Method for increasing plant alkaloid-heat stress tolerance

By adjusting the active gibberellin in rice to a moderate level, the problem of rice's tolerance to alkali and heat stress was solved, and high-yield growth of rice was achieved under saline-alkali and high-temperature environments.

CN121915077APending Publication Date: 2026-04-24CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
Filing Date
2024-10-24
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Current technologies have not fully explored the mechanism of action of gibberellin in rice's response to alkali and heat stress, making it difficult to breed new rice varieties that are both salt-tolerant and maintain high yield.

Method used

By regulating the level of active gibberellins in rice to a moderate level through gene editing or exogenous application, specifically by regulating the expression of gibberellin 20 oxidase or applying gibberellin synthesis inhibitors, the activity levels of gibberellin GA1 and GA4 can be maintained, thereby enhancing the rice's tolerance to alkali and heat stress.

Benefits of technology

It significantly improves the tolerance of rice to alkaline and heat stress, reduces yield loss, increases crop yield, and reduces the impact of environmental stress on plant growth.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005099579140000011
    Figure HDA0005099579140000011
  • Figure HDA0005099579140000012
    Figure HDA0005099579140000012
  • Figure HDA0005099579140000021
    Figure HDA0005099579140000021
Patent Text Reader

Abstract

The invention belongs to the technical field of agricultural biology, and relates to a method for increasing plant alkali stress tolerance and / or heat stress tolerance, which comprises the following steps: regulating the active gibberellin level in a plant body by maintaining the active gibberellin level in the plant at a medium level, the method is beneficial to plant restoration, alkali-resistant and heat-resistant plant germplasm resource creation and alkali-resistant and heat-resistant plant variety cultivation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology, and specifically relates to a method for increasing the tolerance of plants to alkali-heat stress, and more specifically to the application of active gibberellin in increasing the tolerance of plants, such as rice, to alkali stress and / or heat stress. Background Technology

[0002] In the natural environment, plants must adapt to constantly changing environmental conditions to ensure their survival and reproduction. Gibberellins (GAs) are an important class of plant hormones that play a crucial role in plant growth and development, especially in responding to various environmental stresses such as cold, salinity, and drought. Gibberellins promote the growth and development of plant organs by regulating cell division and elongation. They play a vital role throughout the entire plant life cycle, including seed germination, stem elongation, leaf unfolding, and flower and fruit development. When facing adverse environmental conditions, the regulation of gibberellin biosynthesis and signal transduction helps plants enhance their resilience and survival ability. Rice, as one of the world's major food crops, is crucial for meeting the needs of a growing population by increasing its yield. Gibberellins not only participate in regulating yield-related traits in rice such as plant height, panicle length, and spikelet number, but also affect rice's response to abiotic stresses. During the Green Revolution, improvements to gibberellin signaling pathway genes significantly increased crop yields, ensuring global food security.

[0003] The widespread cultivation of Green Revolution Varieties (GRVs) benefits from their semi-dwarf plant structure, which provides lodging resistance and reduces yield loss under high nitrogen fertilizer supply. The semi-Dwarf1 (SD1) gene in rice encodes gibberellin 20 oxidase (GA 20 oxidase 2), a key enzyme in gibberellin biosynthesis. Green Revolution varieties typically possess a partially lost-function sd1 allele, leading to a reduced concentration of bioactive gibberellin. This inhibits the proteasome degradation of SLR1 (DELLA protein in rice) by the gibberellin receptor GID1, thus affecting plant growth and development, resulting in reduced plant height and semi-dwarf characteristics. With the increasing severity of global climate change and soil salinization, the development of new rice varieties that possess both salt and heat resistance while maintaining high yield has become particularly urgent. The mechanisms by which gibberellins regulate plant responses to alkaline and heat stress are not fully understood, providing ample room for future research. Gibberellins play a crucial role in plant adaptation to environmental stress and improving crop yield. Future research needs to further explore the specific mechanisms of action of gibberellin in rice stress response in order to breed rice varieties that are better adapted to future environmental challenges. Summary of the Invention

[0004] Our research shows that maintaining moderate levels of endogenous gibberellin in rice through gene manipulation in Green Revolution varieties, or maintaining moderate levels of gibberellin activity in rice through exogenous application of gibberellin synthesis inhibitors or active gibberellins, can enhance rice's tolerance to alkaline or heat stress. Based on this principle, we can maintain moderate levels of active gibberellin in rice (and other plants) through gene editing, or develop drugs containing inhibitors of active gibberellin synthesis or active gibberellins, and apply them to rice (and other plants) to maintain moderate levels of active gibberellin, thereby enhancing rice's tolerance to alkaline or heat stress. Based on this research, the present invention includes the following technical solutions.

