Pogostemon cablin transcription factor PcERF1 and application of pogostemon cablin transcription factor PcERF1 in positive regulation of biosynthesis of pogostemon cablin ketone

By screening and constructing plants that overexpress or silence the PcERF1 gene, the synthesis efficiency of patchouli ketone was improved using Agrobacterium-mediated transformation, solving the problem of insufficient patchouli ketone content in existing technologies and realizing efficient patchouli ketone biosynthesis.

CN121914243AActive Publication Date: 2026-04-24GUANGDONG PHARMA UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GUANGDONG PHARMA UNIV
Filing Date
2026-03-26
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively utilize the plant transcription factor PcERF1 to regulate the biosynthesis of patchouli, resulting in insufficient patchouli content and limiting its role as an antibacterial agent and in medicinal applications.

Method used

The Unigene1163_All gene, which is closely related to AtERF1, was selected and named PcERF1. Stable genetically transformed plants that overexpress or silence PcERF1 were constructed, and the expression of PcERF1 in patchouli was increased by Agrobacterium-mediated transformation to promote the biosynthesis of patchouli ketones.

Benefits of technology

Overexpression of PcERF1 increased patchouli content by approximately 30%, while silencing PcERF1 reduced patchouli content by approximately 30%, thus achieving effective regulation of patchouli biosynthesis and improving the synthesis efficiency of patchouli.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121914243A_ABST
    Figure CN121914243A_ABST
Patent Text Reader

Abstract

The invention discloses a patchouli transcription factor PcERF1 and application of the patchouli transcription factor PcERF1 in positive regulation of biosynthesis of patchouli ketone. A candidate gene PcERF1 (the nucleotide sequence is shown as SEQ ID No.1) with large expression quantity difference is screened based on a transcriptome result of ketone-type VS alcohol-type pogostemon cablin (ketone-type gene expression quantity is high). A result of constructing a PcERF1-overexpressed patchouli strain with stable genetic transformation shows that the PcERF1 expression quantity in the PcERF1-overexpressed patchouli strain is remarkably increased by 3 times compared with a control group, and meanwhile, the content of patchouli ketone in leaves is also increased by about 30%. Therefore, it is determined that the PcERF1 is a potential transcription factor with the effect of promoting biosynthesis of the patchouli ketone, and the PcERF1 has important significance in promoting efficient synthesis of the patchouli ketone in the patchouli.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to a patchouli transcription factor. PcERF1 And its application in the positive regulation of patchouli biosynthesis. Background Technology

[0002] Patchouli ( Pogostemon cablin (Blanco) Benth. is a perennial aromatic herb or subshrub belonging to the genus Blanco in the Lamiaceae family. As a traditional Chinese medicine from the Lingnan region, it is listed as one of the "Ten Southern Chinese Medicines" due to its unique medicinal value and wide clinical application.

[0003] Patchouli ketone is the core active ingredient of patchouli volatile oil. Patchouli ketone can be used for: (1) inhibiting various pathogenic bacteria and plant pathogens, and can be developed into natural antibacterial agents and agricultural antibacterial agents; (2) inhibiting inflammatory factors, and can be used for the treatment of inflammation and immune-related diseases. At the same time, patchouli ketone is also a quality judgment indicator for high-quality ketone-type patchouli. Improving its synthesis efficiency can directly increase the content of effective ingredients in medicinal materials and amplify their application potential.

[0004] Chinese patent application CN120118169A discloses a patchouli transcription factor. PcIDD2 Its application in the positive regulation of patchouli biosynthesis; Key genes in patchouli biosynthesis PcAAE2 The article "Cloning of the Promoter and Screening of Transcription Factors Binding to It" also mentions the key genes in patchouli biosynthesis. PcAAE2 The ERF1 gene is a plant transcription factor that mainly participates in plant stress resistance, development, and signal transduction, regulating plant responses to environmental stresses. However, current technologies do not specify its exact role in this process. PcERF1 Application of genes in regulating patchouli content. Summary of the Invention

[0005] The purpose of this invention is to overcome the aforementioned defects and shortcomings in the prior art and to provide a patchouli transcription factor. PcERF1 .

[0006] A second objective of this invention is to provide a biomaterial.

[0007] A third objective of this invention is to provide the aforementioned patchouli transcription factor. PcERF1 Or the application of the above-mentioned biological materials in positively regulating patchouli biosynthesis and in creating patchouli varieties with high patchouli biosynthesis.

