Peanut Arahy.K991DM gene promoter as well as preparation method and application thereof
By cloning the PAh-K991DM promoter from the peanut genome, constructing a recombinant vector, and efficiently driving gene editing in peanut callus tissue, the problem of promoter deficiency in peanut gene editing was solved, achieving efficient gene editing results and promoting the development of peanut breeding technology.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HENAN ACAD OF AGRI SCI
- Filing Date
- 2026-02-02
- Publication Date
- 2026-04-24
AI Technical Summary
The lack of endogenous, highly efficient promoters in peanut gene editing leads to low gene editing efficiency. Existing exogenous promoters, such as CaMV 35S, have insufficient expression stability in peanut callus tissue, which limits the improvement of gene editing technology.
The endogenous strong promoter PAh-K991DM was cloned from the peanut genome, amplified by PCR, and a recombinant vector was constructed to drive the efficient expression of key gene editing proteins in peanut callus tissue. The PAh-K991DM promoter was used to replace or as a new promoter to regulate the expression of downstream genes.
It significantly improved the efficiency of peanut gene editing, enhanced the editing efficiency of the CRISPR/Cas9 system, reduced the technical threshold and cost, provided an efficient gene editing tool for peanut breeding, and promoted the advancement of peanut molecular breeding technology.
Smart Images

Figure CN121915035A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of plant genetic engineering and biotechnology, specifically relating to a peanut Arahy.K991DM gene promoter, its preparation method, and its application. Background Technology
[0002] Peanuts (Arachis hypogeae L.) are an important global economic crop, playing a core role in edible oil supply and snack foods. The rapid development of plant genetic engineering technology and the application of CRISPR / Cas9 gene editing technology have significantly improved the efficiency and precision of target gene regulation, effectively shortening the breeding cycle.
[0003] In peanut genetic transformation practices, Agrobacterium-mediated transformation or gene gun transformation is commonly used. Gene editing vectors containing promoters and target genes are constructed and transformed into peanut embryogenic callus tissue. After obtaining positive resistant lines through resistance screening, subsequent molecular identification and trait verification are carried out.
[0004] As a core element in gene expression regulation, promoters directly determine the expression level of exogenous genes and play a crucial role in gene editing efficiency. Existing studies have confirmed that using highly efficient promoters to drive Cas9 protein expression can significantly improve gene editing efficiency. Furthermore, plant genetic transformation often uses callus tissue as the core recipient material, and endogenous strong callus promoters have been proven to effectively improve gene editing efficiency in various crops, possessing advantages such as strong species adaptability and high expression stability.
[0005] In peanut gene editing research, the virus-derived CaMV 35S promoter is commonly used to drive Cas9 protein expression. Currently, there are few reports on the use of strong endogenous peanut promoters for Cas9 protein expression, which has become a key bottleneck restricting further improvements in peanut gene editing efficiency. Therefore, identifying endogenous peanut gene promoters and clarifying their functions has significant research and application value. Summary of the Invention
[0006] To address the problems existing in the background art, the present invention provides a peanut Arahy.K991DM gene promoter, its preparation method, and its application.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0008] A peanut Arahy.K991DM gene promoter P Ah-K991DM Its nucleotide sequence is shown in SEQ ID NO.1.
[0009] Amplify the promoter P Ah-K991DM The primer pairs are:
[0010] PK991DM-F: 5′-CTCGTTAGTTTCCTCGTCTGAAAG-3′;
[0011] PK991DM-R: 5′-TTTCACAGTTGAATCACACAACG-3′;
[0012] And the primer pairs with homologous arms used for constructing GUS reporter gene expression vectors, specifically:
[0013] PK991DM-F1: 5′-ccaatacgcaaaccgcctgcaggCTCGTTAGTTTCCTTCGTCTGAAAG-3′;
[0014] PK991DM-R1:5′-ttaccctcagatctaccatggTTTCACAGTTGAATCACACAACG-3′
[0015] The primer pairs with homologous arms used for constructing base editing vectors are:
[0016] PK991DM-F2: 5′-aggtgggacaaaacgggcgcgccCTCGTTAGTTTCCTTCGTCTGAAAG-3′;
[0017] Pcal219-R2: 5′-ttccgcttcttctttggtaccatggtggcTTTCACAGTTGAATCACACAACG-3′.
