves computational pipelines that transform raw signals into biologically interpretable information. By way of example, for short-read sequencing, raw image or intensity data may be converted to base calls and quality scores, followed by demultiplexing, read trimming, and alignment to a reference genome using tools such as BWA, Bowtie, or related mappers (Torri et al., Genes (Basel), 3(3):545-75, 2012; Larson etal., J Thorac Oncol., 18(2):143-157, 2023; Zanit etal., BMC Bioinformatics, 22(218), 2021). Aligned reads can then be processed through variant calling software (e.g., GATK,Filed: November 14, 2025 SAMtools, or commercial equivalents) to identify single-nucleotide variants, small insertions / deletions, and copy-number or structural variants, with extensive benchmarking studies assessing the accuracy and runtime of different pipeline combinations (Samarakoon et al., Bioinformatics Advances, 5(1), 2025). For both short- and long-read data, recent work increasingly leverages GPU-accelerated workflows and deep-learning-based callers such as DeepVariant, Clair, and related models, which use neural networks to improve sensitivity and specificity relative to classical statistical methods (Abdelwahab & Torkamaneh, Front. Bioinform., 5, 2025).

[0105] Also contemplated as a key post-separation analysis is “fragmentomics,” the quantitative study of cell-free DNA (cfDNA) fragmentation patterns in plasma or other biofluids. Instead of focusing solely on sequence or variant information, fragmentomics interrogates features such as fragment length distributions, end-motif frequencies, preferred cleavage sites, nucleosome footprints, and regional coverage oscillations across the genome (Tsui et al., Cancer Cell, 2025, 43(10):1792-1814; Helzer etal., Nat Common, 2025, 16(9122); Sirajee, et al., Transl Oncol., 49:102085, 2024; Sangphukieo et al., eLife 13:RP95320, 2024, doi.org / 10.7554 / eLife.95320.1.sa2). Recent reviews and cohort studies show that cfDNA fragmentation is shaped by chromatin structure, cell-type-specific nuclease activity, and modes of cell death, and that these signatures can be used to infer tissue of origin and to detect cancer or other pathologic states non-invasively (Curtis et al., Proc. Natl. Acad. Sci. USA, 12(34):e2426890122, 2025; Yin et al., J Clin Oncol, 43:2863-2874, 2025). In practice, fragmentomic workflows begin with physical separation and extraction of cfDNA (which can be carried out using the herein-provided CHROMAPS methods), and then downstream analysis can involve computational pipelines that compute fragmentation metrics, integrate them with sequence- and methylation-based features, and apply machine-learning models for tasks such as early cancer detection, minimal residual disease monitoring, and disease classification.

[0106] More generally, the phrase “next generation sequencing” refers to high-throughput sequencing methods that allow the sequencing of millions to billions of molecules in parallel. Examples of next generation sequencing methods include sequencing by synthesis, sequencing by ligation, sequencing by hybridization, polony sequencing, ion semiconductor sequencing, and pyrosequencing. By attaching primers to a solid substrate and a complementary sequence to a nucleic acid molecule, a nucleic acid molecule can be hybridized to the solid substrate via the primer and then multiple copies can be generated in a discrete area on the solid substrate by using polymerase to amplify (these groupings are sometimes referred to as polymerase colonies or polonies). Consequently, during the sequencing process, a nucleotide at a particular position can be sequenced multiple times (e.g., hundreds or thousands of times)— this depth of coverage is referred to as “deepFiled: November 14, 2025 sequencing.” Examples of high throughput nucleic acid sequencing technology include platforms provided by Illumina, BGI, Qiagen, Thermo-Fisher, and Roche, including formats such as parallel bead arrays, sequencing by synthesis, sequencing by ligation, capillary electrophoresis, electronic microchips, “biochips,” microarrays, parallel microchips, and single-molecule arrays (see e.g., Service, Science 311 :1544-1546, 2006).

[0107] The phrase “single molecule sequencing” or “third generation sequencing” refers to next-generation sequencing methods wherein reads from single molecule sequencing instruments are generated by sequencing of a single molecule, generally a molecule of DNA. Unlike next generation sequencing methods that rely on amplification to clone many DNA molecules in parallel for sequencing in a phased approach, single molecule sequencing interrogates single molecules (e.g., of DNA) and does not require amplification or synchronization. Single molecule sequencing includes methods that need to pause the sequencing reaction after each base incorporation (‘wash-and-scan’ cycle) and methods which do not need to halt between read steps. Examples of single molecule sequencing methods include single molecule real-time sequencing (Pacific Biosciences), nanopore-based sequencing (Oxford Nanopore), duplex interrupted nanopore sequencing, and direct imaging of DNA using advanced microscopy.CHROMAPS Methods

[0108] The following provides specific exemplary embodiments of the provided CHROMAPS method; this is a specific illustration of the scheme shown in FIG. 5. Though described here using analysis of blood plasma or another complex body fluid, other complex source samples are envisioned.

[0109] Induce cf-nucleosome condensation on a nucleic acid scaffold: Plasma or other clinical fluid specimens are diluted with ultrapure water or a low salt buffer, to reach a relatively dilute physiological salt concentration (for instance, about half that of plasma, or below about 70 mM). Phase separation inducing buffer (1 mM to 100 mM spermine or similar polycation or multivalent positively charged peptides, 10 mM Bis-Tris or similar buffer with pH between 5 to 8) is prepared and kept at room temperature, for use to induce phase separation. A capture scaffold is added to the diluted specimens (e.g., diluted plasma). The purpose of the capture scaffold is to provide site(s) for DNA from the analyzed sample to be captured, and thus the scaffold can also be referred to as a DNA-capture scaffold (including in embodiments where the scaffold itself does not contain nucleic acids). In examples, the capture scaffold includes synthetic nucleic acid, or a solid capture surface (e.g., a bead or other solid surface), which optionally may be coated or modified to influence how well it binds DNA and / or how well it can release DNA. The capture scaffold may be a nucleic acid scaffold that includes long DNA strands in the range of 0.15 - 15 kbps, mono or oligonucleosome arrays in a free form, nucleicFiled: November 14, 2025 acids or nucleosome arrays conjugated to a solid surface such as beads, or solid substrates without a nucleic acid coating (though other passivating coating agents are contemplated). Phase separation can be modulated, for instance by adding histone- or DNA-binding proteins, synthetic multivalent peptides, or other molecules or components that interact with cell free DNA and / or cell free nucleosomes in the clinical fluid specimens. Phase separation inducing buffer is added to the diluted specimen to reach a final polycation concentration of between 0.1 to 10 mM. After mixing, the mixture is incubated at room temperature.

[0110] Separation of the condensed and dilute phases: In embodiments, centrifugation at room temperature is used to separate the condensed and diluted phases. In embodiments that employ a solid surface capture scaffold (e.g., beads or other solid capture surfaces optionally coated with nucleic acid), the phase condensed on the solid surface can be separated by use of magnetic bars, fluid flow, or electric sorting, for instance.

[0111] Recovery of DNA from condensed and dilute phases for quantification by PCR-based or sequencing-based techniques: The supernatant is carefully removed and saved after centrifugation without disturbing the pellet. cfDNA from the supernatant and from 0.5 ml of the total starting material is extracted using standard techniques. The remaining phase-separated pellet is carefully washed twice with ethanol (e.g., 50% to 90%) and then allowed to completely dry at room temperature. The dried pellet is resuspended in Tris / EDTA buffer (e.g., pH 7.2) and heated to 37eC for 15 minutes. Following this incubation, proteinase K solution is added, mixed, and incubated for 10 minutes at 56eC. Phase-separated cfDNA from the pellet is purified, for instance using AMPure bead (Beckman Coulter, US) purification.

[0112] Subsequent purified DNA from the total, supernatant, and pellet is quantified by quantitative PCR, digital PCR, and targeted or whole genome sequencing.

[0113] This method was used for experimental investigations detailed herein. By way of specific example, the following method may be used:

[0114] Plasma was thawed over ice then diluted with ultrapure water. Polyamine buffer (such as 1 mM - 50 mM or 10 mM -20 mM spermine, 10 mM -50 mM Bis-Tris pH 5-8, for instance pH 6-8, 5.5-8, 5.5-7, 6-7, 5.8, 5.9, 6.0. 6.1 , 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5 and so forth) to induce phase separation was prepared and kept at room temperature. A long fragment (e.g., range: 150 bp < length > 15 kilo-bp) DNA scaffold construct with a 5’ inverted dideoxy thymine was added to the plasma at a final concentration between 10 ng / ml - 1000 ng / ml. Polyamine buffer was added to the diluted plasma with added DNA scaffold, to reach a final polyamine concentration between 0.1 mM - 5 mM. After mixing, the solution was incubated at room temperature for 10 minutes then centrifuged for 10 minutes at room temperature and 18000xg. In embodiments, this could be carried out using a 5 min -1 hr incubation, followed by a 5 min - 10 min at 18000xg - 21000xg centrifugation.Filed: November 14, 2025

[0115] The supernatant was carefully removed, without disturbing the pelleted phase (which constitutes the separated condensed phase), and saved after centrifugation leaving no dead volume behind. cfDNA from the supernatant and from 0.5 ml of the total starting material was extracted, for instance by the Zymo Quick-cfDNA Serum and Plasma kit (CAT#D4076). The extraction was eluted with elution buffer warmed to 60eC, which was incubated on the spincolumn for three minutes twice to maximize recovery.

[0116] The phase separated pellet was carefully washed twice with cold 75% ethanol (in embodiments, a range of range: 50% < ethanol > 90%). After washing, the cleaned pellet was allowed to completely dry at room temperature (approx. 15 min). The dried pellet was resuspended in Tris-HCl / EDTA buffer (in embodiments, 10 mM - 50 mM Tris-HCI, 0.1 mM -10 mM EDTA, pH 6.5-8.5) and heated to 37eC for 15 minutes (in embodiments, 15 min -30 min). Directly following this incubation, proteinase K solution was added to a final concentration of 6 mg / ml (in embodiments, 1.5 mg / ml - 12 mg / ml proteinase K), mixed by high-speed vortex, and incubated for 10 minutes (in embodiments, 10 min - 30 min incubation) at 56eC. Phase separated cfDNA from the pellet was then purified using AM PURE bead purification (in embodiments, 1X - 3X bead:sample ratio). All AMPURE bead purifications were performed with 70% ethanol.

[0117] Subsequent purified DNA from the total, supernatant, and pellet was prepared for sequencing, then sequenced using the TakaraThruplex DNA-seq kit (CAT# R400674) utilizing 8 cycles of library amplification.

[0118] Though exemplified above with analysis of plasma, it is demonstrated herein that the provided methods and systems work equally well with other complex biological fluids, such as bodily fluids.Tuning DNA and nucleosome phase separation

[0119] Epigenetic contrast between the separated phases can be tuned (adjusted) by modulating conditions used for the phase separation. This is accomplished, in embodiments, by adding one or more contrast modulators (e.g., a histone-modification-specific binding molecule, a DNA binding molecule, a nucleosome binding molecule, and / or a chromatin binding molecule) to the phase separation mixture to influence partitioning of DNA into the dilute or condensed phase.

[0120] Epigenetic contrast can also be modulated by varying the nucleic acid scaffold used, such as by selecting characteristics such as the type of nucleic acid, the length of nucleic acid, sequence of nucleic acid (including GC content), association with proteins, and so forth. Nucleic acid scaffold options include naturally and non-naturally occurring free DNA and RNA; mono or oligo nucleosomes; naturally or non-naturally occurring nucleic acids bound to a solid surface (e.g., a bead); or multivalent and positively charged solid surface with or without boundFiled: November 14, 2025 nucleic acids. Contrast can be enhanced by the varying concentration of DNA condensation inducing agent(s) used for the method. Such DNA condensation inducing agents include at least one of a polyamine, a positively charged peptide, or protein domain. Contrast can also be further fine-tuned by varying the concentration of components in the phase separation inducing buffer, including a chelator (such as EDTA), divalent cations, and / or the pH of the buffer.Fragmentomics Analysis

[0121] More information can be harvested using the described differential phase separation of cfDNA. The CHROMAPS method is amenable to both nucleosome profiling and fragment analysis. Both have proven to be highly predictive for cancer diagnosis and subtyping [5, 31]. Cancer cfDNA is known to have a shorter and more variable fragment length and district footprints compared to healthy

[0032] , It is demonstrated herein that fragment features may be added as another informative feature layer, along with pseudo-accessibility, to better determine, survey, and / or predict disease state or other characteristics.Solid Support-based CHROMAPS:

[0122] Another embodiment that provides increased throughput and robustness of the described assays involves a bead-based (or other solid support capture surface-mediated) method of nucleosome phase separation (e.g., cf-nucleosome phase separation). Including a bead or other surface-medicated capture element can remove the need for centrifugation (FIG.12A). For instance, use of magnetic beads as a nucleation site for condensed nucleosomes or DNA would allow physical separation of dilute and condensed DNA without the need for centrifugation. This would decrease protocol time, allow multi-well format, and enable processing automation. Additional guidance related to integrating solid support elements into CHROMAPS methods and systems is provided herein.

[0123] A bead-based assay was engineered to demonstrate the feasibility of performing polyamine-induced phase separation onto a solid support surface. It was hypothesized that the bead surface will act as a nucleation site for phase separation, resulting in pelleted DNA electrostatically attached to the beads that can then be separated from the supernatant using a magnet.Controlled modulation of phase separation to increase epigenetic resolution.

[0124] The original CHROMAPS method does not directly distinguish specific histone modifications or DNA methylation sites as the pseudo-accessibility is an aggregate score of all epigenetic signals typically culminating in an output similar to chromatin accessibility. This can be addressed through addition of histone modification binding proteins, such as chromo-Filed: November 14, 2025 domain and bromo-domain containing proteins or antibodies, to the sample being analyzed. The binding of these proteins is proposed to modulate the phase behavior of target nucleosomes because of a change in electrostatics and sterically limiting polyamine interactions. Effectively, this would alter the phase behavior of specifically bound nucleosomes, providing the ability to target nucleosomes of a certain type (having a certain characteristic) to either be enriched in the supernatant or pellet.

[0125] An example of this is incubating plasma cf-nucleosomes with BRD4 which is a histone H3 and H4 acetylation binding protein. It is proposed that acetylated nucleosomes would have significantly altered phase separation which is detectable as large deviations in the pseudoaccessibility in regions known to be acetylated such as active promoters and enhancers. Provided herein is proof-of-principle that binding of an anti-dsDNA antibody can be used to controllably inhibit the phase separation of bare DNA (FIG. 15A) or mononucleosomes (FIG.15B) and this effect is dependent upon antibody concentration. This assay would function as a type of “leave-one-out” or “reverse” cell-free ChlP-seq in which it is possible to measure genome wide epigenetic state with the added resolution of identifying specific histone modification types within a single step.Exemplary Applications, including Clinical Applications:

[0126] The CHROMAPS platform technology that can be leveraged for its ability to non-invasively determine chromatin state and architecture, which is highly dysregulated across many diseases but previously could not be determined from patient blood. A primary application resides in oncological precision medicine, where there is great benefit in longitudinal monitoring of treatment response which is often impracticable with standard tissue biopsy techniques. Though many diagnostic companies and start-ups are attempting to solve this same problem, all use standard sequencing techniques with little differentiation.