[0008] A fourth object of the present invention is to provide a method for promoting the above-mentioned patchouli transcription factor. PcERF1 Application of the expressed reagent in the creation of patchouli varieties with high patchouli ketone biosynthesis.

[0009] The fifth objective of this invention is to provide a method for creating a patchouli variety with high patchouli ketone biosynthesis.

[0010] The above-mentioned objective of this invention is achieved through the following technical solution: This invention provides a patchouli transcription factor PcERF1 The patchouli transcription factor PcERF1 The encoded amino acid sequence is shown in SEQ ID No. 2.

[0011] This invention screened six candidate genes based on transcriptome results of keto-type vs. alcohol-type patchouli (with high expression of the keto-type gene). Based on the FPKM ratio, a line with a significant expression difference, Unigene1163_All, was ultimately selected as a candidate gene (the gene sequence of Unigene1163_All is shown in SEQ ID No. 1). Phylogenetic analysis showed that Unigene1163_All... AtERF1 Because of the close kinship, the candidate gene Unigene1163_All was named... PcERF1 .

[0012] To investigate PcERF1 To regulate the content of patchouli ketones in patchouli, this invention first involves transiently silencing the ketones in patchouli. PcERF1 Gene, results showed that pTRV2- PcERF1 group PcERF1 Gene expression levels were reduced by approximately 90% compared to the pTRV2 group, while the patchouli content in leaves decreased by approximately 20%. Further experiments were conducted to construct overexpression or silencing mechanisms. PcERF1 Stable genetically transformed plants were obtained from the OE group pCAMBIA1301-. The results showed that the OE group pCAMBIA1301- PcERF1 and RNAi group pK7GWIWG2D- PcERF1 The relative expression levels of patchouli were significantly upregulated and downregulated by 3-fold compared to the control groups (pCAMBIA1301 group and pK7GWIWG2D group), respectively. Simultaneously, the content of patchouli ketone in the leaves increased or decreased by approximately 30%. Therefore, patchouli transcription factors... PcERF1 It can positively regulate the biosynthesis of patchouli in patchouli and is a potential transcription factor that promotes the biosynthesis of patchouli.

[0013] Furthermore, the patchouli transcription factor PcERF1 The nucleotide sequence is shown in SEQ ID NO.1.

[0014] This invention provides a biomaterial comprising the above-mentioned patchouli transcription factor. PcERF1 The expression cassette, expression vector, or expression strain.

[0015] This invention also provides the above-mentioned patchouli transcription factor. PcERF1 Or the application of the above-mentioned biological materials in the positive regulation of patchouli biosynthesis.

[0016] Furthermore, the positive regulation of patchouli biosynthesis refers to the positive regulation of patchouli biosynthesis in patchouli.

[0017] This invention also provides the above-mentioned patchouli transcription factor. PcERF1 Or the application of the above-mentioned biological materials in the creation of patchouli varieties with high patchouli ketone biosynthesis.

[0018] This invention provides a method for promoting the above-mentioned patchouli transcription factor. PcERF1 Application of the expressed reagent in the creation of patchouli varieties with high patchouli ketone biosynthesis.

[0019] Furthermore, the reagent includes primer pairs as shown in SEQ ID No. 3-4 or SEQ ID No. 13-14.

[0020] This invention provides a method for improving the biosynthesis of patchouli ketone, wherein the method involves increasing the above-mentioned patchouli transcription factor through transgenic methods. PcERF1 Expression in patchouli.

[0021] This invention also provides a method for creating a patchouli variety with high patchouli ketone biosynthesis, wherein the method involves increasing the above-mentioned patchouli transcription factor through transgenic methods. PcERF1 Expression in patchouli.

[0022] Furthermore, the genetic modification method is Agrobacterium-mediated transformation.

[0023] Preferably, the Agrobacterium is Agrobacterium tumefaciens GV3101.

[0024] Furthermore, the method includes the following steps: S1. Utilizing overexpression PcERF1 Agrobacterium infection of patchouli leaves, co-cultured for a period of time, then transferred to selection medium and cultured until resistant shoots grew; S2. Cut off the resistant clustered buds and insert them into the screening rooting medium to root them.