[0018] The promoter P Ah-K991DM The preparation method includes the following steps:
[0019] (1) Extract genomic DNA from a peanut variety, namely Yuhua 9326;
[0020] (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the specific primer pair described above;
[0021] The amplification reaction system was 50 μL: 100 ng genomic DNA template, 1×PrimeSTAR GXL buffer, 200 μM dNTPs, one 0.3 μM forward and one reverse primer, and 1.25 U PrimeSTAR GXL DNA polymerase, with sterile deionized water added to bring the total volume to 50 μL.
[0022] Amplification reaction program: 94 ℃ pre-denaturation for 30 s, 98 ℃ denaturation for 10 s, 55 ℃ annealing for 15 s, 68 ℃ extension for 2 min, 30 cycles, 72 ℃ extension for 5 min, and 4 ℃ to terminate the reaction.
[0023] (3) The PCR amplification products were detected by agarose gel electrophoresis, and the target product was recovered and purified;
[0024] (4) The purified product was ligated into a cloning vector, transformed into host cells, and after culturing, single colonies were picked for sequencing verification to obtain the P. Ah-K991DM The promoter; the cloning vector is a T vector, and the host cell is Escherichia coli competent cells DH5α.
[0025] A type containing the promoter P Ah-K991DM The recombinant vector, using a plant expression vector or gene editing vector as the backbone vector, carries the P... Ah-K991DM The promoter is inserted into the backbone vector to replace the original promoter in the backbone vector or to act as a new promoter to regulate the expression of downstream genes; the backbone vector is at least one of 35S-pBWA(H)-gus vector, 35S-CBE base editing vector, and CRISPR / Cas9 vector.
[0026] The recombinant vector includes P Ah-K991DM -pBWA(H)-gus and P Ah-K991DM -At least one of CBE.
[0027] The promoter P Ah-K991DM Its application in driving gene expression includes driving the expression of key gene editing proteins, reporter genes, or functional genes in peanut callus cells.
[0028] The key gene editing proteins include Cas9 protein, Cas9 protein-deaminase fusion protein, Cas9 protein-reverse transcriptase fusion protein, or other gene editing-related functional proteins; the reporter gene is the GUS gene; the functional genes include at least one of stress resistance genes, disease resistance genes, and genes related to superior traits.
[0029] The promoter P Ah-K991DM Its application in flowering breeding, through the construction of structures containing the aforementioned P Ah-K991DM Gene editing vectors or plant expression vectors for promoters.
[0030] The application of the recombinant vector in peanut genetic transformation and promoter function verification.
[0031] The present invention has the following beneficial effects:
[0032] (1) The present invention can clone the peanut Arahy.K991DM gene promoter from peanut genomic DNA using conventional PCR amplification technology. This method is simple, does not require complex instruments or special experimental conditions, and the amplification products are highly specific, reproducible, and the results are stable and reliable. Compared with the existing technology, which requires complex methods such as genomic library screening to obtain promoters, the present invention significantly reduces the technical threshold and production cost of promoter cloning, laying a solid foundation for subsequent industrial applications.
[0033] (2) This invention is the first to clone the promoter of the Arahy.K991DM gene from peanut as an endogenous strong promoter, which effectively solves the technical problem of lacking an endogenous and efficient promoter in the field of peanut gene editing at present. The viral CaMV 35S promoter commonly used in existing peanut gene editing practices has inherent defects such as poor species adaptability and insufficient expression stability in peanut callus tissue. The endogenous promoter provided by this invention is naturally compatible with the peanut genome background, which fundamentally makes up for the above defects of exogenous promoters and provides core element support for the optimization and upgrading of peanut gene editing technology.