[0005] A first aspect of the present invention provides a method for increasing the tolerance of plants, such as rice, to alkali stress and / or heat stress, comprising the steps of: regulating the level of active gibberellin in the plant, such as rice, by maintaining the level of active gibberellin in the plant, such as rice, at a moderate level, wherein...

[0006] The term "medium level" refers to the level / content of active gibberellins in Green Revolution Varieties (GRVs) plants under normal growing conditions, i.e., without environmental stress.

[0007] Preferably, the above-mentioned active gibberellins refer to gibberellins GA1 and GA4.

[0008] In one embodiment, the methods for regulating the level of active gibberellin in plants such as rice are selected from the group consisting of:

[0009] 1) Endogenous regulation, adjusting the expression level or activity of gibberellin 20 oxidase (GA 20 oxidase) in plants to maintain the active gibberellin in the plant at the aforementioned moderate level; and / or

[0010] 2) Exogenous regulation: When the level / content of active gibberellin in the plant is lower than the intermediate level, active gibberellin, or active gibberellin synthesis inhibitor, or active gibberellin synthesis promoter is applied to the plant itself or its planting soil / culture solution to maintain the active gibberellin in the plant at the intermediate level.

[0011] It should be understood that the term "basic" in this article, when describing numerical characteristics, means that the represented number may have an error range or fluctuation range of ±15%, ±12%, ±10%, ±9%, ±8%, ±7%, ±6%, or ±5%.

[0012] In one implementation, the above-mentioned endogenous regulation method 1) is selected from the following methods:

[0013] 1-1) When the content of active gibberellin in the plant is significantly lower than the intermediate level (e.g., more than 10%, preferably more than 15% or more or more than 20% lower than the intermediate level), the plant is overexpressed with the gene encoding gibberellin 20 oxidase, such as the Semi-Dwarf1 (SD1) gene in rice (which is an allele of the ATT1 gene).

[0014] 1-2) When the content of active gibberellin in the plant is significantly higher than the aforementioned moderate level (e.g., more than 20%, preferably more than 15%, or more than 10% higher than the aforementioned moderate level), the expression of the gibberellin 20 oxidase encoding gene in the plant, such as the Semi-Dwarf1 (SD1) gene in rice (which is an allele of the ATT1 gene), is inhibited, or

[0015] By using gene editing technology, the gene encoding gibberellin 20 oxidase in plants, such as the Semi-Dwarf1 (SD1) gene in rice, was replaced with an allele that partially lacks gibberellin synthesis function, such as the sd1 allele, resulting in a decrease in the activity of expressed GA 20 oxidase.

[0016] It should be understood that the term "significantly (below / above)" in this article, when describing numerical characteristics, means that there is a difference of more than 10%, 12%, 15%, 18%, or 20% relative to the stated number / standard, i.e., exceeding the range (below / above).

[0017] Furthermore, the above method 1-1) can be selected from the following methods:

[0018] (1-1-1) The gene encoding gibberellin 20 oxidase, such as the rice SD1 gene, is cloned into a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, namely a gibberellin 20 oxidase gene overexpression vector. Plants are then transformed by Agrobacterium-mediated transformation to obtain transgenic plants that overexpress gibberellin 20 oxidase.

[0019] (1-1-2) By using gene editing technology, the gene encoding gibberellin 20 oxidase, such as the rice SD1 gene, is cloned into a plant chromosome to obtain transgenic plants that overexpress gibberellin 20 oxidase; and / or

[0020] (1-1-2) By placing the gene encoding gibberellin 20 oxidase in plants, such as the rice SD1 gene, under the regulation of an enhanced promoter,

[0021] Methods 1-2 above are selected from the following methods:

[0022] (1-2-1) Knock out the gene encoding gibberellin 20 oxidase in plant chromosomes, such as the rice SD1 gene;

[0023] (1-2-2) Down-regulate the expression level of gibberellin 20 oxidase-encoding genes in the chromosomes of wild-type plants, such as the SD1 gene in rice;

[0024] (1-2-3) Replace the gibberellin 20 oxidase coding gene, such as the rice SD1 gene, in plant chromosomes with a mutant of the gene encoding gibberellin 20 oxidase that has lost or downregulated function; and / or

[0025] (1-2-4) Block, inhibit or interfere with the expression of gibberellin 20 oxidase encoding genes in plant chromosomes, such as the rice SD1 gene.

[0026] Furthermore, the above method (1-2-2) can be selected from the following group:

[0027] (1-2-2-1) Mutations in the promoter region and / or coding region of gibberellin 20 oxidase-encoding genes, such as the rice SD1 gene, lead to downregulation of the expression level of gibberellin 20 oxidase-encoding genes, such as the rice SD1 gene.