[0025] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a patchouli transcription factor PcERF1 This invention relates to the positive regulation of patchouli ketone biosynthesis and its application. Based on the transcriptome results of ketone vs. alcohol-type patchouli (with high expression of the ketone gene), this invention screened a candidate gene with a large difference in expression level. PcERF1(The nucleotide sequence is shown in SEQ ID No. 1). By constructing an overexpression... PcERF1 Furthermore, the results showed that the stable genetic transformation of patchouli lines indicated that overexpression PcERF1 Among the patchouli strains PcERF1 The expression level was significantly upregulated by 3 times compared to the control group, and the content of patchouli in the leaves also increased by about 30%. Therefore, this invention identifies... PcERF1 It is a potential transcription factor that promotes the biosynthesis of patchouli, which is of great significance for promoting the efficient synthesis of patchouli in patchouli. Attached Figure Description

[0026] Figure 1 Phylogenetic tree analysis for Unigene1163_All.

[0027] Figure 2 pTRV2- PcERF1 Transient silencing expression strains PcERF1 Analysis of expression levels and patchouli content.

[0028] Figure 3 pCAMBIA1301- PcERF1 Overexpression lines PcERF1 Analysis of expression levels and patchouli content.

[0029] Figure 4 pK7GWIWG2D- PcERF1 Silent expression strains PcERF1 Analysis of expression levels and patchouli content. Detailed Implementation

[0030] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0031] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0032] Example 1 Patchouli Transcription Factor PcERF1 Screening and amplification I. Experimental Methods 1. Experimental materials Guangzhou Shipai Patchouli (hereinafter referred to as SP), Zhaoqing Liantang Patchouli (hereinafter referred to as LT), Hainan Patchouli (hereinafter referred to as HN), Suixi Patchouli, etc. (hereinafter referred to as SX). Among them, SP and LT are ketone-type patchouli, while HN and SX are alcohol-type patchouli.

[0033] 2. Gene screening Four strains and two chemotypes of patchouli (SP, LT, HN, SX) were simultaneously planted in Longgang Village, Huocun Committee, Liantang Town, Gaoyao District, Zhaoqing City, Guangdong Province. Roots, stems, and leaves of the four strains and two chemotypes of patchouli (SP, LT, HN, SX) were subsequently collected for transcriptome sequencing. Based on these four sets of transcriptome data, transcription factors with higher expression levels in ketone patchouli compared to alcohol-type patchouli were screened. The specific screening method is shown in Table 1 below. Table 1. Screening of differentially expressed genes from transcriptomes of four strains and two chemotypes of Patchouli.

[0034] The first group consists of SP vs HN (high SP gene expression) and LT vs HN (high LT gene expression), which screen for duplicate genes and can identify ketotype vs HN (high ketotype gene expression) genes. The second group consists of SP vs SX (high SP gene expression) and LT vs SX (high LT gene expression), which screen for duplicate genes and can identify ketotype vs SX (high ketotype gene expression) genes. The third group consists of ketotype vs HN (high ketotype gene expression) and ketotype vs SX (high ketotype gene expression), which screen for duplicate genes and can identify ketotype vs alcohol type (high ketotype gene expression) genes.

[0035] 3. Phylogenetic tree analysis The selected candidate gene sequences were uploaded to TAIR (https: / / www.arabidopsis.org / ) for BLAST, and those with an e-value less than 10 were selected. -5 Phylogenetic analysis was performed on the sequences, and a phylogenetic tree (Neighbor-joining, Jones-Taylor-Thornton, 1000 replicates) was constructed using MEGA 10 software. Candidate genes were renamed based on the phylogenetic tree results.

[0036] II. Experimental Results Six candidate genes were screened from the transcriptome results of keto-type vs. alcohol-type (keto-type gene expression is high). Based on the FPKM ratio, the Unigene1163_All line with a large expression difference was finally selected as a candidate gene (the nucleotide sequence of Unigene1163_All is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No. 2). Phylogenetic analysis showed the following results: Figure 1 As shown, Unigene1163_All and AtERF1 Because of the close kinship, the candidate gene Unigene1163_All was named... PcERF1.

[0037] Example 2 Patchouli Transcription Factor ​ amplification RNA was extracted from patchouli using the RNA prep Pure Plant total RNA extraction kit from Tiangen Biotech Co., Ltd. The integrity of the extracted RNA was detected by 1.2% agarose gel electrophoresis, and A... 260 / A 280 Numerical values ​​determine RNA quality and concentration, A 260 / A 280 The ratio should be between 1.8 and 2.1. Based on the electrophoresis bands, ensure the brightness ratio of the 28S rRNA to 18S rRNA bands in the sample is approximately 2:1. The extracted RNA is then processed using TransScript. ® II. The All-in-One First-Strand cDNA Synthesis SuperMix for PCR kit reverse transcribes total RNA into first-strand cDNA.