[0127] The CHROMAPS method provides a new platform to reconstruct chromatin features and regulatory elements from circulating DNA in patient fluids such as blood, urine, CSF, and clinical fluids from aspiration and lavage procedures. As a result, the platform provides new opportunities in liquid biopsy by measuring epigenetic regulation associated with a natural disease progression and treatment-induced responses, evolution, and adaptation of the disease using accessible fluid specimens in oncology, obstetrics, neurodegeneration, transplantation, and metabolic disorders. Clinical applications span disease surveillance and detection, molecular subtyping, treatment stratification, and monitoring treatment response.

[0128] CHROMAPS has the potential to transform clinical liquid biopsy, and analysis of any complex sample, by allowing minimally invasive analysis of epigenetic regulation, which is critically important for disease management.Filed: November 14, 2025

[0129] CHROMAPS has potential applications in analyzing the chromatin landscape of specimens containing fragmented DNA bound or unbound to proteins, including but not limited to clinical samples, animal samples, agricultural samples, archaeological samples, and forensic samples.Systems:

[0130] Also provided are systems useful to phase separate DNA (such as fragmented cell-free DNA and / or cell free nucleosomes) from a complex biological or other complex fluid sample, for instance a substantially unpurified bodily fluid from a subject, such as a human or other mammalian subject. By way of example, such a system includes: a sample isolation device, which is adapted to isolate a biological sample from the subject; a separation device, which is adapted to subject the complex fluid sample to poly-cation molecule mediated condensation phase separation in the presence of a scaffold, to produce a dilute phase and a condensed phase, and one or more DNA analysis devices (optionally at least one of which is a sequencing device), which is / are adapted to analyze and / or characterize DNA in the dilute and condensed phases, thereby obtaining one or more DNA information results; and an alignment device, which is adapted to align one or more of the DNA information results between the dilute and condensed phases in order to determine or provide a pseudoaccessibility score for one or more locations within the analyzed genome based on the alignment result.

[0131] Optionally, the systems may further include an information delivery device capable of delivering to a receiver (which may be a person) information about the results of the analysis. Such information may include one or more of: the identity and / or relative or absolute quantity of DNA fragments mapping to a specified locus within a genome, the proportional amount of any such locus that is found in the dilute and condensed phases from an analyzed sample, fragmentomic information about DNA in the dilute and condensed phases, and so forth.Computer Implementations:

[0132] Embodiments disclosed herein can utilize a computer architecture capable of executing program components for implementing the functionality described herein. The computer architecture can include a conventional computer, workstation, desktop computer, laptop, tablet, network appliance, e-reader, smartphone, or other computing device, and can be utilized to execute any of the processes described herein.

[0133] The computer includes a baseboard or “motherboard,” which is a printed circuit board to which a multitude of components or devices can be connected by way of a system bus or other electrical communication paths. In one illustrative configuration, one or more processing units, such as (“CPUs”), GPUs, TPUs, ASICs, FPGAs, or the like, and / or threads, kernels,Filed: November 14, 2025 cores, and / or the like thereof, that may operate in conjunction with a chipset. The CPUs can be standard programmable processors that perform arithmetic and logical operations necessary for the operation of the computer.

[0134] The CPUs perform operations by transitioning from one discrete, physical state to the next through the manipulation of switching elements that differentiate between and change these states. Switching elements generally include electronic circuits that maintain one of two binary states, such as flip-flops, and electronic circuits that provide an output state based on the logical combination of the states of one or more other switching elements, such as logic gates. These basic switching elements can be combined to create more complex logic circuits, including registers, adders-subtractors, arithmetic logic units, floating-point units, and the like.

[0135] The chipset provides an interface between the CPUs and the remainder of the components and devices on the baseboard. The chipset can provide an interface to a randomaccess memory (RAM) or any other suitable form of memory, used as the main memory in the computer. The chipset can further provide an interface to a computer-readable storage medium such as a read-only memory (ROM) or non-volatile RAM (NVRAM) for storing basic routines that help to startup the computer and to transfer information between the various components and devices. The ROM or NVRAM can also store other software components necessary for the operation of the computer in accordance with the configurations described herein.

[0136] The computer can operate in a networked environment using logical connections to remote computing devices and computer systems through a network. The chipset can include functionality for providing network connectivity through a network interface controller (NIC), such as a gigabit Ethernet adapter. The NIC is capable of connecting the computer to other computing devices over the network. It should be appreciated that multiple NICs can be present in the computer, connecting the computer to other types of networks and remote computer systems. In some instances, the NICs may include at least on ingress port and / or at least one egress port.

[0137] The computer can include an input / output (I / O), such as a controller sufficient to transmit processor-executable instructions to or receive processor-executable instructions from a device. For example, the I / O controller include or interface with one or more user interface devices (e.g., a display, speaker, a keyboard, a mouse, a trackpad, a touchscreen), one or more servers, laboratory equipment (e.g., spectrometers), and / or the like. Interfacing with any of these devices may additionally or alternatively be executed by the network interface controller .

[0138] The computer can be connected to a storage device that provides non-volatile storage for the computer. The storage device can store an operating system, programs, and data. The storage device can be connected to the computer through a storage controller connected toFiled: November 14, 2025 the chipset. The storage device can consist of one or more physical storage units. The storage controller can interface with the physical storage units through a serial attached small computer system interface (SCSI) (SAS) interface, a serial advanced technology attachment (SATA) interface, a fiber channel (FC) interface, or other type of interface for physically connecting and transferring data between computers and physical storage units.

[0139] The computer can store data on the storage device by transforming the physical state of the physical storage units to reflect the information being stored. The specific transformation of physical state can depend on various factors, in different embodiments of this description. Examples of such factors can include the technology used to implement the physical storage units, whether the storage device is characterized as primary or secondary storage, and the like.

[0140] For example, the computer can store information to the storage device by issuing instructions through the storage controller to alter the magnetic characteristics of a particular location within a magnetic disk drive unit, the reflective or refractive characteristics of a particular location in an optical storage unit, or the electrical characteristics of a particular capacitor, transistor, or other discrete component in a solid-state storage unit. Other transformations of physical media are possible without departing from the scope and spirit of the present description, with the foregoing examples provided only to facilitate this description. The computer can further read information from the storage device by detecting the physical states or characteristics of one or more particular locations within the physical storage units.

[0141] In addition to the storage device described above, the computer can have access to other computer-readable storage media to store and retrieve information, such as program modules, data structures, or other data. It should be appreciated by those skilled in the art that computer-readable storage media is any available media that provides for the non-transitory storage of data and that can be accessed by the computer. In some examples, the operations performed by any network node described herein may be supported by one or more devices similar to computer. Stated otherwise, some or all of the operations performed by a network node may be performed by one or more computer devices operating in a cloud-based arrangement.

[0142] By way of example, computer-readable storage media can include volatile and nonvolatile, removable and non-removable media implemented in any method or technology. Computer-readable storage media include RAM, ROM, erasable programmable ROM (“EPROM”), electrically-erasable programmable ROM (“EEPROM”), flash memory or other solid-state memory technology, compact disc ROM (“CD-ROM”), digital versatile disk (“DVD”), high definition DVD (“HD-DVD”), BLU-RAY, or other optical storage, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage devices, or any other medium that can be used to store the desired information in a non-transitory fashion.Filed: November 14, 2025

[0143] As mentioned briefly above, the storage device can store an operating system utilized to control the operation of the computer. According to one embodiment, the operating system includes a LINUX® operating system. According to another embodiment, the operating system includes the WINDOWS SERVER® operating system from MICROSOFT Corporation of Redmond, Washington. According to further embodiments, the operating system can include a UNIX® operating system or one of its variants. It should be appreciated that other operating systems can also be utilized. The storage device can store other system or application programs and data utilized by the computer.

[0144] In one embodiment, the storage device or other computer-readable storage media includes one or more programs. The programs, for example, include computer-executable instructions which, when loaded into the computer, transform the computer from a general-purpose computing system into a special-purpose computer capable of implementing the embodiments described herein. These computer-executable instructions transform the computer by specifying how the CPUs transition between states, as described above. According to one embodiment, the computer has access to computer-readable storage media storing computer-executable instructions which, when executed by the computer, perform the various processes described herein. The computer can also include computer-readable storage media having instructions stored thereupon for performing any of the other computer-implemented operations described herein. The program(s), for example, include one or more processes. The process(es) may include instructions that, when executed by the CPU(s), cause the computer and / or the CPU(s) to perform one or more operations.

[0145] The computer can also include one or more input / output controllers for receiving and processing input from a number of input devices, such as a keyboard, a mouse, a touchpad, a touch screen, an electronic stylus, or other type of input device. Similarly, an input / output controller can provide output to a display, such as a computer monitor, a flat-panel display, a digital projector, a printer, or other type of output device. It will be appreciated that the computer might not include all of the described components, can include other components that are not explicitly described, or might utilize an architecture completely different than that as described.

[0146] In some instances, one or more components may be referred to herein as “configured to,” “configurable to,” “operable / operative to,” “adapted / adaptable,” “able to,” “conformable / conformed to,” etc. Those skilled in the art will recognize that such terms (e.g., “configured to”) can generally encompass active-state components and / or inactive-state components and / or standby-state components, unless context requires otherwise.Filed: November 14, 2025

[0147] References1. Heitzer et al., Current and future perspectives of liquid biopsies in genomics-driven oncology. Nature Reviews Genetics, 2019. 20(2): p. 71-88.2. Ignatiadis et al., Liquid biopsy enters the clinic - implementation issues and future challenges. Nature Reviews Clinical Oncology, 2021. 18(5): p. 297-312.3. Tivey et al., Circulating tumour DNA - looking beyond the blood. Nature Reviews Clinical Oncology, 2022. 19(9): p. 600-612.4. Baca et al., Liquid biopsy epigenomic profiling for cancer subtyping. Nature Medicine, 2023. 29(11): p. 2737-2741.5. Doebley et al., A framework for clinical cancer subtyping from nucleosome profiling of cell-free DNA. Nature Communications, 2022. 13(1): p. 7475.6. Mathios et al., Detection and characterization of lung cancer using cell-free DNA fragmentomes. Nature Communications, 2021. 12(1): p. 5060.7. Sadeh et al., ChlP-seq of plasma cell-free nucleosomes identifies gene expression programs of the cells of origin. Nature Biotechnology, 2021. 39(5): p. 586-598.8. Ding & Lo, Cell-Free DNA Fragmentomics in Liquid Biopsy. Diagnostics, 2022. 12(4): p.978.9. Fullgrabe et al., Simultaneous sequencing of genetic and epigenetic bases in DNA.Nature Biotechnology, 2023.10. Huang & Wang, Cell-Free DNA Methylation Profiling Analysis-Technologies and Bioinformatics. Cancers (Basel), 2019. 11 (11).11. Lo et al., Epigenetics, fragmentomics, and topology of cell-free DNA in liquid biopsies.Science, 2021. 372(6538).12. Snyder et al., Cell-free DNA Comprises an In Vivo Nucleosome Footprint that Informs Its Tissues-Of-Origin. Cell, 2016. 164(1-2): p. 57-68.13. Tsoneva et al., Circulating Histones to Detect and Monitor the Progression of Cancer.Int J Mol Sci, 2023. 24(2).14. Liu etal., Sensitive and specific multi-cancer detection and localization using methylation signatures in cell-free DNA. Annals of Oncology, 2020. 31 (6): p. 745-759.15. Ulz et al., Inference of transcription factor binding from cell-free DNA enables tumor subtype prediction and early detection. Nature Communications, 2019. 10(1): p. 4666.16. Fedyuk et al., Multiplexed, single-molecule, epigenetic analysis of plasma-isolated nucleosomes for cancer diagnostics. Nature Biotechnology, 2023. 41(2): p. 212-221.17. Park et al., Electrostatic encoding of genome organization principles within single native nucleosomes. bioRxiv, 2023; Park eta / ., Nature, 643(8071 ):572-581, 2025.18. Sagar et al., Polyamines: Functions, Metabolism, and Role in Human Disease Management. Med Sci (Basel), 2021. 9(2).19. Raspaud et al., Spermine-induced aggregation of DNA, nucleosome, and chromatin.Biophys J, 1999. 77(3): p. 1547-55.20. Raspaud et al., Precipitation of DNA by polyamines: a polyelectrolyte behavior. Biophys J, 1998. 74(1): p. 381-93.21. Farr et al., Nucleosome plasticity is a critical element of chromatin liquid-liquid phase separation and multivalent nucleosome interactions. Nature Communications, 2021.12(1): p. 2883.22. Kang et al., Sequence-dependent DNA condensation as a driving force of DNA phase separation. Nucleic Acids Research, 2018. 46(18): p. 9401-9413.Filed: November 14, 2025 23. Yang et al., Computer modeling reveals that modifications of the histone tail charges define salt-dependent interaction of the nucleosome core particles. Biophys J, 2009.96(6): p. 2082-94.24. Fedyuk, V., et al., Multiplexed, single-molecule, epigenetic analysis of plasma-isolated nucleosomes for cancer diagnostics. Nature Biotechnology, 2023. 41(2): p. 212-221.25. Mattox et al., The Origin of Highly Elevated Cell-Free DNA in Healthy Individuals and Patients with Pancreatic, Colorectal, Lung, or Ovarian Cancer. Cancer Discov, 2023.13(10): p. 2166-2179.Select Additional References

[0148] International Patent Application Publication WO 2024 / 216205 (Methods and Systems for Cell-Free Nucleic Acid Processing)

[0149] US Patent Application Publication US 2023 / 0332206A1 (Methods and Systems for Analyzing Nucleic Acid Molecules)

[0150] US Patent Application Publication US 2022 / 0334128A1 (Method for the Enrichment of Circulating Tumor DNA)

[0151] US Patent Application Publication US 2020 / 0199656A1 (Cell-free DNA End Characteristics)

[0152] US Patent Application Publication US 2019 / 0338345A1 (Generating Cell-Free DNA Libraries Directly from Blood)

[0153] US Patent Application Publication US 2013 / 0230858A1 (Methods and Processes for Non-lnvasive Assessment of Genetic Variations)

[0154] International Patent Application Publication WO 2018 / 009723A1 (Methods for Fragmentome Profiling of Cell-Free Nucleic Acids)

[0155] Millan-Zambrano et al., “Histone post-translational modifications — cause and consequence of genome function” Nat. Rev. Genetics 23:563-580, 2022; nature.com / articles / s41576-022-00468-7

[0156] Rao et al., “Transcription factor-nucleosome dynamics from plasma cfDNA identifies ER-driven states in breast cancer” Science Adv. 8(34): 2022 DOIA: 10.1125 / sciadv.abm4358; science. org / doi / 10.1126 / sciadv.abm4358

[0157] Lau et al., “Single-molecule methylation profiles of cell-free DNA in cancer with nanopore sequencing” Genome Med. 15: 33, 2023; genomemedicine.biomedcentral.com / articles / 10.1186 / S13073-023-01178-3

[0158] Sadeh et al., “ChlP-seq of plasma cell-free nucleosomes identifies gene expression programs of the cells of origin” Nature Biotech. 39:586-598, 2021 ; nature.com / articles / s41587-020-00775-6

[0159] Ho etal., “Comparative analysis of metazoan chromatin organization” Nature 512:449- 452, 2014; nature.com / articles / nature13415Filed: November 14, 2025

[0160] Lu eta!., “The plant-specific histone residue Phe41 is important for genome-wide H3.1 distribution” Nat. Commun. 9:630, 2018; nature.com / articles / s41467-018-02976-9

[0161] International Patent Application Publication WO 2018 / 009723 (Methods of fragmentome profiling of cell-free nucleic acids)

[0162] US Patent No. 11 ,952,616 (Methods and Systems for analyzing nucleic acid molecules)

[0163] The Exemplary Embodiments and Example(s) provided herein are included to demonstrate particular embodiments of the disclosure. Those of ordinary skill in the art should recognize in light of the present disclosure that many changes can be made to the specific embodiments disclosed herein and still obtain a like or similar result without departing from the spirit and scope of the disclosure.First set of Exemplary Embodiments.