[0028] (1-2-2-2) Mutations in upstream regulators of gibberellin 20 oxidase-encoding genes, such as the rice SD1 gene, lead to downregulation of the expression level of gibberellin 20 oxidase-encoding genes, such as the rice SD1 gene; or

[0029] (1-2-2-3) Introduce gibberellin 20 oxidase interacting proteins into plants to alter the function of gibberellin 20 oxidase encoding genes, such as the rice SD1 gene.

[0030] Preferably, the above method 1-1) or 1-2) is implemented using gene editing technology, which may be selected from the following group: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT.

[0031] The above-mentioned plants are crops selected from the group consisting of: rice, wheat, corn, soybean, barley, oats, rye, sorghum, cotton, vegetables, tobacco, and cruciferous plants, with rice being the preferred plant.

[0032] A second aspect of the invention provides the use of active gibberellins as biomarkers in identifying plant tolerance to alkaloid stress and / or heat stress.

[0033] The use of active gibberellins as biomarkers in the creation of plant germplasm resistant to alkali stress and / or heat stress, and in the breeding of plant varieties resistant to alkali stress and / or heat stress;

[0034] The use of genes ATT1 (MSU ID LOC_Os01g66100) and ATT2 (MSU ID LOC_Os03g63970) as biomarkers in identifying plant tolerance to alkaline stress and / or heat stress, such as in rice; and

[0035] The use of genes ATT1 and ATT2 as biomarkers in creating plant germplasm resistant to alkali stress and / or heat stress, and in breeding plant varieties resistant to alkali stress and / or heat stress.

[0036] The MSU number of gene ATT1 is LOC_Os01g66100, which encodes GA20 oxidase 2 (GA20OX2); the MSU number of gene ATT2 is LOC_Os03g63970, which encodes GA20 oxidase 1 (GA20OX1).

[0037] Those skilled in the art will readily understand that when active gibberellins, such as gibberellins GA1 and GA4, serve as biomarkers of alkali stress resistance and / or heat stress resistance in plants, they can also be used to develop agricultural products or plant growth regulators (including but not limited to agricultural products such as fertilizers) that maintain the level of active gibberellins in plants to enhance rice's resistance to low alkali stress or heat stress.

[0038] A third aspect of the present invention provides a method for identifying plant varieties that are tolerant to alkali stress and / or tolerant to heat stress, comprising the following steps:

[0039] The content of active gibberellin in plant tissues, such as rice, is determined. When plants are under alkaline stress and / or heat stress, if the content of active gibberellin in plant tissues, such as rice, is significantly higher than the intermediate level (e.g., more than 20%, preferably more than 15%, or more than 10% higher than the intermediate level) or significantly lower than the intermediate level (e.g., more than 10%, preferably more than 15%, or more than 20% lower than the intermediate level), it indicates that the plant variety is at risk of being intolerant to alkaline stress and / or heat stress.

[0040] Conversely, when plants are in alkaline and / or heat stress growing environments, if the content of active gibberellin in plant tissues, such as rice, is maintained at the aforementioned moderate level (e.g., not more than 20%, preferably more than 15% or more than 10%) or not less than the aforementioned moderate level (e.g., not less than 10%, preferably more than 15% or more than 20%), it suggests that the plant, such as rice, has a tendency to be tolerant to alkaline and / or heat stress, and the plant variety is considered a candidate for tolerant to alkaline and / or heat stress varieties.

[0041] Another aspect of the present invention provides a method for identifying plant varieties that are tolerant to alkali stress and / or tolerant to heat stress, comprising the following steps:

[0042] The expression levels of genes ATT1 and / or ATT2 in plants such as rice were measured.

[0043] When plants are in alkaline stress and / or heat stress growing environments, if the expression levels of genes ATT1 and / or ATT2 are significantly higher than the intermediate level (e.g., more than 20%, preferably more than 15%, or more than 10% higher than the intermediate level) or significantly lower than the intermediate level (e.g., more than 10%, preferably more than 15%, or more than 20% lower than the intermediate level), it suggests that the plant variety is at risk of being intolerant to alkaline stress and / or intolerant to heat stress.

[0044] Conversely, when plants are under alkaline and / or heat stress, if the expression levels of genes ATT1 and / or ATT2 are maintained at the moderate level (e.g., not more than 20%, preferably more than 15% or more than 10%) or not lower than the moderate level (e.g., not less than 10%, preferably more than 15% or more than 20%), it suggests that the plant, such as rice, has a tendency to be alkali-tolerant and / or heat-tolerant, and the plant variety is considered a candidate for alkali-tolerant and / or heat-tolerant varieties.

