Application of OsFRK3 in regulation and control of rice biomass

Abstract

The invention discloses an application of OsFRK3 in regulation and control of rice biomass. The OsFRK3 disclosed by the invention is a protein as shown in SEQ ID No. 9. Experiments prove that after the encoding gene of the OsFRK3 is edited, the plant height, the single plant yield and the overground plant biomass of an obtained gene edited strain are all remarkably reduced. It is indicated that OsFRK3 is crucial to normal growth of plants, can be used for regulating and controlling the plant height, the yield of a single plant and the biomass of overground plants, and has a good application prospect.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically the application of OsFRK3 in regulating rice biomass. Background Technology

[0002] Photosynthesis is the primary pathway for plants to synthesize carbohydrates. During photosynthesis, plants use light energy to convert carbon dioxide and water into carbohydrates such as glucose. These carbohydrates then undergo a series of reactions to provide energy for cellular metabolism and biosynthesis. Furthermore, carbohydrate metabolism can regulate photosynthesis in various ways. Studies have shown that carbohydrates can influence the rate and efficiency of photosynthesis through signal transduction pathways. In addition, carbohydrates can act as signaling molecules during photosynthesis, regulating the expression of related genes and enzyme activity, thereby affecting plant growth and development. Photosynthesis is the main pathway for plants to synthesize carbohydrates, and carbohydrates influence plant growth and development by regulating the photosynthetic process and participating in cellular metabolic activities.

[0003] Plant sugar metabolism is a hot topic in plant science research. Soluble sugars are the main energy source for plant life activities and, as signaling molecules, influence plant growth, development, and stress responses. Sucrose is transported from photosynthetic leaves to sink organs such as roots, meristems, young leaves, flowers, fruits, and seeds. Fructose accounts for half of the hexose produced by sucrose cleavage and can be phosphorylated by fructokinase (FRK) or hexokinase (HXK). FRK is the main fructose phosphorylase, regulating fructose concentration and the distribution and flow of intracellular organic carbon. In plants, cytoplasmic fructokinase phosphorylates fructose to fructose 6-phosphate (F6P), which further participates in glycolysis and respiratory metabolism. However, FRK located in plastids can phosphorylate fructose within the plastids, thereby participating in starch metabolism, amino acid metabolism, and lipid metabolism pathways within the plastids. Plant sugar metabolism is not only related to the basic processes of plant growth and development but is also closely related to plant adaptation to environmental changes and resistance to stress. In-depth research into plant sugar metabolism will help reveal the mysteries of plant life and provide theoretical and practical guidance for agricultural production and plant breeding.

[0004] Sugar transport and metabolism play a crucial role in plant development and crop yield. Once sucrose reaches sink cells via unloading from the phloem, it must be hydrolyzed into glucose and fructose by invertases, or degraded by sucrose synthases to synthesize uridine diphosphate glucose and fructose, which are then used in various metabolic processes and to regulate related physiological and biochemical processes. Fructose, as a signaling molecule, directly or through cross-regulation with other signaling pathways, plays a vital role in regulating gene expression under abiotic stress. FRKs are the main fructose phosphorylases in plants, playing a crucial role in plant sugar metabolism and participating in the regulation of physiological processes such as plant growth and development and stress response. Compared to the widely studied hexokinases, research on FRKs has become increasingly abundant in recent years, and their roles and importance have become more prominent. However, research is still relatively lagging, and many physiological functions and molecular mechanisms involved in the regulation of FRKs remain to be further explained and elucidated. Furthermore, most research on fructose kinases has focused on model plants such as Arabidopsis thaliana, with relatively few studies on field crops. In crop sink organs, the activity of some fructokinases gradually decreases as the sink organ matures. They may play a role in enhancing sink strength in the early stages of sink development. This phenomenon has very important research value and practical significance for increasing crop yield. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to regulate plant biomass, including plant height and yield.

[0006] To address the aforementioned technical problems, the present invention first provides any of the following applications of proteins or substances that regulate the content or activity of said proteins: D1) Regulates plant biomass; D2) Prepare products that regulate plant biomass; D3) Cultivating plants with altered biomass; D4) Preparation of products for cultivating plants with altered biomass; The protein is derived from rice and is named OsFRK3, which is represented by A1), A2), or A3). A1) The amino acid sequence of this protein is SEQ ID No. 9; A2) A protein that has the same function as the amino acid sequence shown in SEQ ID No. 9 in the sequence listing, but with one or more amino acid residues substituted and / or deleted and / or added; A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0007] The OsFRK3 protein in A2) above is a protein that shares 75% or more amino acid sequence identity with the protein shown in SEQ ID No. 9 and has the same function. Identity refers to the similarity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained. The phrase "having 75% or more of the sameness" means having 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the sameness.