[0034] (3) The endogenous promoter of the peanut Arahy.K991DM gene obtained in this invention exhibits high expression activity in peanut callus tissue, and can specifically and efficiently drive the precise expression of key gene editing proteins such as CRISPR / Cas9 in peanut callus tissue. Experimental data confirm that, compared with the existing gene editing system using the CaMV 35S promoter, the CBE vector driven by the Arahy.K991DM gene promoter in this invention can achieve an editing efficiency of 25%, which is higher than the 14.3% of the 35S-CBE vector, thus improving gene editing efficiency and providing key technical support for precise gene editing in peanuts. This promoter can be widely used in gene editing breeding work to improve traits such as herbicide resistance, drought resistance, cold resistance, and disease resistance in peanuts, and has important practical value and broad industrialization prospects for promoting the progress of peanut molecular breeding technology and cultivating superior new peanut varieties.
[0035] (4) The recombinant vector containing a plant high-efficiency expression promoter obtained in this invention contains the promoter nucleotide sequence described above. The vector is of suitable size and has the characteristic of high-efficiency transformation in peanut cells, and can be quickly introduced into recipient materials such as peanut embryogenic callus; the marker gene GUS it carries has high expression intensity, which can be quickly detected by conventional histochemical staining methods. The detection signal is clear, and the expression activity of the promoter can be determined intuitively and accurately, which effectively simplifies the promoter function verification process and reduces detection cost and time cost; by transforming peanuts with this recombinant vector, transgenic lines with high-efficiency expression of the GUS gene in peanut callus can be stably obtained, providing an efficient and reliable tool for promoter function verification and subsequent optimization of gene editing vectors. Attached Figure Description
[0036] Figure 1 The graph shows the expression level analysis of the Arahy.K991DM gene in the cultivar Yuhua 9326.
[0037] Figure 2 For P Ah-K991DM -pBWA(H)-gus and P Ah-K991DM -Schematic diagram of the T-DNA region of the CBE vector;
[0038] Among them, T7 Ter: bacteriophage T7 RNA polymerase terminator; AtU6: Arabidopsis U6 promoter; 35S: CaMV 35S promoter of cauliflower mosaic virus; evoFERNY: cytidine deaminase; nCas9 (D10A): Cas9 nickase; UGI: uracil DNA glycosylation inhibitor; Hyg: hygromycin resistance gene; RB and LB: right and left T-DNA boundaries;
[0039] Figure 3 For P Ah-K991DM Histochemical staining results of transgenic peanut callus driven by the GUS gene;
[0040] Among them, (A) unconverted wild-type Yuhua 9326 callus; (B) callus transformed by 35S-pBWA(H)-gus vector; (C) callus transformed by P Ah-K991DM Callus transformed by the -pBWA(H)-gus vector;
[0041] Figure 4 To edit the Sanger sequence peak diagram representing the target location of the strain. Detailed Implementation
[0042] The present application will be further described in detail below with reference to the embodiments.
[0043] Example 1: Identification and expression analysis of the peanut Arahy.K991DM gene.
[0044] 1. Screening of the peanut Arahy.K991DM gene
[0045] Transcriptome sequencing (https: / / www.ncbi.nlm.nih.gov / sra / PRJNA1264070) identified a high expression level of Arahy.K991DM in peanut callus, with its gene annotation being tubulin α4A.
[0046] 2. Test materials and sampling treatment
[0047] The peanut material used in this invention was Yuhua 9326, sown in the field and managed using conventional methods. Samples were taken from the roots, stems, flowers, leaves, pegs, and peanut pods at the reproductive growth stages R3, R6, and R8 of field-grown Yuhua 9326 during its full flowering period (Growth stages of peanut. KJ Boote, Peanut Science, 1982). Callus tissue from Yuhua 9326 cultured indoors was used as an additional sampling material. All collected samples were flash-frozen in liquid nitrogen and then stored at -80°C for later use.
[0048] 3. Total RNA extraction and cDNA synthesis
[0049] Total RNA was extracted from the above-mentioned samples using the Takara MiniBEST Plant RNA Extraction Kit, following the kit's instructions. The total RNA concentration was 1 μg, and the A260 / A280 value was 1.8–2.0. Using the extracted total RNA as a template, first-strand cDNA was synthesized using the Takara PrimeScript™ 1st Strand cDNA Synthesis Kit, following the manufacturer's instructions. The synthesized cDNA product was used as a template for real-time quantitative PCR (RT-qPCR).