[0038] according to ​ The gene's ID in the transcriptome is used to obtain its CDS sequence. Primers are designed using Snapgene software based on primer design principles. ​ The CDS amplification primers (Table 2) were sent to Qingke Biotechnology Co., Ltd. for synthesis.

[0039] Table 2 ​ CDS amplification primers

[0040] Using cDNA from patchouli leaves as a template, PCR amplification was performed using TaKaRa high-fidelity polymerase. The reaction system and amplification program are shown in Tables 3 and 4. The PCR products were recovered by gel excision, and their purity and concentration were determined. The products were stored at -20℃.

[0041] Table 3 PCR amplification reaction system

[0042] Table 4 PCR Amplification Program

[0043] Example 3: Instantaneous Silencing with VIGS Technology ​ Gene I. Experimental Methods 1. ​ Fragment introduced into the pTRV2 vector homologous arm Use the SGN VIGS Tool website (https: / / vigs.solgenomics.net / ) to select... ​A 300-500bp fragment of the gene was constructed using Snapgene software. ​ The pTRV2 vector model was used, and homologous arm primers were designed based on the reverse insertion of EcoRI and XhoI restriction sites. The primers are shown in Table 5, and the reaction system and amplification program are shown in Tables 3 and 4. The PCR products were recovered by gel excision, and their purity and concentration were determined. The products were stored at -20℃.

[0044] Table 5 ​ -pTRV2 homologous arm primers

[0045] 2. pTRV2 vector digestion use ​ I and ​ The pTRV2 plasmid was digested with restriction endonuclease I. The digestion system is shown in Table 6. The digestion was carried out at 37℃ for 15 min. The digestion products were recovered by gel excision and stored at -20℃.

[0046] Table 6 pTRV2 double enzyme digestion reaction system

[0047] 3. ​ Linked with pTRV2 linearized vector pTRV2- ​ Homologous recombination of the fragment and the pTRV2 linearized vector was performed using the SE Seamless Cloning and Assembly Kit from Zhuangmeng Biotechnology. The recombination reaction system is shown in Table 7. After mixing the reaction solution, the cells were placed in a 37°C water bath for 30 min to transform DH5α competent cells. Single colonies were selected for PCR verification. Based on the verification results, the bacterial culture was sent to Qingke Biotechnology for sequencing (pTRV2 vector sequencing primers pTRV2-F: GGGAGATGATACGCTGTTTG (SEQ ID No. 7), pTRV2-R: GTACAGACGGGCGTAATAAC (SEQ ID No. 8)). After confirming that the insertion site was correct and the sequence was correct, the plasmid was extracted.

[0048] Table 7 pTRV2- ​ Homologous recombination reaction system with pTRV2 linearized vector

[0049] 4. VIGS method for instantaneous silence ​ Gene (1) pTRV1, pTRV2 and pTRV2- were transformed into Agrobacterium tumefaciens GV3101, respectively. ​ Plasmid.

[0050] (2) Select single colonies of Agrobacterium and perform colony PCR using pTRV2-F and pTRV2-R as primers. Select positive clones into 5 mL of LB liquid medium containing antibiotics (containing 50 mg / L Kan and 50 mg / L Rif) and culture them at 28℃, 180 rmp, for 16-18 h to obtain primary bacteria.

[0051] (3) Take 1 mL of primary bacterial culture and inoculate it into LB liquid medium containing antibiotics (containing 50 mg / L Kan, 50 mg / L Lfif, 10 mM MES, 10 mM MgCl2, and 20 μM AS). Incubate at 28°C and 180 rpm until the bacterial culture reaches OD. 600 A value of 1.5 indicates the presence of secondary bacteria. The pTRV1 bacterial culture was cultured using the same method as described above.

[0052] (4) Centrifuge at 10,000 rpm for 10 min at room temperature. Discard the supernatant.

[0053] (5) Prepare the resuspension solution: 10 mM MES, 10 mM MgCl2, 200 μM AS.

[0054] (6) Add resuspension solution to resuspend the bacterial cells, so that the OD of the bacterial solution reaches 1.5.