[0008] The OsFRK3 protein in A2 above can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.

[0009] The gene encoding the OsFRK3 protein in A2) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in SEQ ID No. 8, and / or by performing a missense mutation of one or more base pairs, and / or by attaching a tag coding sequence to its 5′ and / or 3′ ends. The DNA molecule shown in SEQ ID No. 8 encodes the OsFRK3 protein shown in SEQ ID No. 9.

[0010] The tag described in A3) can be a polypeptide or protein fused with the target protein using in vitro DNA recombination technology, to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag, and / or SUMO tag, etc.

[0011] In the above applications, the substance that regulates the content or activity of OsFRK3 can be any one of the following B1) to B9): B1) Nucleic acid molecules encoding OsFRK3; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2); B8) Nucleic acid molecules that reduce the content or activity of OsFRK3; B9) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues or transgenic plant organs containing the nucleic acid molecules described in B8).

[0012] In the above applications, the nucleic acid molecule described in B1) may be as follows: (b11), (b12), (b13), (b14), or (b15) b11) The coding sequence is the cDNA molecule or DNA molecule of SEQ ID No. 8 in the sequence listing; b12) The DNA molecule shown in SEQ ID No. 8 of the sequence listing; b13) The DNA molecule shown in SEQ ID No. 7 of the sequence listing; b14) has 75% or more identity with the nucleotide sequence defined by b11) or b12) or b13) and encodes a DNA molecule that encodes OsFRK3; b15) hybridizes under strict conditions with a nucleotide sequence defined by b11) or b12) or b13) or b14) and encodes a DNA molecule that is OsFRK3.

[0013] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0014] Those skilled in the art can readily mutate the nucleotide sequence encoding the OsFRK3 protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that possess 75% or higher identity to the nucleotide sequence of the OsFRK3 protein isolated in this invention, provided they encode and function the OsFRK3 protein, are derived from and equivalent to the nucleotide sequence of this invention.

[0015] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the protein of SEQ ID No. 9 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0016] In the above applications, the stringent conditions may be as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4 and 1mM EDTA, followed by rinsing at 50°C in 2×SSC and 0.1% SDS.

[0017] The aforementioned 75% or higher identity can be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0018] B8) The nucleic acid molecule that reduces OsFRK3 content may be an sgRNA that targets the encoding gene of OsFRK3.

[0019] B9) The recombinant vector may be a recombinant vector prepared using the Crisper / Cas9 system capable of editing the OsFRK3 gene. The recombinant vector may express sgRNA targeting the nucleic acid molecule described in B1). The target sequence of the sgRNA may be positions 834-853 of SEQ ID No. 7 in the sequence listing.

[0020] In the above applications, the microorganisms can be yeast, bacteria, algae, or fungi. Among them, bacteria can be Agrobacterium, such as Agrobacterium EHA105.

[0021] In the above applications, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs do not include propagation material.

[0022] In the above applications, the substance that regulates the content or activity of OsFRK3 can be a substance that reduces the content or activity of OsFRK3, the substance that regulates plant biomass can be a substance that reduces the biomass of the plant, and the change in biomass can be a decrease in biomass.

[0023] The present invention also provides any of the following methods: X1) A method for cultivating plants with reduced biomass, including reducing the content or activity of OsFRK3 in a recipient plant, or knocking out the encoding gene of OsFRK3 in a recipient plant, or reducing the expression level of the encoding gene of OsFRK3 in a recipient plant, to obtain a target plant with reduced biomass compared to the recipient plant. X2) Methods for reducing plant biomass include reducing the content or activity of OsFRK3 in the recipient plant, or knocking out the encoding gene of OsFRK3 in the recipient plant, or reducing the expression level of the encoding gene of OsFRK3 in the recipient plant, to obtain a target plant with reduced biomass compared with the recipient plant, thereby achieving the reduction of plant biomass.

[0024] In the above methods, X1) and X2) can be implemented by gene editing of the coding gene of OsFRK3 (such as the CRISPR / Cas9 method). The coding gene can be the nucleic acid molecule described in B1).