[0050] 4. RT-qPCR detection of Arahy.K991DM gene expression level
[0051] Using the cDNA obtained in the above experiments as an RT-qPCR template, the expression level of the Arahy.K991DM gene was detected using the Applied Biosystems™ QuantStudio™ 5 system.
[0052] Using the peanut constitutive expression gene AhADH3 as an internal reference gene, the amplification primers were as follows:
[0053] The primers for the internal reference gene AhADH3 are:
[0054] ADH3-F:GACGCTTGGCGAGATCAACA (SEQ ID NO. 2);
[0055] ADH3-R: AACCGGACAACCACCACATG (SEQ ID NO.3);
[0056] Arahy.K991DM gene primers are
[0057] q-K991DMf: AGTGAGGACTGGCACATACCGC (SEQ ID NO.4);
[0058] q-K991DMr: CACCCACAGCATTCATCACAAG (SEQ ID NO. 5).
[0059] The results are as follows Figure 1 As shown in the figure, the expression level of Arahy.K991DM in flowers, fruit pods, and developing seeds (R3 stage, early pod stage) is higher than that in other materials. It also shows a high expression level in other tested materials, indicating that the promoter of the gene Arahy.K991DM may be a strong promoter.
[0060] Example 2: Peanut Arahy.K991DM gene promoter P Ah-K991DM Preparation
[0061] Promoter P was prepared by PCR amplification using genomic DNA as a template. Ah-K991DM The specific steps are as follows:
[0062] 1. Genomic DNA extraction
[0063] Genomic DNA was extracted from the leaves of *Yuhua 9326* according to the instructions of the plant DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd., catalog number: DP350). The extracted genomic DNA was stored at -20 ℃ for later use.
[0064] 2. Promoter amplification primer design
[0065] Primers were designed based on the peanut reference genome Arachis hypogaea Tifrunner.gnm2.J5K5 Genomes to amplify the promoter sequence approximately 2000 bp upstream of the start codon of Arahy.K991DM.
[0066] The amplification primers are:
[0067] PK991DM-F: 5′-CTCGTTAGTTTCCTTCGTTCTGAAAG-3′ (SEQ ID NO.6),
[0068] PK991DM-R: 5′-TTTCACAGTTGAATCACACAACG-3′ (SEQ ID NO. 7).
[0069] 3. PCR amplification of promoter sequence
[0070] PCR amplification was performed using primers PK991DM-F and PK991DM-R, with genomic DNA as a template.
[0071] PCR amplification was performed using the high-fidelity enzyme PrimeSTAR. ® GXL DNA Polymerase (Takara, catalog number: R050Q).
[0072] The amplification reaction system (total system 50 μL) consisted of: 100 ng genomic DNA template, 1 × PrimeSTAR GXL buffer, 200 μM dNTPs, 0.3 μM each of forward and reverse primers, and 1.25 U PrimeSTAR GXL DNA polymerase, with ddH2O added to bring the total volume to 50 μL.
[0073] The reaction procedure was as follows: 94 °C pre-denaturation for 30 s, 98 °C denaturation for 10 s, 55 °C annealing for 15 s, 68 °C extension for 2 min, 30 cycles, 72 °C extension for 5 min; and finally, the reaction was terminated by holding at 4 °C.
[0074] 4. PCR product detection, recovery, and cloning
[0075] After the reaction, the amplification products were detected by 1.0% (w / v) agarose gel electrophoresis. The remaining target PCR product was recovered using a DNA purification kit (Nanjing Novizan Biotechnology Co., Ltd. DC301). The purified product was ligated into a T vector (Beijing Qingke Biotechnology Co., Ltd., catalog number: TSV-007), and transformed into *E. coli* competent cells DH5α (Sangon Biotech (Shanghai) Co., Ltd.) using the freeze-thaw method. The transformed bacterial culture was evenly spread on LB solid medium containing the corresponding antibiotic and incubated overnight at 37 ℃. The next day, a single colony was picked and inoculated into LB liquid medium, and incubated overnight at 37 ℃ with shaking at 200 rpm to obtain bacterial culture samples.
[0076] 5. Sequencing Validation and Promoter Acquisition
[0077] The bacterial culture samples obtained above were sent to Sangon Biotech (Shanghai) Co., Ltd. for Sanger sequencing verification.