[0055] (7) Let stand at room temperature for 3-6 hours.

[0056] (8) Combine pTRV1 with pTRV2 or pTRV2- ​ The bacterial solutions were mixed at a 1:1 ratio.

[0057] (9) Take 10 patchouli plants with uniform growth and inject them into the second pair of leaves. The injection should be performed when the back of the leaves is moist.

[0058] (10) After injection, place in a 24℃, 16 / 8 photoperiod for incubation, and observe and water carefully.

[0059] (11) Fourteen days after injection, VIGS-silenced leaflets were collected. One sample was flash-frozen in liquid nitrogen and stored at -80°C. The other sample was used for patchouli content detection.

[0060] 5. Verification (1) Three patchouli leaves were collected, RNA was extracted, and cDNA was obtained by reverse transcription. The silencing efficiency was detected by qRT-PCR. Primer sequences are shown in Table 8.

[0061] Table 8 qRT-PCR primer sequences

[0062] (2) Collect the leaves of 3 patchouli plants and prepare patchouli ketone.

[0063] Preparation method of patchouli ketone: Take leaf samples of transgenic plants that have been quick-frozen in liquid nitrogen, grind them in a pre-cooled mortar, accurately weigh 350 mg, add 1.5 mL of n-hexane, extract by ultrasonication at 60 Hz for 30 min, incubate in a water bath at 56℃ for 1 h, centrifuge at 12000 rpm for 10 min, take the supernatant, filter it through an organic filter membrane and put it into a gas phase vial as the test solution.

[0064] Accurately weigh 25 mg of patchouli ketone and prepare a 1 mg / mL stock solution with n-hexane. Accurately pipette an appropriate amount of the stock solution and dilute with n-hexane to prepare six aliquots of reference standard solutions with different concentrations: 500 μg / mL, 400 μg / mL, 250 μg / mL, 200 μg / mL, 100 μg / mL, and 50 μg / mL. Inject these solutions under chromatographic conditions and record the chromatograms. Perform linear regression with the reference standard solution concentration as the x-axis (μg / mL) and peak area as the y-axis to plot a standard curve.

[0065] GC-MS experiments were performed using an HP-5MS capillary column (30 m × 0.25 mm, 0.25 μm). The temperature program was as follows: initial 120℃, hold for 2 min, increase to 160℃ at 5℃ / min, hold for 2 min, increase to 180℃ at 10℃ / min, hold for 2 min, increase to 250℃ at 30℃ / min; split ratio 30:1; carrier gas: high-purity helium; column oven temperature 120℃; injection port temperature 250℃; interface temperature 250℃; injection volume μL. Mass spectrometry conditions: EI ion source; ion source temperature: 200℃; ionization energy: 70 eV; scan mass range m / z: 50–500; solvent delay: 2 min. The standard library NIST17.lib was used.

[0066] The accumulation of patchouli was determined by GC-MS. The concentration of patchouli in the sample (μg / mL) was calculated by substituting the peak area into the linear regression equation. The patchouli content in patchouli leaves was then calculated.

[0067] II. Experimental Results injected with pTRV2- ​ RNA was extracted from patchouli leaves from Agrobacterium-mediated silencing, and cDNA was obtained by reverse transcription. qRT-PCR analysis was performed to verify the silencing efficiency, which was compared with that obtained from Agrobacterium-mediated silencing with pTRV2 injection. ​ Gene silencing was successful, and the silencing efficiency results were as follows: ​ As shown, the results indicate that pTRV2- ​ group ​ Gene expression levels were reduced by approximately 90% compared to the pTRV2 group.

[0068] injected with pTRV2-​ The content of patchouli ketone in patchouli leaves was determined by Agrobacterium tumefaciens inoculum solution to verify... ​ The effect of transient gene silencing on patchouli was compared with that of injection of pTRV2 Agrobacterium tumefaciens, and the results are as follows: ​ As shown, the results indicate that pTRV2- ​ The patchouli content in the gene-silenced group was significantly lower than that in the pTRV2 group (p<0.001), with a reduction of approximately 20%.