[0025] Gene editing of the encoded gene using the CRISPR / Cas9 method can be achieved by introducing a recombinant vector encoding Cas9 and capable of transcribing sgRNA that targets the encoded gene into the recipient plant and then screening to obtain the target plant in which the encoded gene has been edited.

[0026] In an embodiment of the present invention, the target plant is OsFRK3 Gene knockout lines: OsFRK3 -KO1, missing bits 807-840 of SEQ ID No. 7; OsFRK3 -KO2, missing bits 825-840 of SEQ ID No. 7; OsFRK3 -KO3, missing bits 838-840 of SEQ ID No. 7.

[0027] The recombinant vector can be introduced into plant cells using conventional biotechnological methods such as Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp.411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition)).

[0028] The target plant is understood to include not only first-generation plants containing the OsFRK3 protein or its encoding gene that have been altered, but also their progeny. For the target plant, the gene can be propagated within the species, or it can be transferred into other varieties of the same species using conventional breeding techniques, particularly commercial varieties. The target plant includes seeds, callus tissue, intact plants, and cells.

[0029] OsFRK3 or substances that regulate the content or activity of OsFRK3 are also within the scope of protection of this invention.

[0030] In this invention, the biomass can be reflected in plant height, aboveground plant biomass, and / or grain yield.

[0031] The plant may be M1, M2, or M3. M1) Monocotyledons or dicotyledons; M2) Gramineae plants; M3) rice.

[0032] Experiments have shown that editing OsFRK3 significantly reduces plant height, yield per plant, and aboveground biomass in the resulting gene-edited lines. This indicates that... OsFRK3 It is crucial for the normal growth of plants and can be used to regulate plant height, yield per plant, and aboveground plant biomass, showing great promise for application.

[0033] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0034] Figure 1 FRK gene knockout in rice: the gene editing site in rice.

[0035] Figure 2Detection of FRK family gene expression in rice. (AC) Tissue expression of FRK genes in rice; (DF) Spatiotemporal expression of FRK genes in rice, with the horizontal axis representing the number of days after sowing.

[0036] Figure 3 . OsFRK1 , OsFRK2 and OsFRK3 The phenotypes of each knockout line were analyzed. In DF, data labeled with different letters showed significant differences, while data labeled with the same letter showed no significant differences. Detailed Implementation

[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are all commercially available. All quantitative experiments in the following examples were performed in at least three replicates, and the results were averaged. Unless otherwise specified, in the following examples, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.

[0038] The Cas9-pCAMBIA1300 plasmid used in the following examples (Zhang H, Zhang J, Wei P, Zhang B, Gou F, Feng Z, Mao Y, Yang L, Zhang H, Xu N, Zhu JK. The CRISPR / Cas9 system produces specific and homozygous targeted gene editing in rice in one generation. Plant Biotechnol J. 2014, 12(6): 797-807) is available to the public from the applicant. This biological material is only for repeating the relevant experiments of the present invention and shall not be used for other purposes.

[0039] Example 1: OsFRK1, OsFRK2, and OsFRK3 can regulate rice biomass. This embodiment identifies three biomass-regulating proteins derived from Nipponbare rice, named OsFRK1, OsFRK2, and OsFRK3, with sequences shown in SEQ ID No. 3, SEQ ID No. 6, and SEQ ID No. 9 of the sequence listing, respectively. The CDS sequences encoding the three proteins are shown in SEQ ID No. 2, SEQ ID No. 5, and SEQ ID No. 8, respectively, and the genomic sequences are shown in SEQ ID No. 1, SEQ ID No. 4, and SEQ ID No. 7, respectively.

[0040] 1. Gene cloning and vector construction Construction of gene knockout vectors: based on online design websites ( http: / / skl.scau.edu.cn / Design sgRNA and primers, and determine OsFRK1 The target sequence is GCGTATAGAACTTCGTGCCGA (positions 863-882 of SEQ ID No. 1), which has been determined. OsFRK2 The target sequence is GGACTCGGCCAGCGAGACGC (positions 791-810 of SEQ ID No. 4), which has been determined. OsFRK3 The target sequence is GCTGAGCAGGGACGACGTG (positions 834-853 of SEQ ID No. 7). The DNA fragments corresponding to the three target sites were cloned into plasmids containing Cas9-pCAMBIA1300 by BsaI digestion, yielding... OsFRK1、 OsFRK2、OsFRK3 Gene knockout vector OsU3-sgRNA-OsUBI-Cas9- OsFRK1、 OsU3-sgRNA-OsUBI-Cas9- OsFRK2、 OsU3-sgRNA-OsUBI-Cas9- OsFRK3 The three recombinant vectors can respectively transcribe the above-mentioned targets OsFRK1 Target OsFRK2 Target OsFRK3 The target sgRNA, the OsU3 promoter drives the transcription of sgRNA, and the OsUBI promoter drives the expression of Cas9 protein.