[0078] The analysis results show that P was obtained. Ah-K991DM The nucleotide sequence is shown in SEQ ID NO.1.
[0079] Example 3 Peanut P Ah-K991DM Application in transgenic peanut callus
[0080] 1. Peanut gene promoter P Ah-K991DM Construction of plant expression vectors
[0081] 1.1 Construction of GUS reporter gene plant expression vector
[0082] Using Sbf I and Nco I endonucleases (Thermo Fisher Scientific) to target P Ah42CD1 The pBWA(H)-gus vector (Wuhan Boyuan Biotechnology Co., Ltd.) was double-digested to remove the P gene driving the GUS reporter gene. Ah42CD1 Promoter, and gel-recover linearized carrier.
[0083] In Example 2, P was designed Ah-K991DM Homologous arm sequences identical to those inserted into the vector were added to the 5' ends of the promoter forward and reverse amplification primers, respectively. The optimized primer sequences are as follows:
[0084] PK991DM-F1:
[0085] 5′-ccaatacgcaaaccgcctgcaggCTCGTTAGTTTCCTTCGTCTGAAAG-3′ (SEQ ID NO.8);
[0086] PK991DM-R1:
[0087] 5′-ttaccctcagatctaccatggTTTCACAGTTGAATCACACAACG-3′ (SEQ ID NO. 9).
[0088] Using genomic DNA from *Yuhua 9326* as a template, the promoter sequence was amplified. After product recovery, it was ligated into the linearized pBWA(H)-gus vector using a seamless cloning kit (Takara, Clontech, #638948) to construct P... Ah-K991DM The 35S-pBWA(H)-gus recombinant vector was used as the control, and the above plasmid resistance gene markers were all hygromycin resistance.
[0089] 1.2 Construction of base editing plant expression vectors
[0090] The 35S-CBE base editing vector (Weimi Biotechnology Co., Ltd., Nanjing) was double-digested using Asc I and Kpn I restriction enzymes (Thermo Fisher Scientific) to remove the CaMV 35S promoter driving the evoFERNY-nCas9 fusion protein, and the linearized vector was then recovered by gel digestion.
[0091] In P Ah-K991DM Homologous arm sequences matching the insertion sites of the aforementioned vector were added to the 5' ends of the promoter forward and reverse amplification primers, respectively.
[0092] PK991DM-F2:
[0093] 5′-aggtgggacaaaacgggcgcgccCTCGTTAGTTTCCTTCGTCTGAAAG-3′ (SEQ ID NO. 10);
[0094] Pcal219-R2:
[0095] 5′-ttccgcttcttctttggtaccatggtggcTTTCACAGTTGAATCACACAACG-3′ (SEQ ID NO. 11).
[0096] Using the genomic DNA of Yuhua 9326 as a template, P with homologous arms was amplified. Ah-K991DM Promoter sequence. After amplification product recovery, it was ligated into a linearized base editing vector using a seamless cloning kit (Takara, Clontech, #638948) to construct P. Ah-K991DM The -CBE recombinant vector and the control vector were both 35S-CBE vectors. The target site for both was the P197 site of the AhALS2 gene. The above plasmid resistance gene markers were all hygromycin resistance.
[0097] 1.3 Recombinant vector sequencing validation
[0098] The recombinant vectors were transformed into competent *E. coli* cells and plated on LB agar containing the corresponding antibiotics. The cells were incubated overnight at 37 °C. The following day, single colonies were picked and inoculated onto LB liquid agar, and cultured overnight at 37 °C with shaking at 200 rpm to obtain bacterial culture samples. The bacterial culture samples were sent to a biotechnology company for Sanger sequencing. Positive clones of the GUS reporter gene recombinant vector were detected using sequencing primer Ahgus-seq: 5`-TTCGTCGGTTCTGTAACTATCATC-3` (SEQ ID NO. 12). Positive clones of the base editing vector were detected using sequencing primer CBE-seq: 5`-GAGCAGTGGGTAGAAGGGTT-3` (SEQ ID NO. 13). The recombinant vector T-DNA was as follows: Figure 2 As shown.