[0069] Example 4 ​ Construction of stable genetically modified plants I. Experimental Methods (a) OE- ​ Carrier construction 1. ​ Fragment introduced into the homologous arm of the pCAMBIA1301 vector The CDS fragment of the PcERF1 gene was selected and constructed using Snapgene software. ​ -pCAMBIA1301 (abbreviated as OE-) ​ A vector model was established, and homologous arm primers were designed based on the inserted NcoI and BstEⅡ restriction sites. The primers are shown in Table 9, and the reaction system and amplification program are shown in Tables 3 and 4. The PCR products were recovered by gel excision, and their purity and concentration were determined. The products were stored at -20℃.

[0070] Table 9 OE- ​ Homologous arm primers

[0071] 2. pCAMBIA1301 vector digestion The pCAMBIA1301 plasmid was digested with NcoI and BstEII restriction endonucleases. The digestion system is shown in Table 10. The digestion was carried out at 60℃ for 1 h. The digestion products were recovered by gel excision and stored at -20℃.

[0072] Table 10 pCAMBIA1301 double enzyme digestion reaction system

[0073] 3. ​ Linked with pCAMBIA1301 linearized carrier OE- ​Homologous recombination of the fragment and the linearized pCAMBIA1301 vector was performed using the SE Seamless Cloning and Assembly Kit from Zhuangmeng Biotechnology. The recombination reaction system is shown in Table 7. After mixing the reaction solution, the mixture was incubated at 37°C for 30 min. DH5α competent cells were then transformed. Single colonies were selected for PCR verification. Based on the verification results, the bacterial culture was sent to Qingke Biotechnology for sequencing (pCAMBIA1301 vector sequencing primers GBD-F: AGAGGACCTAACAGAACTCG (SEQ ID No. 15), GBD-R: TAATCATCGCAAGACCGGCAAC (SEQ ID No. 16)). After confirming that the insertion site was correct and the sequence was correct, the plasmid was extracted. The plasmid with the verified correct sequence was stored at -20°C for transformation of competent Agrobacterium.

[0074] (two) ​ Silent carrier construction 1. Gateway cloning system primer design and target sequence amplification (silencing vector construction) Primers for ligating the gateway vector (pDnor221) were designed based on the target gene sequence and the specific site sequence of the gateway technology entry vector (as shown in Table 11). The primers for the plant RNAi plasmid were... ​ Expression interference was performed on a 209bp sequence in the gene. The designed sequence was then amplified using PCR.

[0075] Table 11 RNAi- ​ Primers

[0076] The BP reaction used Gateway BP Clonase II Enzyme Mix (ThermoFisher). The reaction system is shown in Table 12 below: Table 12 Connection System

[0077] Add the above components to a 200 μL PCR tube and mix gently. Incubate at 25°C for 1 hour. After ligation, remove the PCR tube, add 0.5 μL of proteinase K, and incubate at 37°C for 10 minutes.

[0078] The BP reaction product was introduced into Transl-T1 Escherichia coli, single clones were picked for colony PCR, and positive clones were sent to Qingke Biotechnology Co., Ltd. for sequencing.

[0079] The LR reaction was performed using Gateway LR Clonase II Enzyme Mix (ThermoFisher). The reaction system is shown in Table 13 below: Table 13 Reaction System

[0080] Add the above components to a 200 μL PCR tube and mix gently. Incubate at 25°C for 1 hour. After ligation, remove the PCR tube, add 0.5 μL of proteinase K, and incubate at 37°C for 10 minutes.

[0081] pK7GWIWG2D- ​ The recombinant plasmid was introduced into TranslT-1, and the empty vector pK7GWIWG2D-0 plasmid was introduced into TransDB3.1 E. coli. The difference was that spectinomycin (Spec) should be used as the antibiotic in this case. The verification primer for the target sequence PcERF1i near the T35S end of the pK7GWIWG2D plasmid consisted of the primer located 50 bp upstream of the attR1 site (att R1T35S) (pK7GWIWG2D-F1) and the downstream primer of PcERF1i (PcERFi-R); while the verification primer for the target sequence antisense-PcERF1i near the P35S end consisted of the primer located 79 bp upstream of the attR2 site (att R2P35S) (pK7GWIWG2D-F2) and the downstream primer of antisense-PcERF1i (antisense-PcERF1i-R) (primer sequences are shown in Table 14). Single clones grown on LB plates were selected for colony PCR verification. Positive clones were sent to Qingke Biotechnology Co., Ltd. for sequencing. Plasmids with correct sequences were stored at -20℃ for transformation of competent Agrobacterium.