[0164] 1 . A method of phase separating fragmented DNA in a complex fluid sample, including: obtaining a complex fluid sample including fragmented DNA; adding a nucleic acid scaffold; subjecting the complex fluid sample to poly-cation molecule mediated condensation phase separation in the presence of the DNA scaffold, to produce a dilute phase and a condensed phase; substantially separating the dilute phase from the condensed phase; and extracting fragmented DNA from each of the dilute phase and the condensed phase.

[0165] 2. A non-invasive system to reconstruct epigenetic landscape, chromatin features, and / or regulatory elements from DNA in a complex fluid, including: obtaining a complex fluid sample including fragmented DNA; adding a nucleic acid scaffold; subjecting the complex fluid sample to poly-cation molecule mediated condensation phase separation in the presence of the DNA scaffold, to produce a dilute phase and a condensed phase; substantially separating the dilute phase from the condensed phase; extracting fragmented DNA from each of the dilute phase and the condensed phase; and characterizing the fragmented DNA to reconstruct the epigenetic landscape, the chromatin features, and / or the regulatory elements from the DNA.

[0166] 3. A method of detecting or diagnosing in a subject a disease or condition mediated by epigenetic modification of nucleosomes, the method including: obtaining a complex fluid sample including fragmented DNA; adding a nucleic acid scaffold; subjecting the complex fluid sample to poly-cation molecule mediated condensation phase separation in the presence of the DNA scaffold, to produce a dilute phase and a condensed phase; substantially separating the dilute phase from the condensed phase; extracting fragmented DNA from each of the dilute phase and the condensed phase; and analyzing the fragmented DNA to identify characteristics of a target disease or condition.Filed: November 14, 2025

[0167] 4. The method of any one of embodiments 1-3, wherein fragmented DNA extracted from the dilute phase is enriched for active chromatin regions and fragmented DNA extracted from the condensed phase is enriched for repressive chromatin regions.

[0168] 5. The method of any one of embodiments 1-3, wherein the poly-cation molecule used for condensation includes at least one of a polyamine, a positively charged peptide, protein, or protein domain.

[0169] 6. The method of embodiment 5, wherein the polyamine includes at least one of spermine, spermidine, or putrescine.

[0170] 7. The method of any one of embodiments 1-3, further including quantifying DNA fragments from the dilute phase, from the condensed phase, or from both.

[0171] 8. The method of any one of embodiments 1-3, wherein the quantifying includes one or more of a sequencing-based method, a PCR-based method, a fluorescent-quantification based method, or a spectroscopy-based method.

[0172] 9. The method of any one of embodiments 1-3, further including calculating a pseudoaccessibility score for DNA fragments from the dilute phase, from the condensed phase, or from both.

[0173] 10. The method of embodiment 9, wherein the pseudo-accessibility score is defined as differential enrichment of DNA at each genomic location between phases.

[0174] 11 . The method of any one of embodiments 1 -3, wherein the method is carried out with labeling any components in the complex fluid sample.

[0175] 12. The method of any one of embodiments 1-3, wherein the complex fluid sample includes fragmented DNA bound to one or more DNA binding proteins, fragmented DNA unbound by any DNA binding proteins, or both.

[0176] 13. The method of embodiment 12, wherein the one or more DNA binding proteins includes: at least one histone; at least two different histones; at least two differentially modified histones; or at least one DNA binding protein that is not a histone.

[0177] 14. The method of any one of embodiments 1 -3, wherein the fragmented DNA includes mammalian DNA, bird DNA, insect DNA, plant DNA, fungal DNA, bacterial DNA, viral DNA, or a mixture of two or more thereof.

[0178] 15. The method of any one of embodiments 1 -3, wherein the fragmented DNA includes at least one of cell-free DNA (cfDNA), cell-free nucleosomes (cf-nucleosomes), fragmented chromatin, fragmented extra-chromosomal DNA, or fragmented DNA unbound by any DNA binding proteins.

[0179] 16. The method of any one of embodiments 1-3, further including decondensing the condensed phase before extracting fragmented DNA from the condensed phase.Filed: November 14, 2025

[0180] 17. The method of embodiment 16, wherein decondensing the condensed phase includes at least one of heating the condensed phase, adding a chelator, or adding a high salt buffer.

[0181] 18. The method of embodiment 17, wherein at least one of: the heating occurs at 30-90°C for at least 5 minutes; the chelator includes ethylenediaminetetraacetic acid (EDTA), metachelate, egtazic acid (EGTA; ethylene glycol-bis(p-aminoethyl ether)-N,N,N',N'-tetraacetic acid), ethydronic acid (HEDP), diethylenetriaminepentaacetic acid (DTPA) nitrilotriacetic acid (NTA), iminodisuccinic acid (IDS), polyaspartic acid, S,S-ethylenediamine-N,N'-disuccinic acid (EDDS), methylglycinediacetic acid (MGDA), or L-Glutamic acid N,N-diacetic acid, tetrasodium salt (GLDA); or the high salt buffer includes at least 150 mM monovalent cation and / or at least 1 mM divalent cation.

[0182] 19. The method of any one of embodiments 1-3, wherein the nucleic acid scaffold includes naturally occurring or synthetic DNA or RNA molecules.

[0183] 20. The method of embodiment 19, wherein the nucleic acid scaffold includes one or more of: unbound DNA of at least 100 bases in length in linear, circular form, or both; DNA of any length bound to a solid substrate in linear, circular form, or both; unbound RNA of at least 100 bases in length; RNA of any length bound to a solid substrate; mono- or oligonucleosomes bound or unbound to a solid substrate; non-naturally occurring nucleic acids of at least 100 bases in length; non-naturally occurring nucleic acids of any length bound to a solid substrate; and multivalent and positively charged solid surface with or without bound nucleic acids.

[0184] 21. The method of embodiment 20, wherein the solid substrate includes a bead, such as a magnetic bead.

[0185] 22. The method of any one of embodiments 1-3, wherein the complex fluid sample includes naturally-occurring salt(s), and the method further includes diluting the sample prior to subjecting the complex fluid sample to poly-cation molecule mediated condensation phase separation, to produce a diluted sample.

[0186] 23. The method of embodiment 22, wherein the diluted sample includes no more than 150 millimolar monovalent and divalent cations, or at 25-75% concentration of the undiluted (e.g., original) complex liquid sample.

[0187] 24. The method of any one of embodiments 1-3, wherein the complex fluid sample includes: a bodily fluid sample; an agricultural sample; an archaeological sample; or a forensic samples.

[0188] 25. The method of any one of embodiments 1-3, further including adding one or more contrast modulators before subjecting the complex fluid sample to poly-cation molecule mediated condensation phase separation.Filed: November 14, 2025

[0189] 26. The method of embodiment 25, wherein the one or more contrast modulators include: a histone-modification-specific binding molecule; a DNA binding molecule; a nucleosome binding molecule; achromatin binding molecule; a modified histone; or a complex of two or more proteins including at least one of these.

[0190] 27. The method of embodiment 26, wherein the histone-modification-specific binding molecule includes a histone modification binding antibodies, a bromo-domain protein, or a chromo-domain protein.

[0191] 28. The method of any one of embodiments 1-3, wherein poly-cation molecule mediated condensation phase separation includes: gravity-based separation of phases; or solid surface-based separation of phases.

[0192] 29. The method of embodiment 28, wherein gravity-based separation of phases includes centrifugal separation.

[0193] 30. The method of embodiment 28, wherein solid surface-based separation of phases includes bead capture, such as magnetic bead capture.

[0194] 31 . The method of embodiment 28, including solid surface-based separation of phases, wherein at least a portion of the nucleic acid scaffold is bound to the solid surface.

[0195] 32. The method of embodiment 31 , wherein the nucleic acid scaffold is covalently bound to the solid surface.

[0196] 33. The method of any one of embodiment 30-32, further including adding polyethylene glycol (PEG) or another crowding polymer to the complex fluid sample before subjecting the complex fluid sample to poly-cation molecule mediated condensation phase separation.

[0197] 34. The method of any one of embodiments 1-33, for use in: health surveillance; disease surveillance; disease diagnosis; molecular subtyping; treatment stratification; treatment selection; clinical decision making; predicting treatment response; monitoring treatment response; genome characterization; or drug discovery or characterization.

[0198] 35. A database including DNA fragment sequences produced by the method of embodiment 8.

[0199] 36. A method to differentially enrich for epigenetic states in cell free DNA (cfDNA) in a complex fluid sample, including: obtaining a complex fluid sample including cfDNA; subjecting the complex fluid sample to poly-cation-mediated condensation phase separation in the presence of an excess of nucleic acid scaffold, to produce a dilute supernatant phase and a condensed phase; substantially separating the dilute supernatant phase from the condensed phase; and extracting cfDNA from each of the dilute supernatant phase and the condensed phase; wherein cfDNA extracted from the dilute supernatant phase is enriched for active chromatin regions and cfDNA extracted from the condensed phase is enriched for repressive chromatin regions.Filed: November 14, 2025

[0200] 37. The method of embodiment 36, wherein cfDNA extracted from the dilute phase is enriched for active chromatin regions and cfDNA extracted from the condensed phase is enriched for repressive chromatin regions.Second set of Exemplary Embodiments.

[0201] 1 . A method for DNA analysis in a complex fluid, including: obtaining a complex fluid sample including fragmented genomic DNA; adding a DNA-capture scaffold to the complex fluid sample; subjecting the complex fluid sample to poly-cation molecule mediated phase separation in the presence of the DNA-capture scaffold, to produce a dilute phase and a condensed phase; substantially separating the dilute phase from the condensed phase, thereby separating the fragmented genomic DNA into dilute phase DNA and condensed phase DNA; and analyzing the dilute phase DNA and the condensed phase DNA, wherein the analyzing includes detecting and / or measuring at least one characteristic of each of the dilute phase DNA and the condensed phase DNA and generating a comparison of the at least one DNA characteristic between the phases.

[0202] 2. The method of embodiment 1 , further including calculating a pseudo-accessibility score at one or more genomic locations based on differential enrichment of DNA between the dilute phase and the condensed phase for DNA fragments at the one or more genomic locations.

[0203] 3. A method of phase separating fragmented DNA in a complex fluid sample, including: obtaining a complex fluid sample including fragmented DNA; adding a capture scaffold; subjecting the complex fluid sample to poly-cation molecule mediated phase separation in the presence of the scaffold, to produce a dilute phase and a condensed phase; substantially separating the dilute phase from the condensed phase; and extracting DNA from each of the dilute phase and the condensed phase.

[0204] 4. A minimally-invasive system to reconstruct epigenetic landscape, chromatin features, and / or regulatory elements from DNA in a complex fluid, including: obtaining a complex fluid sample including fragmented DNA; adding a capture scaffold; subjecting the complex fluid sample to poly-cation molecule mediated phase separation in the presence of the scaffold, to produce a dilute phase and a condensed phase; substantially separating the dilute phase from the condensed phase; extracting DNA from each of the dilute phase and / or the condensed phase; and characterizing the DNA to reconstruct the epigenetic landscape, the chromatin features, and / or the regulatory elements from the DNA.

[0205] 5. A method of detecting, diagnosing, and / or molecularly characterizing a disease or condition in a subject, the method including: obtaining a complex fluid sample including fragmented DNA; adding a capture scaffold; subjecting the complex fluid sample to poly-cation molecule mediated condensation phase separation in the presence of the scaffold, to produceFiled: November 14, 2025 a dilute phase and a phase; substantially separating the dilute phase from the condensed phase; extracting DNA from the dilute phase and / or the condensed phase; and analyzing the DNA to identify characteristics of a target disease or condition.

[0206] 6. The method of embodiments 1-5, wherein characterizing or analyzing the DNA includes performing fragmentomics analysis on DNA from the dilute phase, DNA from the condensed phase, or DNA from each of the dilute phase and the condensed phase.

[0207] 7. The method of embodiment 6, wherein the fragmentomics analysis includes analysis of one or more of: fragment length in the dilute phase, the condensed phase, or the dilute phase and condensed phase; ratio of fragment lengths in the dilute phase, the condensed phase, or the dilute phase and condensed phase; variance of fragment lengths in the dilute phase, the condensed phase, or the dilute phase and condensed phase: fragment location in the genome, or in different regions across chromosomes, the dilute phase, the condensed phase, or the dilute phase and condensed phase; fragment abundance in the dilute phase, the condensed phase, or the dilute phase and the condensed phase:, and end motif analysis of the fragments, such as determination of end locations within the genome, in the dilute phase, the condensed phase, or the dilute phase and condensed phase.

[0208] 8. A method to differentially enrich for epigenetic states in cell free DNA (cfDNA) present in a complex fluid sample, including: obtaining a complex fluid sample including cfDNA; subjecting the complex fluid sample to poly-cation-mediated phase separation in the presence of a capture scaffold, to produce a dilute supernatant phase and a condensed phase; substantially separating the dilute supernatant phase from the condensed phase; and optionally extracting cfDNA from each of the dilute supernatant phase and the condensed phase; wherein cfDNA from the dilute supernatant phase is enriched for active chromatin regions and cfDNA from the condensed phase is enriched for repressive chromatin regions.

[0209] 9. The method of any one of embodiments 1 -5, 7, or 8, wherein cfDNA or fragmented DNA in each phase is enriched for one or more characteristics of the genome.

[0210] 10. The method of any one of embodiments 1 -5, 7, or 8, wherein cfDNA or fragmented DNA in one phase is enriched for active chromatin regions and fragmented DNA in the other phase is enriched for repressive chromatin regions.

[0211] 11 . The method of embodiment 10, wherein cfDNA or fragmented DNA extracted from the dilute phase is enriched for active chromatin regions, and cfDNA or fragmented DNA extracted from the condensed phase is enriched for repressive chromatin regions.

[0212] 12. The method of any one of embodiments 1-5, 7, or 8, wherein the poly-cation molecule used for condensation includes at least one of a polyamine, a positively charged peptide, a positively charged protein, or a positively charged protein domain.

[0213] 13. The method of embodiment 12, wherein the polyamine includes at least one of spermine, spermidine, or putrescine.Filed: November 14, 2025

[0214] 14. The method of any one of embodiments 1-5, 7, or 8, further including quantifying DNA fragments from the dilute phase, from the condensed phase, or from both phases.

[0215] 15. The method of any one of embodiments 1-5, 7, or 8, wherein quantifying includes one or more of a sequencing-based method, a PCR-based method, a fluorescent-quantification based method, or a spectroscopy-based method.