[0041] 2. Rice transformation and knockout OsFRK1、OsFRK2、OsFRK3 Identification of genetically modified plants Mature seeds of the japonica rice variety Nipponbare were sterilized and placed on an induction medium to obtain embryogenic callus. The OsU3-sgRNA-OsUBI-Cas9- obtained in step 1 was then... OsFRK1、 OsU3-sgRNA-OsUBI-Cas9- OsFRK2、 OsU3-sgRNA-OsUBI-Cas9- OsFRK3After being introduced into Agrobacterium EHA105, callus tissue can be infected and co-cultured using Agrobacterium-mediated rice genetic transformation. Next, selection is performed on a selective medium containing antibiotics to identify resistant callus tissue after transformation. The selected resistant callus tissue is then transferred to differentiation medium for seedling and rooting culture. Finally, the seedlings are removed from the medium, hardened off, and transplanted into soil pots for further growth until maturity.

[0042] Based on the identification primers, gene editing sites of each mutant at the target site were determined by gene amplification and sequencing, resulting in more than three independent gene editing sites. OsFRK Gene knockout rice lines ( Figure 1 ).

[0043] OsFRK1 Gene knockout lines: OsFRK1 -KO1, insert A between positions 879 and 880 of SEQ ID No. 1; OsFRK1 -KO2, missing bits 878-879 of SEQ ID No. 1; OsFRK1 -KO3, insert a T between positions 879 and 880 of SEQ ID No. 1; OsFRK2 Gene knockout lines: OsFRK2 -KO1, insert G between positions 793 and 794 of SEQ ID No. 4; OsFRK2 -KO2, insert T between positions 793 and 794 of SEQ ID No. 4; OsFRK2 -KO3, missing bits 793-798 of SEQ ID No. 4; OsFRK3 Gene knockout lines: OsFRK3 -KO1, missing bits 807-840 of SEQ ID No. 7; OsFRK3 -KO2, missing bits 825-840 of SEQ ID No. 7; OsFRK3 -KO3, missing bits 838-840 of SEQ ID No. 7.

[0044] 3. OsFRK1、OsFRK2、OsFRK3 Gene expression Using the Nipponbare (WT) japonica rice variety as experimental material, qRT-PCR was used to detect the presence of [unclear - possibly a specific substance or component] in different tissues. OsFRK1、 OsFRK2、 OsFRK3 The gene expression level was detected using the following steps: Detection OsFRK1、 OsFRK2、 OsFRK3 The primers used to determine the relative expression levels of genes in WT materials were, in order: OsFRK1:5'-GCATTGACTCAGTAGAGGATGA-3';5'-CTCAAGCTTTCTTCTGATCTTGC-3'; OsFRK2 :5'-TTGCTGCTTCGTTTTAGACAAG-3'; 5'-GGAAGCAACTAACTTAGCACAC-3'; OsFRK3 : 5'-TTTTAGTCCACACTCTCTCGC-3'; 5'-GTAGCCGAGAATATGGCCG-3'; The internal reference gene is rice Actin, and the primers for the internal reference gene are: 5'-ACCATTGGTGCTGAGCGTTT-3'; 5'-CGCAGCTTCCATTCCTATGAA-3'.

[0045] The results of gene tissue expression showed that OsFRK1 High expression in roots OsFRK2 It is highly expressed in roots, stems, and leaves, but less so in spikes. OsFRK3 The highest expression level was observed in the stem. Figure 2 (AC). Spatiotemporal expression results of the gene showed... OsFRK1 , OsFRK2 and OsFRK3 As rice grows, the expression level peaks during the tillering stage and gradually decreases in the later stages. Figure 2 (DF).