[0082] Table 14 RNAi- ​ PCR primers

[0083] (III) Agrobacterium-mediated genetic transformation of patchouli (1) Transformation of Agrobacterium tumefaciens GV3101.

[0084] (2) Cut the aseptic patchouli seedlings into 0.5 cm pieces. 2 The square leaf discs on the left and right were cultured in pre-medium (MS + 10 mg / L AS) for 3 days, with 1500 lx light for 14 h / d.

[0085] (3) Select single colonies of Agrobacterium and perform colony PCR using GBD-F and GBD-R, pK7GWIWG2D-F1 and PcERF1i-R, antisense-PcERF1i-R and pK7GWIWG2D-F2 as primers. Select positive clones into 5 mL of LB liquid medium containing antibiotics (containing 50 mg / L Kan and 50 mg / L Rif) and culture them at 28℃, 180 rmp, for 16-18 h to obtain primary bacteria.

[0086] (4) Take 1 mL of primary bacterial culture and inoculate it into 100 mL of LB liquid medium containing antibiotics (containing 50 mg / L Kan, 50 mg / L Rif, 10 mM MES, 10 mM MgCl2, and 20 μM AS). Incubate at 28°C and 180 rpm until the bacterial culture reaches OD. 600 A value of 0.3-0.4 indicates the presence of secondary bacteria.

[0087] (5) Centrifuge the bacterial culture at 12,000 rpm for 2 min, and then resuspend it in 100 mL of infection solution (MS + 10 mg / L AS).

[0088] (6) After 3 days of pre-culture, the patchouli leaf discs were placed in the infection solution and treated at 160 rpm and 28°C for 20 min. The bacterial solution on the surface of the leaf discs was dried with filter paper and placed on co-culture medium (MS + 10 mg / L AS) and co-cultured at 28°C in the dark for 3 days.

[0089] (7) After co-culturing for 3 days, the patchouli leaf discs were placed in 100 mL of washing solution (MS + 450 mg / L Timentin) and treated at 160 rpm and 28℃ for 20 min. The liquid in the leaf discs was absorbed with filter paper and placed on selection medium (MS + 20 mg / L Hyg + 450 mg / L Timentin). The selection medium was changed every 7 days until clustered shoots appeared.

[0090] (8) Cut off the resistant shoot clusters and insert them into the selection and rooting medium (1 / 2 MS + 450 mg / L Timentin) for rooting. Then harden off the seedlings and cultivate them in soil.

[0091] (iv) Identification of genetically modified positive patchouli 1. DNA-level identification Take 0.1g each of fresh patchouli leaves from the empty vector, OE group, and RNAi group, and extract DNA from the plant materials using the TaKaRa MiniBEST PlantGenomic DNA Extraction Kit (TaKaRa). The steps are as follows: (1) After grinding 100 mg of each experimental group material with liquid nitrogen, add 10 μL of 50×DTT Buffer and 500 μL of Buffer HSI and mix thoroughly. Then add 10 μL of RNase A (10 mg / mL), shake, and lyse in a water bath at 56℃ for 10 min. (2) Add 62.5 μL of Buffer KAC to the lysed sample and mix well. After incubating on ice for 5 min, centrifuge at 12,000 rpm for 5 min. Carefully aspirate the supernatant using a pipette, add an equal volume of Buffer GB to the supernatant, and mix thoroughly. (3) Insert the Spin Column from the kit into the Collection Tube, transfer the solution into the Spin Column, centrifuge at 12000 rpm for 1 min, and discard the waste liquid; (4) Add 500 μL of Buffer WA to the Spin Column, centrifuge at 12000 rpm for 1 min, and discard the filtrate; (5) Add 700 μL of buffer WB to the Spin Column, centrifuge at 12000 rpm for 1 min, and discard the filtrate. Repeat the above steps once; (6) Place the Spin Column onto the new Collection Tube and centrifuge at 12,000 rpm for 2 min; (7) Place the Spin Column into a new EP tube, add 30-50 μL of solution buffer to the center of the Spin Column membrane, and let it stand at room temperature for 5 min; (8) Elute DNA by centrifugation at 12000 rpm for 2 min. Verify the purity and concentration of genomic DNA by measuring absorbance using a 1% agarose gel electrophoresis and a micro spectrophotometer; Using GBD-F and GBD-R, pK7GWIWG2D-F1 and PcERF1i-R as specific primers, and patchouli DNA from the corresponding experimental group as a template, PCR amplification was performed. The system was the same as in Tables 3 and 4.