[0099] The GUS reporter gene recombinant vector constructed in this invention is of suitable size, exhibits high plant cell transformation efficiency, and carries a high expression intensity of the GUS marker gene, which can be rapidly detected using a simple histochemical staining method. Transforming peanuts using this vector can yield transgenic lines with high GUS gene expression in peanut callus, suitable for P... Ah-K991DM Verification of promoter expression activity; P Ah-K991DM -CBE expression vector can test P Ah-K991DMThe editing efficiency of the base editing protein driven by the gene editing mechanism in peanuts provides an efficient vector tool for subsequent peanut gene editing breeding.
[0100] 2. Genetic transformation of peanuts
[0101] 2.1 Collection and pretreatment of explants: Take mature peanut pods, remove the shells, select plump, clean seeds without sterile spots, soak them in 75% alcohol for 1 min, remove the alcohol, soak them in 0.1% mercuric chloride for 8 min, remove the mercuric chloride, and finally rinse them 5-7 times with sterile water and soak them overnight for use.
[0102] 2.2 Induction, screening and subculture of embryogenic callus: Cotyledons, embryonic leaflets and hypocotyls of peanut seeds were removed in a clean bench. The epicotyls were placed on MS induction medium (formula shown in Table 1) and cultured at 28 ℃. Subculture was performed every 3-4 weeks. Embryogenic callus tissue appeared after 3-4 subcultures. Embryogenic callus tissue cultured for 4-12 months was selected for subsequent experiments.
[0103] Table 1. Stock solution formulation for MS induction medium
[0104]
[0105] 2.3 Preparation for Gene Gun Bombardment Method: Prepare the bullets according to the instructions for the Xinzhi Gene Gun (GJ-1000). The specific steps are as follows:
[0106] Weigh 60 mg of gold powder into a 2 mL centrifuge tube, add 1 mL of anhydrous ethanol, sonicate until the temperature feels slightly hot to the touch, centrifuge and discard the supernatant.
[0107] Add 1 mL of anhydrous ethanol to a centrifuge tube, vortex for 3-5 min, let stand for 1 min, and discard the supernatant; add 1 mL of sterile distilled water to a centrifuge tube, vortex, centrifuge, discard the supernatant, add 50% sterile glycerol to prepare a 60 mg / mL gold powder suspension for later use.
[0108] Using the Tiangen endotoxin-free plasmid small-scale extraction kit (catalog number: DP118), the recombinant vector P was extracted according to the product instructions. Ah-K991DM -pBWA(H)-gus、35S-pBWA(H)-gus、P Ah-K991DM -CBE and control vector 35S-CBE recombinant vector plasmids.
[0109] Take 50 μL of the above gold powder suspension, add 10 μL of recombinant vector plasmid with a concentration of 1 μg / μL, shake for 30 s, add 50 μL of calcium chloride with a concentration of 2.5 M, shake for 30 s, add 20 μL of spermidine with a concentration of 0.1 M, shake for 30 s, centrifuge, remove the supernatant, add 150 μL of 70% ethanol, blow the precipitate until it is evenly dispersed, centrifuge and discard the supernatant, add 150 μL of anhydrous ethanol, let stand for 1 min, discard the supernatant and add 60 μL of anhydrous ethanol, blow the precipitate apart for later use.
[0110] 2.4 Genetic transformation of peanut: Induced peanut embryogenic callus was placed on MS medium and bombarded with a GJ-1000 gene gun. After bombardment, the callus was cultured at 28 °C for 3 days, and then transferred to MS medium containing 20 mg / L hygromycin for screening. After culturing for 1 month, newly formed callus was selected and transferred to MS medium containing 20 mg / L hygromycin for subculture twice. The embryogenic callus obtained from the proliferation was used for subsequent studies.
[0111] 3. Gene promoter P Ah-K991DM Functional analysis
[0112] (1) The P was verified by using the GUS histochemical staining method. Ah-K991DM The specific steps for determining the expression activity of the promoter in peanut callus are as follows:
[0113] In P Ah-K991DM From peanut embryogenic callus transformed with 35S-pBWA(H)-gus and control 35S-pBWA(H)-gus vectors, a portion of callus from hygromycin-resistant callus lines was selected and placed in 2 mL centrifuge tubes. GUS staining solution (Beijing Cooler Master Technology Co., Ltd.) was added to the centrifuge tubes, ensuring the sample was completely submerged. The centrifuge tubes were then placed in an oven and incubated overnight at 37 °C. After incubation, the samples were washed three times with anhydrous ethanol, and the staining was observed and photographed under a microscope.