[0046] 4. Phenotypic analysis of gene knockout lines The gene knockout lines were used as test materials and planted in rice fields in Shunyi District, Beijing, for agronomic trait assessment. The japonica rice variety Nipponbare (WT) was used as a control. The test indicators included: plant height (the height of a mature rice plant is the distance from the base of the stem to the top (i.e., the highest panicle), biomass (aboveground biomass: all aboveground parts including leaves, leaf sheaths, stems and seeds were collected from the base of the stem, dried in an oven at 105°C for 30 minutes, and then continuously dried at 80°C for 2 days before weighing, with 10 biological replicates for each material), and yield per plant (i.e., grain weight per plant: rice grains from a single plant were collected, dried in an oven at 45°C, and then weighed).

[0047] result( Figure 3 The data shows that, compared to the wild type, OsFRK1 , OsFRK2 and OsFRK3 The plant height, yield per plant, and biomass of each knockout line were significantly reduced. This indicates that rice OsFRK1, OsFRK2 and OsFRK3It is crucial for the normal growth of rice; its absence leads to a significant decrease in plant height, biomass, and yield.

[0048] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Any of the following applications of proteins or substances that regulate the content or activity of said proteins: D1) Regulates plant biomass; D2) Prepare products that regulate plant biomass; D3) Cultivating plants with altered biomass; D4) Preparation of products for cultivating plants with altered biomass; The protein is either A1), A2), or A3). A1) The amino acid sequence of this protein is SEQ ID No. 9; A2) A protein that has the same function as the amino acid sequence shown in SEQ ID No. 9 in the sequence listing, but with one or more amino acid residues substituted and / or deleted and / or added; A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

2. The application according to claim 1, characterized in that: The substance that regulates the content or activity of the protein is any one of the following: B1) to B9): B1) The nucleic acid molecule that encodes the protein; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2); B8) Nucleic acid molecules that reduce the content or activity of the protein; B9) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues or transgenic plant organs containing the nucleic acid molecules described in B8).

3. The application according to claim 2, characterized in that: B1) The nucleic acid molecule described is as follows: (b11) or (b12) or (b13) or (b14) or (b15) b11) The coding sequence is the cDNA molecule or DNA molecule of SEQ ID No. 8 in the sequence listing; b12) The DNA molecule shown in SEQ ID No. 8 of the sequence listing; b13) The DNA molecule shown in SEQ ID No. 7 of the sequence listing; b14) has 75% or more identity with the nucleotide sequence defined by b11) or b12) or b13) and is a DNA molecule encoding the protein; b15) hybridizes under stringent conditions with a nucleotide sequence defined by b11) or b12) or b13) or b14) and the DNA molecule encoding the protein thereon.

4. The application according to any one of claims 1-3, characterized in that: The substance that regulates the protein content or activity is a substance that reduces the protein content or activity, and the substance that regulates plant biomass reduces the plant biomass. The change in biomass is a decrease in biomass.

5. The application according to any one of claims 1-4, characterized in that: The biomass is reflected in plant height, aboveground plant biomass, and / or grain yield.

6. The application according to any one of claims 1-5, characterized in that: The plant is M1, M2, or M3. M1) Monocotyledons or dicotyledons; M2) Gramineae plants; M3) rice.

7. Any of the following methods: X1) A method for cultivating plants with reduced biomass, comprising reducing the content or activity of the protein described in claim 1 in a recipient plant, or knocking out the gene encoding the protein described in claim 1 in a recipient plant, or reducing the expression level of the gene encoding the protein described in claim 1 in a recipient plant, to obtain a target plant with reduced biomass compared to the recipient plant. X2) A method for reducing plant biomass, comprising reducing the content or activity of the protein described in claim 1 in the recipient plant, or knocking out the coding gene of the protein described in claim 1 in the recipient plant, or reducing the expression level of the coding gene of the protein described in claim 1 in the recipient plant, to obtain a target plant with reduced biomass compared to the recipient plant, thereby achieving a reduction in plant biomass.

8. The method according to claim 7, characterized in that: The methods described in X1) and X2) are implemented by gene editing of the gene encoding the protein described in claim 1.

9. The method according to claim 7 or 8, characterized in that: The biomass is reflected in plant height, aboveground plant biomass and / or grain yield. And / or, the plant is M1, M2, or M3). M1) Monocotyledons or dicotyledons; M2) Gramineae plants; M3) rice.

10. The protein of claim 1 or any of the substances in claims 1-3 that regulate the content or activity of the protein.

Images