[0216] 16. The method of any one of embodiments 1-5, 7, or 8, further including calculating a pseudo-accessibility score for cfDNA or DNA fragments from the dilute phase, from the condensed phase, or from both.

[0217] 17. The method of embodiment 16, wherein the pseudo-accessibility score is defined as differential enrichment of DNA at each genomic location between phases.

[0218] 18. The method of any one of embodiments 1 -5, 7, or 8, wherein the method is carried out with labeling any components in the complex fluid sample.

[0219] 19. The method of any one of embodiments 1-5, 7, or 8, wherein the complex fluid sample includes cfDNA or fragmented DNA bound to one or more DNA binding proteins, cfDNA or fragmented DNA unbound by any DNA binding proteins, or both.

[0220] 20. The method of embodiment 19, wherein the one or more DNA binding proteins includes: at least one histone; at least two different histones; at least two differentially modified histones; or at least one DNA binding protein that is not a histone.

[0221] 21. The method of any one of embodiments 1-5, 7, or 8, wherein the cfDNA or fragmented DNA includes mammalian DNA, bird DNA, insect DNA, plant DNA, fungal DNA, or a mixture of two or more thereof.

[0222] 22. The method of any one of embodiments 1-5, 7, or 8, wherein the cfDNA or fragmented DNA includes at least one of cell-free DNA (cfDNA), cell-free nucleosomes (cf-nucleosomes), fragmented chromatin, fragmented extra-chromosomal DNA, or fragmented DNA unbound by any DNA binding proteins.

[0223] 23. The method of any one of embodiments 1-5, 7, or 8, further including decondensing the condensed phase before extracting fragmented DNA from the condensed phase.

[0224] 24. The method of embodiment 23, wherein decondensing the condensed phase includes at least one of heating the condensed phase, adding a chelator, or adding a high salt buffer.

[0225] 25. The method of embodiment 24, wherein at least one of: the heating occurs at 30-90°C for at least 5 minutes; the chelator includes ethylenediaminetetraacetic acid (EDTA), metachelate, egtazic acid (EGTA; ethylene glycol-bis(p-aminoethyl ether)-N,N,N',N'-tetraacetic acid), ethydronic acid (HEDP), diethylenetriaminepentaacetic acid (DTPA) nitrilotriacetic acid (NTA), iminodisuccinic acid (IDS), polyaspartic acid, S,S-ethylenediamine-N,N'-disuccinic acid (EDDS), methylglycinediacetic acid (MGDA), or L-Glutamic acid N,N-Filed: November 14, 2025 diacetic acid, tetrasodium salt (GLDA); or the high salt buffer includes at least 150 mM monovalent cation and / or at least 1 mM divalent cation.

[0226] 26. The method of any one of embodiments 1-5, 7, or 8, wherein the capture scaffold includes: a nucleic acid or a solid surface substantially non-reactive or reversibly reactive to DNA; or naturally occurring or synthetic DNA or RNA molecules.

[0227] 27. The method of embodiment 26, wherein the scaffold includes one or more of: unbound DNA of at least 100 bases in length in linear form, circular form, or both; DNA of any length bound to a solid substrate in linear form, circular form, or both; unbound RNA of at least 100 bases in length; RNA of any length bound to a solid substrate; mono- or oligonucleosomes bound or unbound to a solid substrate; non-naturally occurring nucleic acids of at least 100 bases in length; non-naturally occurring nucleic acids of any length bound to a passivated or unpassivated solid substrate; solid surface substantially non-reactive or reversibly reactive to DNA, optionally coated with a passivating substance; and solid surface with or without bound nucleic acids.

[0228] 28. The method of embodiment 27, wherein the solid substrate includes a bead, such as a magnetic bead.

[0229] 29. The method of any one of embodiments 1-5, 7, or 8, wherein a solid surface is used and characterization or analysis of the separated DNA includes direct measurement of or amplification of sequences of DNA bound to the solid surface.

[0230] 30. The method of any one of embodiments 1-5, 7, or 8, wherein the complex fluid sample includes naturally-occurring salt(s), and the method further includes diluting the sample prior to subjecting the complex fluid sample to poly-cation molecule mediated phase separation, to produce a diluted sample.

[0231] 31 . The method of embodiment 30, wherein the diluted sample includes no more than 150 millimolar monovalent and divalent cations, or at 25-75% concentration of the complex fluid sample before dilution.

[0232] 32. The method of any one of embodiments 1-5, 7, or 8, wherein the complex fluid sample includes: a bodily fluid sample; a clinical sample; a laboratory sample; an environmental sample; an agricultural sample; an archaeological sample; or a forensic sample.

[0233] 33. The method of any one of embodiments 1-5, 7, or 8, further including adding one or more contrast modulators before subjecting the complex fluid sample to poly-cation molecule mediated phase separation.

[0234] 34. The method of embodiment 33, wherein the one or more contrast modulators include: a histone-modification-specific binding molecule; a DNA binding molecule; a nucleosome binding molecule; a chromatin binding molecule; a modified histone; or a complex of two or more proteins including at least one of these.Filed: November 14, 2025

[0235] 35. The method of embodiment 34, wherein the histone-modification-specific binding molecule includes a histone modification binding antibody, a bromo-domain protein, or a chromo-domain protein.

[0236] 36. The method of any one of embodiments 1 -5, 7, or 8, wherein poly-cation molecule mediated phase separation includes: gravity-based separation of phases; or solid surfacebased separation of phases.

[0237] 37. The method of embodiment 36, wherein gravity-based separation of phases includes centrifugal separation.

[0238] 38. The method of embodiment 36, wherein solid surface-based separation of phases includes bead capture, such as magnetic bead capture.

[0239] 39. The method of embodiment 36, including solid surface-based separation of phases, wherein at least a portion of the capture scaffold is nucleic acid bound directly or indirectly to the solid surface.

[0240] 40. The method of embodiment 39, wherein the nucleic acid is covalently bound to the solid surface.

[0241] 41. The method of any one of embodiment 38-40, further including adding polyethylene glycol (PEG) or another crowding polymer or passivating agent to the complex fluid sample before subjecting the complex fluid sample to poly-cation molecule mediated phase separation.

[0242] 42. The method of any one of embodiments 1-41 , for use in: health surveillance; disease surveillance; disease diagnosis; molecular subtyping; treatment stratification; treatment selection; clinical decision making; predicting treatment response; monitoring treatment response; genome characterization; or drug discovery or characterization.

[0243] 43. A database including DNA fragment sequences or cfDNA sequences produced by a sequencing method of embodiment 15.

[0244] 44. A method for characterizing an epigenetic landscape in a complex fluid, essentially as described herein.

[0245] 45. A kit for carrying out the method of any one of embodiments 1-43, including at least one of: a nucleic acid scaffold; a phase separation contrast modulator; a DNA condensation agent; or a fragmented DNA control sample.

[0246] 46. A system to phase separate DNA from a complex biological or other complex fluid sample, the system including: a sample isolation device, which is adapted to isolate a biological sample from a subject; a separation device, which is adapted to subject the complex fluid sample to poly-cation molecule mediated condensation phase separation in the presence of a scaffold, to produce a dilute phase and a condensed phase; one or more DNA analysis devices, which is / are adapted to analyze and / or characterize DNA in the dilute and condensed phases, thereby obtaining one or more DNA information results; and an alignment device,Filed: November 14, 2025 which is adapted to align one or more of the DNA information results between the dilute and condensed phases in order to determine or provide a pseudo-accessibility score for one or more locations within a DNA genome based on the alignment result.

[0247] 47. The system of embodiment 46, wherein at least one DNA analysis device is a sequencing device.

[0248] 48. The system of embodiment 46, wherein the complex biological or other complex fluid sample includes a substantially unpurified bodily fluid from a subject, such as a human or other mammalian subject.

[0249] 49. The system of any one of embodiments 46-48, further including an information delivery device capable of delivering to a receiver information about the results of the analysis.

[0250] 50. The system of embodiment 49, wherein the information includes one or more of: identity and / or relative or absolute quantity of DNA fragments mapping to a specified locus within a genome, proportional amount of any such locus that is found in the dilute and condensed phases from an analyzed sample, and fragmentomic information about DNA in the dilute and condensed phases.ExamplesExample 1 : Epigenetic dependence of DNA and nucleosome phase separation induced by polyamines.

[0251] Described in this Example is development of an assay that mimics polyamine-DNA interactions outside of the cell and applies it as a tool to analyze the circulating epigenetic landscape.

[0252] Synthetically modified H3K27ac, H3K9ac, H3K9me3, H3K4me3, H3K27me3, H3K9me2, unmodified mononucleosomes, and tailless mononucleosomes were purchased from EpiCypher. Prior to phase separation, 10 pl of each nucleosome type was dialyzed for at least 1 hour against 10 mM Tris pH 7.20.1 mM EDTA at 4°C in 7 kDa cutoff dialysis buttons. Following dialysis, nucleosomes were diluted 10-fold into nuclease free water with a final concentration of 25 ng DNA / pl and kept on ice.

[0253] Methylated DNA was prepared by 12-hour incubation at 37QC of 5 pg of Widom 601 DNA, 1X NEBuffer-2, 0.32 mM S-adenosylmethionine (SAM), and 30 units of CpG Methyltransferase (M.Sssl) in a 100 pl reaction. At two hours and four hours into the incubation, the reaction was supplemented with an additional 1 pl 32 mM SAM and 24 units of M.Sssl. Following incubation, the methylated 601 DNA was purified using the Qiagen PGR Purification Kit. Successful methylation was confirmed by BstUI digestion (1 pg methylated DNA, 1x rCutSmart Buffer, 10 units BstUI) incubated for 1-hour at 60eC followed by 1% agarose gel-electrophoresis where non-fragmented bands indicate a fully methylated product.Filed: November 14, 2025

[0254] Phase separation was performed by mixing 8 pl of 25 ng / .1 nucleosomes or 8 pl of 25 ng / pl methylated DNA by pipette with 2 pl of 5X phase separation buffer (0-5 mM spermine, 50 mM NaCI, 10 mM Tris pH 7.2, 1 mM EDTA). The reaction was incubated at room temperature for 5 minutes followed by centrifugation at 18,400 x g for 5 minutes at room temperature. Nucleosome phase separation was measured by 5% polyacrylamide gelelectrophoresis using 8 pl of the resulting supernatant. Gel-band fluorescence was measured using ImageJ, where bands which ran at 150 bp, as compared to a NEB low molecular weight ladder (25 bp-766 bp), were considered free DNA and bands which ran at 300 bp were considered intact nucleosomes. The fluorescences of the nucleosome and free DNA fractions were individually normalized to a corresponding 0 mM spermine phase separation control that represented the total gel input per sample. Methylated DNA phase separation was measured by supernatant Nanodrop spectrophotometry. This data is shown in FIGs. 2A-2D. FIG. 2A compares the mean nucleosome and bare DNA phase separation from 0 mM to 1 mM spermine concentrations across all modification types tested. FIG. 2B compares the phase separation of unmethylated and methylated DNA. FIGs. 20, 2D compare the phase separation between epigenetically modified nucleosomes.

[0255] The data shows that nucleosomes require significantly less polyamine to phase separate out of the supernatant compared to bare DNA, evident by the sharp decrease in nucleosomes with increasing polyamine concentration (FIG. 2A). Previous studies show that methylated DNA is more conducive to polyamine-induced phase separation and that differential phase separation between modified nucleosomes may occur [22, 23]. The results corroborate previous findings that bare methylated DNA more readily enters the condensed phase (pellet) compared to un-methylated DNA (FIG. 2B). Further, the data suggests nucleosomes with methyl modifications are more depleted from the supernatant while those modified by acetylation are enriched (FIGs. 2C, 2D). The synthetic tailless nucleosome control, which have their lysine tails enzymatically removed, are resistant to phase separation -suggesting this effect is specifically dependent upon the lysine tails and their modifications. Together, these data suggest polyamine acts as a chemical sensor that enables differential enrichment of epigenetic modifications.

[0256] As described herein, this phase separation technique has been extensively developed specifically for analysis of complex bodily fluid at genome-scale, including through a series of critical findings that have provided specific embodiments of the CHROMAPS method.Example 2: Phase separation of DNA directly in plasma.

[0257] This example describes development of a cell-free nucleosome phase separation system that overcomes major challenges to such assays in complex, minimally or nonfractionated, unconcentrated, and / or unpurified bodily fluids. These challenges include (1)Filed: November 14, 2025 inhibition of fluid contents (salts, biological molecules, and the like) and collection preservatives; (2) recovery of DNA from the pellet; and (3) low abundance of native cf-nucleosomes in unconcentrated biological fluids, such as naturally occurring biological specimens. A protocol is formulated to effectively phase separate low abundancy, native cell-free nucleosomes and DNA directly in bodily fluids (and other complex fluid samples); embodiments of this protocol are described in detail herein.

[0258] The following experimental steps were employed to develop embodiments of the CHROMAPS methods:

[0259] Optimization of phase separation for performance in plasma was carried out by systematically testing EDTA concentration, required plasma dilution, proper pH, recovery of the pellet, and the effect of DNA length on phase separation efficiency. EDTA inhibition was tested using 150 bp Widom 601 DNA at 25 ng / pil with varying amounts of EDTA and MgCI2in solution. Phase separation was then performed as described in Example 1 , with 0 mM, 1 mM, or 5 mM spermine. The supernatant was measured using Nanodrop spectrophotometry following phase separation and each sample was normalized to a 0 mM spermine control.

[0260] The optimum pH and dilution of plasma was found by spiking-in 601 Widom DNA into a range of diluted wildtype mouse plasma samples, all at a final concentration of 25 ng / pl DNA. Phase separation was performed of each sample with indicated pH buffers, where the DNA concentration in the supernatant was measured by Qubit fluorometry. Tris buffer was adjusted to the target pH using either 1 N HOI or 1 N NaOH. All final supernatant Qubit values were first corrected by the value of a plasma blank then normalized to a 0 mM spermine control.

[0261] For pellet recovery, all supernatant was removed, and the pellet was washed with freshly made 75% ethanol, then re-centrifuged at 18,400 x g for 5 minutes. Ethanol was then removed and the pellet allowed to dry for 15 minutes at room temp. The pellet was then resuspended in 10 mM Tris pH 7.2 or 10 mM Tris pH 7.2 5 mM EDTA and either measured immediately or subjected to heat treatment of 37SC for 15 minutes. Corresponding data is shown in FIGs. 3A-3D, where MgCI2rescued (that is, overcame) EDTA phase separation inhibition when added at equimolar amounts to EDTA ; Bis-Tris pH 6.5 yields 100% phase separation of all spike-in DNA when plasma is diluted by 50%; and 10 mM Tris 5 mM EDTA with heat treatment (37eC 15 minutes) results in pellet recovery of >90%.