[0114] The results are as follows Figure 3 As shown: P Ah-K991DM Promoter-driven GUS genes can be stably expressed in peanut callus. Figure 3 C), and the expression intensity is close to that of the control CaMV 35S promoter ( Figure 3 B); however, no blue signal representing GUS activity was found in untransformed peanut callus (B). Figure 3 A), indicating that P Ah-K991DM The promoter has the function of driving the expression of downstream genes in peanut callus.
[0115] (2) To verify P Ah-K991DMThe editing efficiency of promoter-driven base-editing proteins, for those via P Ah-K991DM The target site editing efficiency of peanut hygromycin-resistant callus lines transformed with 35S-CBE and control 35S-CBE vectors was detected. The specific steps are as follows: From P Ah-K991DM From callus transformed with -CBE and 35S-CBE, 28 hygromycin-resistant lines were randomly selected from each. Genomic DNA was extracted from the callus lines using conventional plant genomic DNA extraction methods. Using the extracted genomic DNA as a template, target site-specific primers were used:
[0116] HT-197F: 5`-GGAGTGAGTACGGTGTGCGTCTGCATCGCCACCTCC-3` (SEQ ID NO. 14);
[0117] HT-197R: 5`-GAGTTGGATGCTGGATGGAAAAGCCTCATTCACAATCCTA-3` (SEQ ID NO. 15).
[0118] The AhALS2 gene P197 target sequence was amplified, and the amplified products were sent to the Hi-TOM high-throughput sequencing platform of the China National Rice Research Institute for sequencing analysis. The filtering threshold was 0.1%, and 2000 reads were sequenced for each reaction. Data with ≥1% of reads were selected for statistical analysis. Among them, a mutant read ratio of ≥90% of the total reads for that site was defined as a homozygous mutation, a ratio of <90% but ≥20% was defined as a heterozygous mutation, and a ratio of <20% was defined as a chimeric mutation.
[0119] Sequencing results showed that P Ah-K991DM - The CBE vector can drive precise editing of proteins at the target site with an editing efficiency of 25%, which is higher than the 14.3% of the control 35S-CBE vector (see Table 2 and ). Figure 4 ).
[0120] Table 2. Base Editing Efficiency Statistics
[0121]
[0122] Note: Editing efficiency = (editing coefficient / identification coefficient) × 100%; Indel: insertion or deletion; Indel rate = (indel mutant coefficient / identification coefficient) × 100%.
[0123] As can be seen from the data in Table 2, P Ah-K991DM The CBE vector editing efficiency driven by the promoter (25%) was higher than that of the commonly used CaMV35S promoter (14.3%), indicating that peanut endogenous P Ah-K991DMPromoters have certain advantages in improving the efficiency of peanut gene editing and have important potential application value in peanut gene editing.
[0124] Based on the P obtained by this invention Ah-K991DM Promoters can be constructed by including P Ah-K991DM Gene editing vectors such as Cas9 protein-driven Cas9 protein-deaminase fusion protein or Cas9 protein-reverse transcriptase fusion protein can be used to achieve various mutation types in peanuts, including precise knockout mutations and base substitutions driven by endogenous promoters. This technology system can be widely used to create new superior peanut germplasm with herbicide resistance, drought resistance, cold resistance, and disease resistance, providing an efficient molecular breeding tool for peanut breeding and has broad application prospects.
[0125] This invention successfully cloned the peanut endogenous strong promoter P from peanut. Ah-K991DM This effectively solves the technical bottleneck of the current lack of endogenous, highly efficient promoters in peanut gene editing applications. This promoter not only possesses the function of efficiently driving downstream gene expression in peanut callus tissue, but also the gene editing efficiency of the promoter-driven gene editing system is superior to that of the commonly used CaMV 35S exogenous promoter. Therefore, P Ah-K991DM Promoters have important application value in peanut genetic engineering breeding, providing key core components to support the construction of an efficient and precise peanut gene editing system and the creation of new peanut breeding materials with excellent stress resistance and high quality.