[0092] 2. Determination of relative expression levels of transgenic positive patchouli Leaves from three patchouli plants were collected, RNA was extracted, and cDNA was obtained by reverse transcription. The silencing efficiency was detected by qRT-PCR. Primer sequences are shown in Table 8.

[0093] 3. Determination of patchouli ketone content in transgenic positive patchouli The measurement method is the same as in Example 3.

[0094] II. Experimental Results Agrobacterium-mediated transformation of patchouli leaf discs​ Genetic transformation of the gene had an effect on patchouli in each experimental group. ​ The relative expression levels of genes were determined, and the RT-qPCR results are as follows: ​ and ​ As shown, compared to the pCAMBIA1301 control group (wild type), the OE group pCAMBIA1301- ​ The relative expression levels of all three genes were significantly upregulated by 3-fold. Compared to the pK7GWIWG2D group (wild-type), the RNAi group showed a significantly higher expression level of pK7GWIWG2D-. ​ The relative expression level was downregulated by 3-fold, indicating that the present invention successfully overexpressed or silenced the transgene in the OE group or RNAi group, respectively. ​ .

[0095] The patchouli ketone content of positive transgenic patchouli leaves was detected to verify... ​ The effects of gene silencing and overexpression on patchouli ketone, compared with their respective empty vector transgenes, are as follows: ​ and ​ As shown, the results indicate that pCAMBIA1301- ​ The patchouli content in the gene overexpression group was significantly higher than that in the pCAMBIA1301 group (p<0.05), with an increase of approximately 30%. pK7GWIWG2D- ​ The patchouli content in the gene-silenced group was significantly lower than that in the pK7GWIWG2D group (p<0.05), with a reduction of approximately 30%.

Claims

1. A patchouli transcription factor PcERF1 Its characteristics are, The patchouli transcription factor PcERF1 The encoded amino acid sequence is shown in SEQ ID No.

2.

2. The patchouli transcription factor according to claim 1 PcERF1 Its characteristics are, The patchouli transcription factor PcERF1 The nucleotide sequence is shown in SEQ ID No.

1.

3. A biomaterial, characterized in that, The biomaterial includes the patchouli transcription factor as described in claim 1 or 2. PcERF1 The expression cassette, expression vector, or expression strain.

4. The patchouli transcription factor according to claim 1 or 2 PcERF1 Or the application of the biomaterial described in claim 3 in the positive regulation of patchouli ketone biosynthesis.

5. The patchouli transcription factor according to claim 1 or 2 PcERF1 Or the application of the biomaterial described in claim 3 in the creation of patchouli varieties with high patchouli ketone biosynthesis.

6. For promoting the patchouli transcription factor as described in claim 1 or 2 PcERF1 Application of the expressed reagent in the creation of patchouli varieties with high patchouli ketone biosynthesis.

7. The application according to claim 6, characterized in that, The reagents include primer pairs as shown in SEQ ID No. 3-4 or SEQ ID No. 13-14.

8. A method for creating a patchouli variety with high patchouli ketone biosynthesis, characterized in that, The method involves increasing the patchouli transcription factor described in claim 1 or 2 through a genetic modification approach. PcERF1 Expression in patchouli.

9. The method according to claim 8, characterized in that, The genetic modification method is Agrobacterium-mediated transformation.

10. The method according to claim 8, characterized in that, The method includes the following steps: S1. Utilizing overexpression PcERF1 Agrobacterium infection of patchouli leaves, co-cultured for a period of time, then transferred to selection medium and cultured until resistant shoots grew; S2. Cut off the resistant clustered buds and insert them into the screening rooting medium to root them.

Citation Information

Patent Citations

  • Method for producing patchouli ketone from pogostemon cablin aerial cultured root

    CN112841029A

  • Application of pogostemon cablin enolase PcENO3 in preparation of product for regulating biosynthesis of pogostemon cablin alcohol

    CN117305286A

  • VIGS method for agastache rugosus gene function research and application

    CN119570841A

  • Pogostemon cablin transcription factor PcIDD2 and application of pogostemon cablin transcription factor PcIDD2 in positive regulation of biosynthesis of pogostemon cablin ketone

    CN120118169A

  • Patchouli cold stress response transcription factor and application thereof in resisting cold and improving alcohol content of patchouli

    CN121087090A