[0262] The phase separation of varying lengths of DNA was tested by spiking in 100 ng of NEB low molecular weight ladder into 200 pl of wildtype mouse plasma. Phase separation was performed directly on the plasma by adding phase separation buffer without NaCI (1 mM spermine, 10 mM Tris pH 7.2), mixing by pipette, and incubating at room temperature for 5 minutes. The sample was then centrifuged at 18,400 x g for 5 minutes and the supernatant removed. The pellet was recovered by first washing with 75% ethanol and re-centrifuging at 18,400 x g for 5 minutes. The ethanol was then removed and the pellet left to air dry for 15Filed: November 14, 2025 minutes. The pellet was resuspended in 10 mM Tris 5 mM EDTA and incubated at 37fiC for 15 minutes. The pellet DNA concentration and size was either immediately measured by gelcapillary electrophoresis (Agilent High Sensitivity DNA Kit) or subjected to proteinase K digestion (0.3 mg total) at 56QC for 10 minutes followed by AMPURE DNA purification using a 2X bead ratio. The resulting pellet DNA concentration and size was then measured by gelcapillary electrophoresis. The corresponding data is shown in FIG. 4A. This procedure was repeated with either Bis-Tris pH 6.5 phase separation buffer, 55% diluted wildtype mouse plasma, or the combination of both Bis-Tris pH 6.5 and dilution, as shown in FIG. 4B. The phase separation of the NEB low molecular weight ladder was also performed in nuclease-free water as described in Example 1. The resultant size and concentration of supernatant DNA was analyzed by 5% polyacrylamide gel-electrophoresis. Each band was quantified by fluorescence and normalized to a 0 mM spermine control. Different length DNA fragments were also tested in isolated reactions. Each fragment (150 bp, 300 bp, and 766 bp) was generated by PGR of human template DNA and subject to phase separation as described in Example 1. The resultant supernatant was measured by Qubit fluorometry and normalized to a 0 mM spermine control. Corresponding data is shown in FIGs. 4C, 4D, and 4E.

[0263] Based on the results described above, the following conditions are considered useful for polyamine-mediated phase separation directly from / in plasma: Bis-Tris pH 6.5 buffer, dilution of 50%, and pellet recovery with 10 mM Tris 5 mM EDTA at 37SC for 15 minutes followed by proteinase K digestion. However, these conditions do not induce satisfactory phase separation of extremely low concentration endogenous cf-nucleosomes (approximately 10 pg / pl) in plasma.

[0264] Concluding that phase separation efficiency increases with DNA length, a 766 bp filler spike-in DNA fragment was created to act as a capture scaffold. Phase separation was performed directly in wildtype mouse plasma that was processed from EDTA tube collected whole blood by centrifugation twice; first at 1000 x g for 10 minutes, then at 2500 x g for 10 minutes at room temperature. 100 ng of the 766 bp DNA spike-in was mixed with 1 ml of 50% diluted wildtype mouse plasma with phase separation buffer to final concentrations of 10 mM Bis-Tris pH 6.5 and 1 mM spermine. The solution was mixed by pipette, then incubated at room temperature for 10 minutes followed by room temperature centrifugation at 18,400 x g for 10 minutes. The supernatant was fully removed and the pellet washed with 75% ethanol then re-centrifuged at 18,400 x g for 10 minutes. The ethanol was removed and 75% ethanol added to complete two washes of the pellet. Finally, all ethanol was removed and the pellet left to dry for 15 minutes. The pellet was then resuspended in 10 mM Tris 5 mM EDTA buffer and incubated for 15 minutes at 37SC. Proteinase K was then added (0.3 mg total) and the solution incubated at 56eC for 10 minutes. The resulting recovered pellet DNA was purified by 2X AM Pure bead purification followed by a 0.6X AMPURE size selection with a final elution inFiled: November 14, 2025 10 |_il of nuclease free water. The pellet elution was analyzed by gel-capillary electrophoresis and PCR of housekeeping genes (ACTB, PSAT1 , and B2M) to confirm phase separation of endogenous cfDNA and cf-nucleosomes. This data is shown in FIG. 4F.

[0265] (1): Inhibition of plasma contents. Plasma contains a mixture of physiological salts, proteins, and preservative chemicals coated on standard collection tubes including high amounts of NaCI, CaCI2, albumin, IgGs, and EDTA. However, polyamine-mediated DNA phase separation is governed by electrostatic interactions which these solvents significantly alter. Because of this, previously standard methods of polyamine-mediated DNA phase separation do not perform in patient samples. To determine and attenuate the inhibitory effects these solvents have on polyamine-induced phase separation, phase separation was performed of synthetic DNA which was spiked in over a titration of plasma. Further, varying polyamine buffers were utilized to find optimal parameters for phase separation in varying dilutions of plasma (FIGs. 3A-3D). EDTA was found to be a primary inhibitory component; yet it is a gold standard for coating commercially available anticoagulation tubes designed for the preservation of cfDNA. This inhibition can be reversed by the addition of an approximate equimolar amount of MgCI2to saturate the EDTA by chelation, thereby recovering the phase separation effect (FIG. 3A).

[0266] The titration data show that plasma dilution alone increases phase separation efficiency to a level where only 30% of the total DNA remains in the supernatant near 50% plasma dilution (FIG. 3B).

[0267] The addition of Tris buffer, which controls pH, greatly improves phase separation efficiency in dilute plasma. To further investigate the effect of pH, the polyamine buffer pH was varied from 3.4 to 9.4 and it was found that Bis-Tris pH 6.5 polyamine buffer with 55% dilution of plasma yields complete depletion of synthetic DNA spike-in from the supernatant (FIG. 3C).

[0268] (2): Recovery of DNA in the pellet. To recover DNA which is condensed in the pellet, conditions have been optimized to reverse the polyamine-DNA complexation. Buffer conditions that maximize recovery were first identified utilizing synthetic DNA which was phase separated in water. It was found that ethanol washed pellet resuspended in 10 mM Tris pH 7.2 and 5 mM EDTA yields 30% recovery (FIG. 3D). Addition of heat treatment with the Tris / EDTA buffer improved DNA recovery from the pellet to more than 90%.

[0269] These optimized buffer conditions were then utilized to recover a pelleted synthetic DNA ladder spike-in from plasma. Using a ladder enabled investigating the phase separation efficiency and recovery of varying lengths of DNA. It was found that plasma proteins condense with the DNA in a complex. This can be effectively disassociated by performing a protein digestion followed by DNA purification (FIG. 4A).Filed: November 14, 2025

[0270] The combined optimum conditions to perform phase separation in plasma were benchmarked against standard polyamine-mediated phase separation in water. This was done by measuring the pellet recovery of a high concentration DNA ladder spike-in to either water or plasma by gel-capillary electrophoresis. Phase separation and recovery of the subsequent pellet are indistinguishable between the water control and plasma when Bis-Tris pH between 6 - 8 and protein digestion were utilized (FIG. 4B).

[0271] (3): Low abundance of native cf-nucleosomes in plasma. The concentrations of cfDNA, which exist in blood as cf-nucleosomes, in healthy patient plasma is typically between 1-10 ng / ml

[0025] . This is 104times less concentrated than the DNA concentration of previously reported phase separation methods. To phase separate these low abundance cf-nucleosomes from plasma, a DNA scaffold was spiked into the plasma to increase phase separation efficiency. This was improved by determining that longer DNA (>500 bp) is more conducive to phase separation compared to short DNA (<100 bp) when in solution together as can be seen in FIGs. 4G and 4D. This is further exemplified when each length of DNA is phase separated in isolated reactions where short DNA requires a significantly higher polyamine concentration to phase separate as compared to longer fragments (FIG. 4E). Thus, this nucleic acid (e.g., RNA or DNA) scaffold has been designed to be long relative to the characteristic size of cfDNA (e.g., at least 2 times or usually at least 4 times longer than the cfDNA, which is —160 base pairs; thus, scaffold nucleic acids can be as short as 350 base pairs, more normally at least 750 base pairs, though considerably longer nucleic acids are contemplated, including 1000 base pairs or more, such as 2500 base pairs or longer) and find that endogenous cfDNA can be phase separated and recovered from plasma (or other complex fluids) only by addition of this scaffold (FIG. 4F). This is evident by the amplification of housekeeping genes within the phase separated pellet which is comparable to a standard cfDNA extraction kit and by the lack of amplification of the DNA scaffold added to the plasma.Example 3: Genome-wide determination of chromatin state from cf-nucleosomes in cell culture media

[0272] This example describes the development and subsequent analysis of performing cf-nucleosome polyamine-mediated phase separation directly within a complex fluid at genome scale by incorporation of whole genome sequencing. The methods described herein allow recapitulation of the intracellular epigenetic landscape from fragmented cell-free chromatin.

[0273] Triple negative breast cancer cells, MDA-MB-231 , were cultured to ATCC recommendations in 10% FBS 1% penicillin / streptomycin DMEM culture medium at 37eC with 5% CO2. Conditioned media was collected at 80% confluency and centrifuged first at 2500 x g 4eC for 10 minutes then centrifuged again at 16,100 x g 4SC for 10 minutes. The media was then 0.22 pm filtered to ensure the removal of any cell debris. To generate mononucleosomes,Filed: November 14, 2025 Mnase was added directly to 0.5 ml of spun and filtered media to a final concentration of 40 U / ml and incubated at 37SC for 1 hour. Immediately following this incubation, phase separation was performed as described in Example 2 (CHROMAPS Method) with specific modifications as follows. No long DNA spike-in fragment was used, and following the removal of supernatant, 5 mM EDTA was added to both the supernatant and pellet to quench the Mnase reaction.

[0274] cfDNA was purified from the supernatant using the Zymo Quick cfDNA Serum & Plasma Kit following manufacturer’s instructions and DNA was purified from the pellet by 2X AMPURE bead purification. As comparison to the provided CHROMAPS method, mononucleosomes were isolated and purified from cell nuclei using the Active Motif Nucleosome Preparation Kit with a final elution in 10 mM Tris pH 7.2 1 mM EDTA at a DNA concentration of 25 ng / pl. Phase separation of isolated mononucleosomes was performed in a 10 pl reaction as described in Example 1 with 1 mM spermine, no long DNA spike-in fragment, and pellet recovery by resuspension in 10 mM Tris pH 7.25 mM EDTA.

[0275] Sequencing libraries of the purified supernatant and pellet cfDNA from both methods were generated using the Takara ThruPLEX DNA-Seq and Unique Dual Index Kits following manufacturer’s instructions with eight cycles of library amplification. Quality of all libraries was ensured by bioanalyzer and Qubit. The libraries were sequenced at 25X whole genome coverage with 150 bp paired-end reads using a NovaSeq X sequencer. Reads were quality trimmed and adapters removed with fastp (ver 0.23.2) and then were aligned to hg19 with minimap2 (ver 2.26). Secondary alignments were then removed, and only properly paired reads which had mapping quality greater than 30 were kept. Duplicates were removed using Picard (ver 1.119) and ENCODE blacklisted regions were removed with bedtools2 (ver 2.31.1).

[0276] Pseudo-accessibility score was calculated using deeptools bamCompare (ver 3.5.2) with readCount normalization to account for sequencing depth differences. MDA-MB-231 ATAC-seq data was gathered from Gene Expression Omnibus: GSE129647 (Cai, W.L. et al. BMC Med Genomics 2020). Transcription start sites (Assembly: hg19, Track: SwitchGear TSS, Table: switchDbTss), ChromHMM annotated chromatin states of HMEC cells (Assembly: hg19, Track: Broad ChromHMM, Table: HMEC ChromHMM), and transcription factor binding sites of FOSL1 , ESR1 , and FOXA1 (Assembly: hg19, Track: Txn Factr ChIP E3, Table: encRegTfbsClustered) were downloaded from the UCSC Genome Browser.

[0277] Data is shown in FIGs. 6B-6D and 7A-7C. FIGs. 6B and 6C show the pseudoaccessibility of the media cf-nucleosomes across chromosome 2, as compared to ATAC-seq and across all TSS of chromosome 2, respectively. FIG. 6D shows the pseudo-accessibility averaged over select chromatin states as defined by ChromHMM. FIGs. 7A-7C displayFiled: November 14, 2025 averaged transcription factor binding site ATAC-seq, previous isolated mononucleosome phase separation, and CHROMAPS pseudo accessibility score from the same cell line.

[0278] To validate the ability of the optimized protocol to induce epigenetic contrast between phases at genome scale, conditioned cell culture media was utilized. Similar to patient plasma, culture media has a complex make-up including large amounts of ions and proteins. Moreover, because only one cell type contributes to the cf-nucleosome pool, the cell-free method can be directly compared to standard epigenetic methods performed from the cells themselves. MDA-MB-231 cells, a triple negative breast cancer line, were seeded in monoculture and media was collected at 80% confluency then cellular debris were removed by two rounds of centrifugation and 0.22 pm filtration. As described above, the optimized phase separation protocol was applied to 0.5 ml of conditioned media and scaled this genome-wide by 150 bp paired-end whole genome sequencing at 25x coverage of the supernatant and recovered pellet. Since the supernatant and the pellet are enriched for genomic loci associated with different epigenetic modifications, the differential enrichment between the two phases is a proxy of chromatin states. We define the “pseudo-accessibility” score as a differential coverage between the supernatant and pellet. Here the differential coverage is calculated as l°92uppere^tant) but may be calculated by any means which estimate coverage differences between phases (FIG. 6A).

[0279] The data shows that pseudo-accessibility constructed from cf-nucleosomes in the conditioned culture media is correlated with publicly available ATAC-seq data from the same cell line (FIG. 6B). Comparing across chromosome 2, less accessible regions were enriched in the pellet and more accessible regions were enriched in the supernatant. Accessibility is determined by ATAC-seq which is performed on intact chromatin and is partly driven by its three-dimensional (3D) structure. In contrast, the CHROMAPS technique utilizes fragmented chromatin suspended in cell culture media where all 3D context is lost. Previously held 3D-informed chromatin accessibility can be broadly recaptured directly from cell culture media, as evident by the pseudo-accessibility score described herein. This is further demonstrated at functional genomic sites such as transcription start sites (TSS). Within the nucleus of a cell, the TSSs of active genes are expected to be accessible and marked with activating epigenetic modifications because they are frequently bound by DNA-binding proteins. Therefore, this accessibility is expected to manifest within the phase separation data. The phase behavior of the cell culture cf-nucleosomes was investigated at all TSSs on chromosome 2; it was found that the pseudo-accessibility score is increased surrounding the TSS indicating cf-nucleosomes positioned near the TSS resist condensation and are enriched in the supernatant (FIG. 6C).Filed: November 14, 2025

[0280] Also investigated was whether this method could differentiate dynamic chromatin states by averaging the pseudo-accessibility score across genome regions annotated by the publicly available ChromHMM model which is trained on multiple ChlP-seq datasets. Strikingly, the pseudo-accessibility measurement differentiates these intra-cellular defined chromatin states with an increase in pseudo-accessibility for enhancers and promoters and a decrease in heterochromatic and repetitive genomic loci (FIG. 6D). Transcription factor binding sites (TFBS), which are epigenetically regulated to alter DNA-protein binding, are another functional genomic site expected to be accessible at actively transcribed genes. To investigate the phase behavior of nucleosomes at these sites, the ATAC-seq signal generated from intact chromatin, the supernatant, and pellet enrichment of isolated nucleosomes generated utilizing the previously reported phase separation technique (Park & Ha et al., bioRxiv, 2023; Park et al., Nature, 2025), and the cell free CH ROM APS method were compared. This was done across the binding sites of three transcription factors known to be active in triple negative breast cancer. In both the ATAC and isolated nucleosome phase separation, an increase of accessibility was seen at TFBS (FIGs. 7A, 7B). This indicates that nucleosomes positioned near the TFBS are resistant to condensation into the pellet and are enriched in the supernatant. However, when compared to the herein provided CHROMAPS method using conditioned media cf-nucleosomes, the supernatant shows no enrichment. Rather, the pellet shows the reciprocal trend where cf-nucleosomes flanking the TFBS are depleted (FIG. 70). The enrichment is calculated using the formulawhich means whichever phase most resembles the total pool of nucleosomes contains the least phase separation information as this would drive the ratio to 1 resulting in a log change of 0. When working with cf-nucleosomes in complex fluid, a small amount of the total cf-nucleosomes is able to be phase separated, meaning the supernatant closely resembles the total and the pellet is the most information rich phase. Therefore, recovery of the pellet is necessary to capture phase behavior from complex fluids, which previous methods are incapable of providing.Example 4: Phase separation and sequencing of endogenous cf-nucleosomes directly in patient fluid specimens.