[0126] SEQ ID NO.1 (P Ah-K991DM (nucleotide sequence)
[0127]
Claims
1. A peanut Arahy.K991DM gene promoter P Ah-K991DM Its characteristics are, Its nucleotide sequence is shown in SEQ ID NO.
1.
2. An amplification method for the promoter P described in claim 1 Ah-K991DM The primer pair is characterized in that, The primer pair is as follows: PK991DM-F: 5′-CTCGTTAGTTTCCTCGTCTGAAAG-3′; PK991DM-R: 5′-TTTCACAGTTGAATCACACAACG-3′; And the primer pairs with homologous arms used for constructing GUS reporter gene expression vectors, specifically: PK991DM-F1: 5′-ccaatacgcaaaccgcctgcaggCTCGTTAGTTTCCTTCGTCTGAAAG-3′; PK991DM-R1:5′-ttaccctcagatctaccatggTTTCACAGTTGAATCACACAACG-3′ The primer pairs with homologous arms used for constructing base editing vectors are: PK991DM-F2: 5′-aggtgggacaaaacgggcgcgccCTCGTTAGTTTCCTTCGTCTGAAAG-3′; Pcal219-R2: 5′-ttccgcttcttctttggtaccatggtggcTTTCACAGTTGAATCACACAACG-3′.
3. A promoter P as described in claim 1 Ah-K991DM The preparation method of the [method] is characterized by, Includes the following steps: (1) Extract genomic DNA from peanut variety Yuhua 9326; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair described in claim 2; The amplification reaction system was 50 μL: 100 ng genomic DNA template, 1×PrimeSTAR GXL buffer, 200 μM dNTPs, one 0.3 μM forward and one reverse primer, and 1.25 U PrimeSTAR GXL DNA polymerase, with sterile deionized water added to bring the total volume to 50 μL. Amplification reaction program: 94 ℃ pre-denaturation for 30 s, 98 ℃ denaturation for 10 s, 55 ℃ annealing for 15 s, 68 ℃ extension for 2 min, 30 cycles, 72 ℃ extension for 5 min, and 4 ℃ to terminate the reaction. (3) The PCR amplification products were detected by agarose gel electrophoresis, and the target product was recovered and purified; (4) The purified product was ligated into a cloning vector, transformed into host cells, and after culturing, single colonies were picked for sequencing verification to obtain the P. Ah-K991DM The promoter; the cloning vector is a T vector, and the host cell is Escherichia coli competent cells DH5α.
4. A device containing the promoter P of claim 1 Ah-K991DM The recombinant vector, characterized in that, The recombinant vector uses a plant expression vector or gene editing vector as its backbone vector, and the P... Ah-K991DM The promoter is inserted into the backbone vector to replace the original promoter in the backbone vector or to act as a new promoter to regulate the expression of downstream genes; the backbone vector is at least one of 35S-pBWA(H)-gus vector, 35S-CBE base editing vector, and CRISPR / Cas9 vector.
5. The recombinant vector according to claim 4, characterized in that, The recombinant vector includes P Ah-K991DM -pBWA(H)-gus and P Ah-K991DM -At least one of CBE.
6. The promoter P as described in claim 1 or 2 Ah-K991DM Its application in driving gene expression is characterized by, The applications include driving the expression of key gene editing proteins, reporter genes, or functional genes in peanut callus cells.
7. The application according to claim 6, characterized in that, The key gene editing proteins include Cas9 protein, Cas9 protein-deaminase fusion protein, Cas9 protein-reverse transcriptase fusion protein, or other gene editing-related functional proteins; the reporter gene is the GUS gene; the functional genes include at least one of stress resistance genes, disease resistance genes, and genes related to superior traits.
8. The promoter P as described in claim 1 or 2 Ah-K991DM Its application in flowering breeding is characterized by, The application is to construct a system containing P. Ah-K991DM Gene editing vectors or plant expression vectors for promoters.
9. The application of the recombinant vector according to claim 4 or 5 in peanut genetic transformation and promoter function verification.