[0281] Healthy donor whole blood was collected in EDTA collection tubes and processed by centrifugation twice; first at 1000 x g for 10 minutes, then at 2500 x g for 10 minutes at room temperature. Phase separation of healthy patient plasma was performed as described in Example 2 (CHROMAPS Method) with specific modifications as follows. A 2.5 kb filler DNA spike-in with a 5’ inverted dideoxy thymine was created from the lambda genome (Forward primer: TATTGTTCCCAGAGTCGCCG SEQ ID NO: 1 ; Reverse primer:Filed: November 14, 2025 TATGTGGTTTCCGTCGTCCG SEQ ID NO: 2) and 200 ng was added to 1 ml of 50% diluted plasma prior to phase separation. Supernatant cfDNA was extracted and purified using the Zymo Quick cfDNA Serum & Plasma Kit following manufacturer’s instructions. Recovered and proteinase K digested pellet was purified by 2X bead ratio AMPURE purification. Remaining filler DNA spike-in was removed with a 0.6X bead ratio AMPURE size-selection of both the purified supernatant and pellet with a final elution of 10 pl in 10 mM Tris 0.1 mM EDTA. Additionally, a 1 ml sample of 50% diluted plasma was saved for total cfDNA extraction and sequencing. Library preparation, sequencing, and data processing were completed as described in Example 3. ChromHMM annotated chromatin states of the lymphoblastic cell line GM12878 were downloaded from the UCSC Genome Browser (Assembly: hg 19, Track: Broad ChromHMM, Table: GM12878 ChromHMM).

[0282] This data is shown in FIGs. 8A-8C. FIG. 8A shows libraries of recovered supernatant and pellet compared to total cfDNA extraction displaying successful phase separation. FIGs.8B and 8C show the average pseudo-accessibility score across chromosome 2 transcription start sites, and representative ChromHMM annotated chromatin states, respectively.

[0283] Data was generated for endogenous circulating cf-nucleosomes in human plasma by performing whole genome sequencing of the pellet and supernatant after performing phase separation using healthy donor plasma. Success was demonstrated in the recovery and library construction of phase separated cfDNA in the supernatant and the pellet with similar efficiency as in total plasma (FIG. 8A). Sequencing coverage of the supernatant and the pellet, which are normalized to total input, show enrichment and depletion near the TSS, respectively (FIG.8B). Calculated pseudo-accessibility shows a further contrast near the TSS. This observation supports the hypothesis that histone modifications that regulate the structure and function of chromatin are retained in the blood.

[0284] To examine if chromatin states can be recapitulated from circulating cf-nucleosomes in plasma, pseudo-accessibility was calculated across genome regions with different chromatin states as defined by the ChromHMM model which was trained on nine publicly available ChlP-seq datasets of lymphoblastic cells. This analysis showed that promoters and enhancers were enriched in the supernatant while heterochromatic and repetitive regions are depleted from the supernatant (FIG. 8C). Collectively, this demonstrates that endogenous circulating cf-nucleosomes in complex human fluids (such as plasma), though at a low level, can be phased, separated, and sequenced to recapitulate the chromatin landscape and functional states.Example 5: Prediction of disease state using CHROMAPS pseudo-accessibility.

[0285] This example provides use of the CHROMAPS method across a multi-cancer patient cohort. Dysregulation of the epigenetic landscape is an early hallmark of many cancers, ofFiled: November 14, 2025 which, CHROMAPS generates a holistic recapitulation. The diagnostic potential of the pseudo-accessibility score is demonstrated herein.

[0286] Blood samples from control individuals and patients with hepatocellular carcinoma or lung adenocarcinoma were obtained from Oregon Health and Science University (OHSU) by the Knight Cancer Institute Biolibrary and Oregon Clinical and Translational Research Institute (OCTRI). All samples were collected under OHSU institutional review board (IRB) approved protocols. All donors gave written informed consents for research use, and all relevant ethical regulations were followed. Control donors were individuals with no known previous history of cancer. EDTA collection tubes were used and whole blood processed by centrifugation twice: first at 1000 x g for 10 minutes at either 4eC or room temperature, then at either 2500 x g or 15,000 x g for 10 minutes at either 4eC or room temperature.

[0287] Phase separation of patient plasma (60 non-cancer control, 30 lung adenocarcinoma, and 52 hepatocellular carcinoma) was conducted as described in Example 4 with the only modification being samples were aligned to the hg38 reference genome. Promoter sites were downloaded from the UCSC Genome Browser (Assembly: hg38, Track: ENCODE cCREs, Table: encodeCcreCombined), filtered to only + strand sites to remove redundant regions, and extended by 1 nucleosomes length (167 bp) upstream and downstream of each promoter to ensure capture of +1 and -1 nucleosomes at each gene. Enhancer sites were also downloaded from the UCSC Genome Browser (Assembly: hg38, Track: VISTA Enhancers, Table: vistaEnhancersBb). We then averaged the pseudo-accessibility within these defined regions per patient sample. The promoters and enhancers were then ranked by significance across all patients by a Wilcoxon rank sum test in pairwise comparisons. Classification between disease types was performed by a supervised machine learning approach in leave-one-out cross validation, where in each round, one sample was held out as a validation set, and the rest were used for model training. Feature selection was performed within each fold using Least Absolute Shrinkage and Selection Operator (LASSO) regression, and selected promoters or enhancers were used to classify patients between non-cancer controls, lung cancer, and HCC by logistic regression (glmnet 4.1-10).

[0288] This data is shown in FIGs. 9A-9E and FIGs. 10A-10B. FIGs. 9A and 9B show the average pseudo-accessibility of each group across the most statistically significant promoters and enhancers, respectively. FIGs. 9C and 9D show the full distribution of the patient samples at representative promoters and enhancers, respectively. FIG. 9E shows the receiver operating curve and corresponding AUCs following classification using either promoters or enhancers as feature sets. FIGs. 10A and 10B show the most statistically significant promoters and enhancers between HCC pre- and post-treatment samples.

[0289] To demonstrate representative clinical utility of the CHROMAPS method in oncology, 142 CHROMAPS profiles were generated using 0.5 ml of plasma from each sample in a multi-Filed: November 14, 2025 cancer cohort of 52 hepatocellular carcinoma (HCC) patient samples, 30 lung adenocarcinoma patient samples, and 60 non-cancer control samples (who are patients with comorbidities which are not cancer). Sixteen of the 52 HCC samples were blood draws performed within 24 hours after a locoregional interventional radiology procedure, allowing the opportunity to investigate acute effect of the treatment. All samples displayed successful phase separation from 0.5 ml of plasma and each phase was whole genome sequenced at approximately 7x coverage from which the pseudo-accessibility score was calculated.

[0290] It was hypothesized that the phase separation of epigenetically regulated genomic regions would be enriched based on chromatin state, which is heavily dysregulated during cancer, and that this signal can be obtained non-invasively from cf-nucleosomes. Both promoters and enhancers are dynamically regulated and have a direct effect on gene expression as determined by their epigenetic state. To investigate this, the most statistically significant annotated promoters and enhancers between HCC, lung cancer, and non-cancer controls were identified by pair-wise Wilcox tests of pseudo-accessibility. At the 200 most statistically significant gene promoters, a differential profile was found specifically at the center of the promoter site where the pseudo-accessibility is largely increased within the HCC and control patients while significantly decreased in lung cancer (FIG. 9A). Across the 200 most statistically significant enhancer regions, the cancer and non-cancer control pseudoaccessibility profiles coincide flanking the enhancer but are stratified specifically within the enhancer region, where control patients have the highest pseudo-accessibility followed by lung cancer and HCC (FIG. 9B). The full distribution of patients’ pseudo-accessibility scores across representative promoters and enhancers can be seen in FIG. 9C and FIG. 9D, respectively. For example, it was found that the pseudo-accessibility of the DUSP22 promoter was significantly decreased in the lung cancer patients, possibly indicating its down regulation and suppression. Recent reports find that DUSP22 acts as a tumor suppressor in lung adenocarcinoma, where its expression restrains EGFR / c-Met activity thereby inhibiting tumor progression

[0025] . In HCC, the most proximal enhancer of the transcription factor FOXN3 (which has been shown to inhibit proliferation of HCC cells) was found to have significantly decreased pseudo-accessibility

[0026] . Again, this effect is owing to a potential repressed epigenetic state that is indicative of a pro-tumorigenic signal.

[0291] Next, the ability of CHROMAPS to distinguish disease states was investigated. Leveraging the differential signal found at epigenetic regulatory sites, classification was performed by a supervised machine learning approach in leave-one-out cross validation, where in each round, one sample was held out as a validation set, and the rest were used for model training. Feature selection was performed within each fold using Least Absolute Shrinkage and Selection Operator (LASSO) regression, and selected promoters or enhancers were used to classify patients between non-cancer controls, lung cancer, and HCC by logisticFiled: November 14, 2025 regression. Differentiating HCC from controls, lung cancer from controls, and lung cancer from HCC yielded mean AUCs of 0.73, 0.79, and 0.74 between using promoters or enhancers, respectively, displaying the diagnostic potential of the herein provided pseudo-accessibility score.

[0292] Further, pseudo-accessibility profiles were identified which vary significantly over promoters and enhancers between pre- and post-treatment HCC samples (FIG. 10A). It was hypothesized the post-treatment draws contain an acute inflammatory signal as they were collected within 24-hours of treatment (which is a direct injection of embolic agents into the primary blood vessel which feeds the tumor). Indeed, a statistically significant increase of pseudo-accessibility was found in post-treatment samples at the promoters of BAFF, a B-cell activation factor and central regulator of B-cell differentiation, and MY01G, a lymphocyte specific gene predominantly expressed in B and T cells [27, 28]. At enhancers, a drop in pseudo-accessibility of the most proximal enhancer to PBX1 and an increase at the enhancer of ZNF521 were found, both of which are essential transcription factors for lymphoid development and play a role in preserving hematopoietic stem cell differentiation [29, 30] (FIG.10B).Example 6: Prediction of disease state by fragment length analysis of CHROMAPS.

[0293] More information can be harvested using the described differential phase separation of cfDNA. The CHROMAPS method is amenable to both nucleosome profiling and fragment length analysis. Both have proven to be highly predictive for cancer diagnosis and subtyping [5, 31]. Cancer cfDNA is known to have a shorter and more variable fragment length compared to healthy

[0032] , This example describes an analysis approach within CHROMAPS data which uses fragment length as another informative feature layer along with pseudo-accessibility to better predict disease state.

[0294] Fragment length of each read was gathered using Picard CollectlnsertSizeMetrics (ver 1.119) from the data generated in Example 5. Per sample, the proportion of fragments with size between 70 bp-150 bp were considered short and fragments with size between 300 bp-500 bp were considered long. Fragment size was also analyzed by 10 bp bins starting from 25 bp to 705 bp resulting in 68 bins. Within each bin, the proportion of total fragments which fall within that size was calculated per sample and per phase. This was used as a feature set for classification with the same scheme as described in Example 5.

[0295] This data is shown in FIGs. 11A-11 H. FIGs. 11 A and 11 B show the fragment length distribution of all reads stratified by phase or disease type, respectively. FIGs. 11C and 11 D show comparison of short and long fragments between phases and disease types, respectively. FIGs. 11 E and 11 F show the enrichment of either short or long fragments stratified by phase then subsequently compared between disease types. FIGs. 11G and 11 HFiled: November 14, 2025 shows the receiver operating curve and corresponding AUCs following classification using either supernatant, pellet, or total fragment bins to classify between HOC vs. Non-cancer Control and Lung Cancer vs. Non-cancer Control, respectively.

[0296] It was hypothesized that fragment length may be used in conjunction with pseudoaccessibility to differentiate disease states and this has been explored as described herein. As expected, the characteristic nucleosome size patterning of the cfDNA with a primary peak at 167 bp was found in both phases and across all patient samples (FIGs. 11A & 11B). However, short fragments (70-150 bp) were significantly enriched in the supernatant after phase separation, while long fragments (300-500 bp) were significantly enriched in the pellet (FIG. 11C). These results are concordant with the above-described findings that phase separation efficiency increases with DNA length (see FIGs. 4C-4E).

[0297] When stratified by cancer status and type, HCC samples contain significantly more short fragments as compared to controls and lung cancer patients, but no significant differences were found in proportions of long cfDNA fragments (FIG. 11 D). Now dichotomized by phase, the enrichment of short fragments in HCC follows the same pattern across supernatant and pellet as seen in the total sample (FIG. 11 E); however, an enrichment was found of long fragments specifically in the supernatant of HCC patients, thereby leading to a significant depletion of long fragments specifically in the pellet (FIG. 11 F). Thus, the additional phase information (that is, specific supernatant or pellet enrichment) provides another significant variable by which to differentiate these disease states.

[0298] The fragment length was utilized as a feature for classification by dividing the fragment length distribution of the pellet and supernatant into 10 bp length bins, then calculating the proportion of total fragments that fall within each bin. The same leave-one-out cross validation and feature selection scheme followed by logistic regression were used as described previously.

[0299] Fragment size specifically in the supernatant yielded respective AUCs of 0.81 and 0.79 when differentiating HCC vs. control and lung cancer vs. control. The pellet yielded respective AUCs of 0.88 and 0.77 when differentiating HCC vs. control and lung cancer vs. control. When classifying between lung cancer and control, the fragment information in the supernatant or pellet outperforms the total proportions, which has phase information removed and is a proxy to a standard cfDNA extraction (FIGs. 11G & 11 H). Together, these results illustrate representative clinical utilities of the described CHROMAPS methods.Example 7: Bead-based CHROMAPS.

[0300] A CHROMAPS embodiment that provides increased throughput and robustness of the separation and analysis assays, involving a bead-based (or other solid support capture surface-mediated) method of cf-nucleosome phase separation. Including a bead or otherFiled: November 14, 2025 surface-medicated capture aspect can remove the need for centrifugation (FIG. 12A). For instance, use of magnetic beads as a nucleation site for condensed nucleosomes or DNA allows physical separation of dilute and condensed DNA without the need for centrifugation.

[0301] This example describes an exemplary bead-based assay that demonstrates the feasibility of performing polyamine-induced phase separation onto a solid support surface. It was hypothesized that the bead surface will act as a nucleation site for phase separation, resulting in pelleted DNA electrostatically attached to the beads that can then be separated from the supernatant using a magnet.

[0302] Carboxyl-coated magnetic AMPURE beads were first washed twice by placing beads on a magnetic rack, waiting for the solution to clear indicating binding, then removing stock commercial buffer and adding 80% ethanol. The beads were then dried and resuspended in corresponding 2X phase separation buffer (20 mM Tris pH 7.2, 100 mM NaCI, 0-2 mM spermine) with or without various amounts of 8 kDa polyethylene glycol (PEG).

[0303] Phase separation was performed with 8 pl of beads in phase separation buffer which were then mixed with 8 pl 25 ng / pl Widom 601 DNA. The reaction was incubated at room temperature for 5 minutes then placed on the magnetic rack until the solution cleared, 2 minutes. The supernatant was then removed and DNA concentration measured by SYBR green fluorometry. The remaining beads, which have the pellet bound, were washed with 75% ethanol then resuspended in 10 mM Tris pH 7.2 5 mM EDTA and heated for 15 minutes at 37eC. Immediately following this incubation, the beads were placed on the magnetic rack, the pellet eluate was collected, and the DNA concentration measured by SYBR green fluorometry.

[0304] Magnetic beads were functionalized with a DNA scaffold coating through streptavidinbiotin linkage and covalent linkage through an azide-DBCO conjugation. MyOne Streptavidin T1 Dynabeads were bound with biotin and Cy5 modified 150 bp dsDNA following manufacturer’s instructions. Covalent conjugation was performed by first washing 100 pg of azide beads (Vector Laboratories) with phosphate buffered saline (PBS) three times. Azide beads were then resuspended in 20 pl of PBS 0.01% Tween-20 and a 5’ DBCO modified 20 nt oligo was added at a final concentration of 10 pM. The bead oligo mix was incubated at room temperature overnight with constant mixing while protected from light. The beads were then washed three times with PBS to remove unconjugated oligo. The length of now conjugated oligo could then be extended by hybridization of a dsDNA construct with a complementary overhang. Successful conjugation was determined by imaging after hybridization of a Cy5 reverse complement oligo. The azide beads were also functionalized with a 5 kDa PEG coating using the same method where the oligo was replaced with 1 mM DBCO-PEG.Filed: November 14, 2025

[0305] Phase separation with DNA scaffold coated beads, streptavidin-biotin and azide-DBCO, was carried out as described above. 10 pg of DNA-coated beads was used per 200 ng of target phase separation DNA in each reaction.

[0306] The epigenetic dependence of phase separation using beads was first tested with H3K9ac and H3K4me3 mononucleosomes purchased from EpiCypher. Nucleosomes were dialyzed against 10 mM Tris pH 7.2 0.1 mM EDTA for 1 hour in 7 kDa dialysis buttons. They were then diluted with nuclease free water to a DNA concentration of 25 ng / pl. 10 pg of beads with a covalent PEG coating were added followed by phase separation buffer at a final concentration of 10 mM Tris pH 7.2, 50 mM NaCI, 1 mM EDTA. The mixture was incubated at room temperature for 5 minutes then placed on a magnetic rack until the solution was clear, 2 minutes. The supernatant was measured by 5% polyacrylamide gel-electrophoresis where band fluorescence was measured in Imaged and each sample normalized to a 0 mM spermine control.

[0307] Phase separation of cf-nucleosomes with streptavidin-biotin DNA coated beads was performed directly in MDA-MB-231 conditioned culture media. 0.5 ml of media was collected at 80% confluency and centrifuged twice; first at 2500 x g 4SC for 10 minutes then centrifuged again at 16,100 x g 4eC for 10 minutes. The media was then 0.22 pm filtered to ensure the removal of any cell debris. To generate mononucleosomes, Mnase was added directly to 0.5 ml of spun and filtered media to a final concentration of 40 U / ml and incubated at 37eC for 1 hour. Immediately following this incubation, the media was diluted by 50% and various amounts of DNA coated beads were added to solution (1 pg, 10 pg, and 100 pg). Phase separation buffer was added at final concentrations of 10 mM Bis-Tris pH 6.5 1 mM spermine. After mixing, the reaction was incubated at room temperature for 10 minutes then placed on a magnetic rack for 10 minutes. The supernatant was then removed and cfDNA extracted using the Zymo Quick-cfDNA Serum and Plasma kit. The beads were then washed with 75% ethanol, dried, and resuspended in 10 mM Tris 5 mM EDTA at 37°C for 15 minutes. Following the incubation, the reaction was placed back on the magnetic rack for 1 minute and the pellet eluate collected. The recovered supernatant and pellet were concentrated to 20 pl by AMPURE purification and enrichment of active or repressed chromatin regions measured by digital droplet PCR. 3 known active chromatin and 3 known repressed chromatin regions were targeted, and using the number of copies in each region, a pseudo-accessibility score was calculated by log2(supernatant copies / pellet copies). This was normalized to an unconjugated bead control at each bead concentration and compared to a centrifugation method control where phase separation was performed without beads as described in Example 3.

[0308] Finally, bead phase separation was performed followed by whole genome sequencing. Carboxyl-coated AMPURE beads were prepared for phase separation as described above. Mononucleosomes were isolated from MDA-MB-231 cells using the Active Motif NucleosomeFiled: November 14, 2025 Preparation Kit. After dialysis against 10 mM Tris 0.1 mM EDTA for 1 hour, nucleosomes were diluted to 25 ng / pl. 8 pl of beads in phase separation buffer (10 mM Tris, 50 mM NaCI, 1 mM EDTA, 1 mM spermine) were then mixed with 8 pl mononucleosomes. The reaction was incubated at room temperature for 5 minutes then placed on the magnetic rack until the solution clear, 2 minutes. The supernatant was then removed and DNA purified by 2X AMPURE purification. The remaining beads, which have the pellet bound, were washed with 75% ethanol then resuspended in 10 mM Tris pH 7.25 mM EDTA and heated for 15 minutes at 37SC. Immediately following this incubation, the beads were placed on the magnetic rack, the pellet eluate was collected and DNA purified by 2X AMPURE purification. Library preparation, sequencing, and data processing were completed as described in Example 3 with 25X whole genome coverage.

[0309] Corresponding data is shown in FIGs. 12B, 12C, 13A-13C, and 14A-14C. FIG. 12B shows the phase separation performance of the carboxyl-coated AMPURE beads with varying amounts of PEG. FIG. 12C shows the first phase separation example of coating beads with a dsDNA scaffold through streptavidin-biotin linkage. FIGs. 13A and 13B show fluorescent images of covalently conjugated DBCO DNA to azide beads where FIG. 13C displays these beads used for phase separation. FIGs. 14A and 14B show the bead-based phase separation technique’s ability to generate epigenetic contrast with both synthetically modified nucleosomes and native cf-nucleosomes directly in condition cell media. FIG. 14C shows the use of beads to perform nucleosomes phase separation followed by whole genome sequencing.

[0310] DNA phase separation onto carboxyl-coated 1 pm diameter magnetic beads was successfully performed with varying amounts of polyethylene glycol (PEG: molecular weight 5 kDa-8 kDa) in solution. The resultant phase separation curve is similar to the centrifugationbased format, and separation efficiency was modulated by the addition of PEG, where increasing PEG concentration improves phase separation efficiency and improves pellet recovery from the beads (FIG. 12B).

[0311] The data suggested that bead surface passivation increases recovery of phase separated DNA or nucleosomes from the beads. Therefore, different strategies were tested for coating the bead with PEG, DNA oligos, and double stranded DNA (dsDNA). As observed with PEG, dsDNA coated magnetic beads greatly improved pellet recovery from 32% to 92% with no loss of phase separation efficiency, as compared to a bare bead control (FIG. 12C). To improve the robustness of the dsDNA coating and to prevent decoupling of the dsDNA from the bead, the dsDNA was covalently bound to azide beads through azide-DBCO conjugation of short oligos (approx. 10 bp - 500 bp) (FIG. 13A). This attachment process can be extended to longer dsDNA constructs (>500 bp) by using an overhang ligation (FIG. 13B). This prevents the filler dsDNA coating from leaking into either the supernatant or pellet, whichFiled: November 14, 2025 could skew the final sequencing results. Using these covalently functionalized magnetic beads, robust phase separation was achieved by removing all DNA from the supernatant at 0.75 mM polyamine. Further, 75% of the pellet was recovered using the covalently functionalized beads (FIG. 13C).

[0312] In summary, a polyamine-induced phase separation technique has been developed which utilizes magnetic beads functionalized with either a passivating agent (such as PEG) or phase separation scaffold (such as dsDNA), to act as a nucleation site for pelleted DNA or nucleosomes. This bead-based engineered platform is the first demonstration of DNA and nucleosome polyamine-mediated phase separation on a solid support surface without the need of centrifugation.

[0313] Next, epigenetic dependency of the bead-based phase separation platform was examined. This bead-based platform was applied to synthetically modified nucleosomes and native nucleosomes in conditioned cell culture media (as a proxy of patient plasma), and isolated cell line mononucleosomes. Using PEGylated beads, distinct epigenetic contrast between H3K9ac and H3K4me3 nucleosomes (FIG. 14A) was shown. When added directly to conditioned MDA-MB-231 cell media, 100 pg of PEGylated beads per 0.5 ml of media successfully phase separated and distinguished active from repressed epigenetic regions at similar rate to the described centrifuge method (FIG. 14B). Finally, whole genome CHROMAPS epigenetic profiles were generated utilizing magnetic beads on isolated mononucleosomes from MDA-MB-231 cells.

[0314] These reported data demonstrate that the described bead-based phase separation platform induces epigenetic contrast on the genome-wide scale. The phase separation score correlates with the accessibility profile of the intact chromatin, consistent with the results obtained using the centrifugation method (FIG. 14C).Example 8: Controlled modulation of phase separation.

[0315] The initially developed CHROMAPS method does not directly distinguish specific histone modifications or DNA methylation sites as the pseudo-accessibility is an aggregate score of all epigenetic signals typically culminating in an output similar to chromatin accessibility. This can be addressed through addition of histone modification binding proteins, such as chromo-domain and bromo-domain containing proteins or antibodies, to the plasma sample. The binding of these proteins is proposed to modulate the phase behavior of target nucleosomes because of a change in electrostatics and sterically limiting polyamine interactions. Effectively, this would alter the phase behavior of specifically bound nucleosomes, providing the ability to target nucleosomes of a certain type to either be enriched in the supernatant or pellet.Filed: November 14, 2025

[0316] This example illustrates an embodiment CHROMAPS separation reaction that is modulated through addition of anti-dsDNA antibody as an example histone modification binding protein.

[0317] Reconstituted mononucleosomes (146 bp Widom 601 DNA assembled onto histone octamers; final nucleosome concentration: 200 nM based on DNA measured with NanoDrop) or a bare 167 bp DNA fragment (final concentration: 50 nM) were mixed and incubated with the indicated concentrations of anti-dsDNA antibody (clone 35I9 DNA, BSA- and azide-free) at room temperature for 30 minutes. Prior to this mixing and incubation, both reconstituted nucleosomes and anti-dsDNA antibody were dialyzed at 4eC in 7 kDa dialysis buttons for one hour. Following dialysis, mixing, and room temperature incubation, 0.5 mM spermine was added to induce phase separation (final concentration: 1 mM Spermine, 50 mM NaCI, 10 mM Tris pH 7.2, 1 mM EDTA) and samples were allowed to stand at room temperature for 5 minutes. Reaction mixtures were centrifuged at 18,400 x g for 5 minutes at room temperature to separate the supernatant and pellet fractions. Both fractions were analyzed using native polyacrylamide gel electrophoresis (6% gel) run at 4°C for 2 hours. Samples were stained with SYBR Safe nucleic acid stain and visualized using an iBright™ nucleic acid imaging system. Quantification of nucleosome and DNA band intensities were performed using Fiji software. Data is shown in FIGs. 15A and 15B, where phase separation with varying amounts of dsDNA targeting antibody are compared with bare DNA and mononucleosomes, respectively.

[0318] An example of controlled modulation of phase separation is incubating plasma cf-nucleosomes with BRD4 which is a histone H3 and H4 acetylation binding protein. It is proposed that acetylated nucleosomes would have significantly altered phase separation which is detectable as large deviations in the pseudo-accessibility in regions known to be acetylated such as active promoters and enhancers. Provided herein is proof-of-principle that binding of an anti-dsDNA antibody can be used to controllably inhibit the phase separation of bare DNA and this effect is dependent upon antibody concentration (FIG. 15A-15B). This assay can be employed as a type of “leave-one-out” or “reverse” cell-free ChlP-seq in which it is possible to measure genome wide epigenetic state with the added resolution of identifying specific histone modification types within a single step.Example 9: Cerebral Spinal Fluid CHROMAPS.

[0319] The described CHROMAPS method is a comprehensive liquid biopsy platform that is applicable to cerebral spinal fluid, urine, saliva, and fluids collected proximal to sites of interest such as pancreatic cyst fluid and pleural fluid. This example illustrates the use of CHROMAPS with cerebral spinal fluid.

[0320] Processing of the cerebral spinal fluid took place within one hour of the sample being drawn. Samples were received on ice and in the same 25 ml syringe the fluid was drawn in.Filed: November 14, 2025 The sample was extracted from the syringe into a 15 ml Corning centrifuge tube. The sample was then centrifuged at room temperature for 10 minutes at 1 ,000 x g to pellet red blood cells. Following centrifugation, supernatant was removed and re-centrifuged at room temperature for 10 minutes at 2,500 x g to pellet any platelets or cell fragments. The sample was then aliquoted into 1 ml micro-centrifuge tubes and stored at -80°C.

[0321] Phase separation and sequencing of 0.5 ml of cerebral spinal fluid was performed as described in Example 4. The data is shown in FIG. 16, where fragment size between phases is compared, and pseudo-accessibility is plotted across chromosome 2.

[0322] CHROMAPS profiles directly generated from 0.5 ml of cerebral spinal fluid, show a characteristic nucleosome size profile (155 bp) of cfDNA fragments and strong epigenetic contrast across each chromosome (chr2 shown in FIG. 16).Closing Paragraphs

[0323] As will be understood by one of ordinary skill in the art, each embodiment disclosed herein can comprise, consist essentially of or consist of its particular stated element, step, ingredient or component. Thus, the terms “include” or “including” should be interpreted to recite: “comprise, consist of, or consist essentially of.” The transition term “comprise” or “comprises” means has, but is not limited to, and allows for the inclusion of unspecified elements, steps, ingredients, or components, even in major amounts. The transitional phrase “consisting of” excludes any element, step, ingredient, or component not specified. The transition phrase “consisting essentially of” limits the scope of the embodiment to the specified elements, steps, ingredients, or components and to those that do not materially affect the embodiment.

[0324] Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. When further clarity is required, the term “about” has the meaning reasonably ascribed to it by a person skilled in the art when used in conjunction with a stated numerical value or range, i.e. denoting somewhat more or somewhat less than the stated value or range, to within a range of ±20% of the stated value; ±19% of the stated value; ±18% of the stated value; ±17% of the stated value; ±16% of the stated value; ±15% of the stated value; ±14% of the stated value; ±13% of the stated value;Filed: November 14, 2025 ±12% of the stated value; ±11% of the stated value; ±10% of the stated value; ±9% of the stated value; ±8% of the stated value; ±7% of the stated value; ±6% of the stated value; ±5% of the stated value; ±4% of the stated value; ±3% of the stated value; ±2% of the stated value; or ±1 % of the stated value.

[0325] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements.

[0326] The terms “a,” “an,” “the” and similar referents used in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e g., “such as”) provided herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.

[0327] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member may be referred to and claimed individually or in any combination with other members of the group or other elements found herein. It is anticipated that one or more members of a group may be included in, or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

[0328] Certain embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Of course, variations on these described embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventor expects skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possibleFiled: November 14, 2025 variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

[0329] Furthermore, numerous references have been made to patents, printed publications, journal articles, other written text, and web site content throughout this specification (referenced materials herein). Each of the referenced materials are individually incorporated herein by reference in their entirety for their referenced teaching(s), as of the filing date of the first application in the priority chain in which the specific reference was included. For instance, with regard to chemical compounds, nucleic acid, and amino acids sequences referenced herein that are available in a public database, the information in the database entry is incorporated herein by reference as of the date of an application in the priority chain in which the database identifier for that compound or sequence was first included in the text.

[0330] It is to be understood that the embodiments of the invention disclosed herein are illustrative of the principles of the present invention. Other modifications that may be employed are within the scope of the invention. Thus, by way of example, but not of limitation, alternative configurations of the present invention may be utilized in accordance with the teachings herein. Accordingly, the present invention is not limited to that precisely as shown and described.

[0331] The particulars shown herein are by way of example and for purposes of illustrative discussion of the preferred embodiments of the present invention only and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of various embodiments of the invention. In this regard, no attempt is made to show structural details of the invention in more detail than is necessary for the fundamental understanding of the invention, the description taken with the drawings and / or examples making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.

[0332] Definitions and explanations used in the present disclosure are meant and intended to be controlling in any future construction unless clearly and unambiguously modified in the example(s) or when application of the meaning renders any construction meaningless or essentially meaningless. In cases where the construction of the term would render it meaningless or essentially meaningless, the definition should be taken from Webster's Dictionary, 11th Edition or a dictionary known to those of ordinary skill in the art, such as the Oxford Dictionary of Biochemistry and Molecular Biology, 2ndEdition (Ed. Anthony Smith, Oxford University Press, Oxford, 2006), and / or A Dictionary of Chemistry, 8thEdition (Ed. J. Law & R. Rennie, Oxford University Press, 2020).

Claims

Filed: November 14, 2025LISTING OF CLAIMSWhat is claimed is:1 . A method for DNA analysis in a complex fluid, comprising:obtaining a complex fluid sample comprising fragmented genomic DNA;adding a DNA-capture scaffold to the complex fluid sample;subjecting the complex fluid sample to poly-cation molecule mediated phase separation in the presence of the DNA-capture scaffold, to produce a dilute phase and a condensed phase;substantially separating the dilute phase from the condensed phase, thereby separating the fragmented genomic DNA into dilute phase DNA and condensed phase DNA; andanalyzing the dilute phase DNA and the condensed phase DNA, wherein the analyzing comprises detecting and / or measuring at least one characteristic of each of the dilute phase DNA and the condensed phase DNA and generating a comparison of the at least one DNA characteristic between the phases.

2. The method of claim 1 , further comprising calculating a pseudo-accessibility score at one or more genomic locations based on differential enrichment of DNA between the dilute phase and the condensed phase for DNA fragments at the one or more genomic locations.

3. A method of phase separating fragmented DNA in a complex fluid sample, comprising:obtaining a complex fluid sample comprising fragmented DNA;adding a capture scaffold;subjecting the complex fluid sample to poly-cation molecule mediated phase separation in the presence of the scaffold, to produce a dilute phase and a condensed phase;substantially separating the dilute phase from the condensed phase; and extracting DNA from each of the dilute phase and the condensed phase.

4. A minimally-invasive system to reconstruct epigenetic landscape, chromatin features, and / or regulatory elements from DNA in a complex fluid, comprising:obtaining a complex fluid sample comprising fragmented DNA;adding a capture scaffold;subjecting the complex fluid sample to poly-cation molecule mediated phase separation in the presence of the scaffold, to produce a dilute phase and a condensed phase;substantially separating the dilute phase from the condensed phase;Filed: November 14, 2025 extracting DNA from each of the dilute phase and / or the condensed phase; and characterizing the DNA to reconstruct the epigenetic landscape, the chromatin features, and / or the regulatory elements from the DNA.

5. A method of detecting, diagnosing, and / or molecularly characterizing a disease or condition in a subject, the method comprising:obtaining a complex fluid sample comprising fragmented DNA;adding a capture scaffold;subjecting the complex fluid sample to poly-cation molecule mediated condensation phase separation in the presence of the scaffold, to produce a dilute phase and a phase; substantially separating the dilute phase from the condensed phase;extracting DNA from the dilute phase and / or the condensed phase; and analyzing the DNA to identify characteristics of a target disease or condition.

6. The method of claims 1-5, wherein characterizing or analyzing the DNA comprises performing fragmentomics analysis on DNA from the dilute phase, DNA from the condensed phase, or DNA from each of the dilute phase and the condensed phase.

7. The method of claim 6, wherein the fragmentomics analysis comprises analysis of one or more of:fragment length in the dilute phase, the condensed phase, or the dilute phase and condensed phase;ratio of fragment lengths in the dilute phase, the condensed phase, or the dilute phase and condensed phase;variance of fragment lengths in the dilute phase, the condensed phase, or the dilute phase and condensed phase:fragment location in the genome, or in different regions across chromosomes, the dilute phase, the condensed phase, or the dilute phase and condensed phase;fragment abundance in the dilute phase, the condensed phase, or the dilute phase and the condensed phase:, andend motif analysis of the fragments, such as determination of end locations within the genome, in the dilute phase, the condensed phase, or the dilute phase and condensed phase.

8. A method to differentially enrich for epigenetic states in cell free DNA (cfDNA) present in a complex fluid sample, comprising:obtaining a complex fluid sample comprising cfDNA;Filed: November 14, 2025 subjecting the complex fluid sample to poly-cation-mediated phase separation in the presence of a capture scaffold, to produce a dilute supernatant phase and a condensed phase;substantially separating the dilute supernatant phase from the condensed phase; and optionally extracting cfDNA from each of the dilute supernatant phase and the condensed phase;wherein cfDNA from the dilute supernatant phase is enriched for active chromatin regions and cfDNA from the condensed phase is enriched for repressive chromatin regions.

9. The method of any one of claims 1-5, 7, or 8, wherein cfDNA or fragmented DNA in each phase is enriched for one or more characteristics of the genome.

10. The method of any one of claims 1-5, 7, or 8, wherein cfDNA or fragmented DNA in one phase is enriched for active chromatin regions and fragmented DNA in the other phase is enriched for repressive chromatin regions.11 . The method of claim 10, wherein cfDNA or fragmented DNA extracted from the dilute phase is enriched for active chromatin regions, and cfDNA or fragmented DNA extracted from the condensed phase is enriched for repressive chromatin regions.

12. The method of any one of claims 1-5, 7, or 8, wherein the poly-cation molecule used for condensation comprises at least one of a polyamine, a positively charged peptide, a positively charged protein, or a positively charged protein domain.

13. The method of claim 12, wherein the polyamine comprises at least one of spermine, spermidine, or putrescine.

14. The method of any one of claims 1-5, 7, or 8, further comprising quantifying DNA fragments from the dilute phase, from the condensed phase, or from both phases.

15. The method of any one of claims 1-5, 7, or 8, wherein quantifying comprises one or more of a sequencing-based method, a PCR-based method, a fluorescent-quantification based method, or a spectroscopy-based method.

16. The method of any one of claims 1 -5, 7, or 8, further comprising calculating a pseudoaccessibility score for cfDNA or DNA fragments from the dilute phase, from the condensed phase, or from both.Filed: November 14, 2025 17. The method of claim 16, wherein the pseudo-accessibility score is defined as differential enrichment of DNA at each genomic location between phases.

18. The method of any one of claims 1-5, 7, or 8, wherein the method is carried out with labeling any components in the complex fluid sample.

19. The method of any one of claims 1-5, 7, or 8, wherein the complex fluid sample comprises cfDNA or fragmented DNA bound to one or more DNA binding proteins, cfDNA or fragmented DNA unbound by any DNA binding proteins, or both.

20. The method of claim 19, wherein the one or more DNA binding proteins comprises:at least one histone;at least two different histones;at least two differentially modified histones; orat least one DNA binding protein that is not a histone.

21. The method of any one of claims 1 -5, 7, or 8, wherein the cfDNA or fragmented DNA comprises mammalian DNA, bird DNA, insect DNA, plant DNA, fungal DNA, or a mixture of two or more thereof.

22. The method of any one of claims 1 -5, 7, or 8, wherein the cfDNA or fragmented DNA comprises at least one of cell-free DNA (cfDNA), cell-free nucleosomes (cf-nucleosomes), fragmented chromatin, fragmented extra-chromosomal DNA, or fragmented DNA unbound by any DNA binding proteins.

23. The method of any one of claims 1-5, 7, or 8, further comprising decondensing the condensed phase before extracting fragmented DNA from the condensed phase.

24. The method of claim 23, wherein decondensing the condensed phase comprises at least one of heating the condensed phase, adding a chelator, or adding a high salt buffer.

25. The method of claim 24, wherein at least one of:the heating occurs at 30-90°C for at least 5 minutes;the chelator comprises ethylenediaminetetraacetic acid (EDTA), metachelate, egtazic acid (EGTA; ethylene glycol-bis(p-aminoethyl ether)-N,N,N',N'-tetraacetic acid), ethydronic acid (HEDP), diethylenetriaminepentaacetic acid (DTPA) nitrilotriacetic acid (NTA), iminodisuccinic acid (IDS), polyaspartic acid, S,S-ethylenediamine-N,N'-disuccinic acidFiled: November 14, 2025 (EDDS), methylglycinediacetic acid (MGDA), or L-Glutamic acid N,N-diacetic acid, tetrasodium salt (GLDA); orthe high salt buffer comprises at least 150 mM monovalent cation and / or at least 1 mM divalent cation.

26. The method of any one of claims 1-5, 7, or 8, wherein the capture scaffold comprises:a nucleic acid or a solid surface substantially non-reactive or reversibly reactive to DNA; ornaturally occurring or synthetic DNA or RNA molecules.

27. The method of claim 26, wherein the scaffold comprises one or more of:unbound DNA of at least 100 bases in length in linear form, circular form, or both; DNA of any length bound to a solid substrate in linear form, circular form, or both; unbound RNA of at least 100 bases in length;RNA of any length bound to a solid substrate;mono- or oligo-nucleosomes bound or unbound to a solid substrate;non-naturally occurring nucleic acids of at least 100 bases in length;non-naturally occurring nucleic acids of any length bound to a passivated or unpassivated solid substrate;solid surface substantially non-reactive or reversibly reactive to DNA, optionally coated with a passivating substance; andsolid surface with or without bound nucleic acids.

28. The method of claim 27, wherein the solid substrate comprises a bead, such as a magnetic bead.

29. The method of any one of claims 1-5, 7, or 8, wherein a solid surface is used and characterization or analysis of the separated DNA comprises direct measurement of or amplification of sequences of DNA bound to the solid surface.

30. The method of any one of claims 1-5, 7, or 8, wherein the complex fluid sample comprises naturally-occurring salt(s), and the method further comprises diluting the sample prior to subjecting the complex fluid sample to poly-cation molecule mediated phase separation, to produce a diluted sample.Filed: November 14, 2025 31. The method of claim 30, wherein the diluted sample comprises no more than 150 millimolar monovalent and divalent cations, or at 25-75% concentration of the complex fluid sample before dilution.

32. The method of any one of claims 1-5, 7, or 8, wherein the complex fluid sample comprises:a bodily fluid sample;aclinical sample;a laboratory sample;an environmental sample;an agricultural sample;an archaeological sample; ora forensic sample.

33. The method of any one of claims 1-5, 7, or 8, further comprising adding one or more contrast modulators before subjecting the complex fluid sample to poly-cation molecule mediated phase separation.

34. The method of claim 33, wherein the one or more contrast modulators comprise: a histone-modification-specific binding molecule;a DNA binding molecule;a nucleosome binding molecule;achromatin binding molecule;a modified histone; ora complex of two or more proteins comprising at least one of these.

35. The method of claim 34, wherein the histone-modification-specific binding molecule comprises a histone modification binding antibody, a bromo-domain protein, or a chromodomain protein.

36. The method of any one of claims 1-5, 7, or 8, wherein poly-cation molecule mediated phase separation comprises:gravity-based separation of phases; orsolid surface-based separation of phases.

37. The method of claim 36, wherein gravity-based separation of phases comprises centrifugal separation.Filed: November 14, 202538. The method of claim 36, wherein solid surface-based separation of phases comprises bead capture, such as magnetic bead capture.

39. The method of claim 36, comprising solid surface-based separation of phases, wherein at least a portion of the capture scaffold is nucleic acid bound directly or indirectly to the solid surface.

40. The method of claim 39, wherein the nucleic acid is covalently bound to the solid surface.

41. The method of any one of claim 38-40, further comprising adding polyethylene glycol (PEG) or another crowding polymer or passivating agent to the complex fluid sample before subjecting the complex fluid sample to poly-cation molecule mediated phase separation.

42. The method of any one of claims 1 -41 , for use in:health surveillance;disease surveillance;disease diagnosis;molecular subtyping;treatment stratification;treatment selection;clinical decision making;predicting treatment response;monitoring treatment response;genome characterization; ordrug discovery or characterization.

43. A database comprising DNA fragment sequences or cfDNA sequences produced by a sequencing method of claim 15.

44. A method for characterizing an epigenetic landscape in a complex fluid, essentially as described herein.

45. A kit for carrying out the method of any one of claims 1 -43, comprising at least one of:a capture scaffold;a phase separation contrast modulator;Filed: November 14, 2025 a DNA condensation agent; ora fragmented DNA control sample.

46. A system to phase separate DNA from a complex biological or other complex fluid sample, the system comprising:a sample isolation device, which is adapted to isolate a biological sample from a subject;a separation device, which is adapted to subject the complex fluid sample to polycation molecule mediated condensation phase separation in the presence of a scaffold, to produce a dilute phase and a condensed phase;one or more DNA analysis devices, which is / are adapted to analyze and / or characterize DNA in the dilute and condensed phases, thereby obtaining one or more DNA information results; andan alignment device, which is adapted to align one or more of the DNA information results between the dilute and condensed phases in order to determine or provide a pseudoaccessibility score for one or more locations within a DNA genome based on the alignment result.

47. The system of claim 46, wherein at least one DNA analysis device is a sequencing device.

48. The system of claim 46, wherein the complex biological or other complex fluid sample comprises a substantially unpurified bodily fluid from a subject, such as a human or other mammalian subject.

49. The system of any one of claims 46-48, further comprising an information delivery device capable of delivering to a receiver information about the results of the analysis.

50. The system of claim 49, wherein the information comprises one or more of: identity and / or relative or absolute quantity of DNA fragments mapping to a specified locus within a genome, proportional amount of any such locus that is found in the dilute and condensed phases from an analyzed sample, and fragmentomic information about DNA in the dilute and condensed phases.

Images