[0045] A fourth aspect of the present invention provides a kit for performing the identification method described above, comprising the following PCR primers for amplifying genes ATT1 and ATT2:

[0046] Forward primer RT-PCR-ATT1-F: CCTCCTTCGGCTTCCAC (SEQ ID NO:1),

[0047] Reverse primer RT-PCR-ATT1-R: GCGACAGCTCCTTCATCTC (SEQ ID NO:2);

[0048] Forward primer RT-PCR-ATT2-F: GGCTTCTTCCTGGTGGTTAA (SEQ ID NO:3),

[0049] Reverse primer RT-PCR-ATT2-R: CTTCATCTCCAGCCGATGAGTA (SEQ ID NO:4).

[0050] Furthermore, the kit also includes the following PCR primers for amplifying the ACTIN gene in rice as an internal reference gene:

[0051] Forward primer RT-ACTIN-F: TGCTATGTACGTCGCCATCCAG,

[0052] Reverse primer RT-ACTIN-R: AATGAGTAACCACGCTCCGTCA.

[0053] Furthermore, the kit also includes an instruction manual that describes the steps and identification criteria for performing gene ATT1 and ATT2 detection.

[0054] For example, the instructions can be written on bottles, test tubes and similar objects, boards, or on a separate piece of paper, or on the outside or inside of a container, such as a paper document with an operation demonstration video app download window or a QR code. The instructions can also be in multimedia form, such as a CD, USB flash drive, or cloud storage.

[0055] This invention is the first to discover an intrinsic relationship between the content of active gibberellins, such as gibberellins GA1 and GA4, and the expression levels of genes ATT1 and ATT2, and the tolerance of plants to alkali stress and / or heat stress. It was found that maintaining moderate levels of active gibberellins in Green Revolution varieties can increase the tolerance of rice to alkali-heat stress. This function of alkali and heat stress resistance makes active gibberellins a potential marker for improving the tolerance of plants, such as rice, to alkali and / or heat stress, for creating germplasm of plants tolerant to alkali and / or heat stress, and for breeding plant varieties tolerant to alkali and / or heat stress. Attached Figure Description

[0056] Figure 1 This study presents the identification of alkali-heat tolerance phenotypes and survival statistics of near-isogenic lines of the ATT1 and ATT2 genes in rice. Among them, AF represents the near-isogenic line NIL-ATT1. LTP and NIL-ATT1 BART NIL-ATT2 LTP and NIL-ATT2 BART Phenotypic (A, D) and survival rate statistics (B and C, E and F) under alkali and heat stress. Alkali treatment: 65 mM sodium bicarbonate treatment for 14 days; heat treatment: 42℃, RH>90% treatment for 28 hours; scale bar: 10 cm. Data are presented as mean ± standard deviation. n = 3 replicates, each consisting of 24 seedlings. Two-tailed t-tests were used to test for significance, **P<0.01, ***P<0.001.

[0057] Figure 2The expression of genes ATT1 and ATT2 in the roots, stems, leaves, and panicles of rice Lontop is shown. Statistical bar charts represent the expression analysis of genes ATT1 and ATT2 in the roots, stems, leaves, and panicles of mature rice. Data are presented as mean ± standard deviation, with n = 3 replicates, each consisting of 24 rice seedlings. The same letter indicates no significant difference. Significant differences were determined using Statix ​​8.0 analysis and post-hoc paired multiple comparison tests (LSD < 0.05).

[0058] Figure 3 Photographs show the expression sites of genes ATT1 and ATT2 under alkaline and heat stress in rice. Specifically, the expression patterns of ProATT1:GUS (β-glucuronidase) and ProATT2:GUS in roots, stems, leaves, and panicles are shown under normal conditions and under alkaline treatment (150 mM sodium bicarbonate, 1 or 3 days) and heat treatment (45℃, relative humidity >90%, 1 or 3 days) during the rice booting stage. Scale bar: 1 cm.

[0059] Figure 4 The changes in the expression levels of genes ATT1 and ATT2 before and after alkali-heat treatment in their near-isogenic lines are shown. The statistical bar chart AD represents the relative expression levels of ATT1 (A and B) and ATT2 (C and D) in near-isogenic lines before and after alkali treatment (A and C) (65 Mm sodium bicarbonate, 1 day) and heat treatment (B and D) (42℃, RH>90%, 6 h). The AD values ​​represent mean ± standard deviation. n = 3 biological replicates; 24 plants per replicate. *P<0.05, **P<0.01, ***P<0.001 indicate a significant difference in a two-tailed t-test.

[0060] Figure 5 The expression of gibberellin metabolism genes under alkaline and heat stress in rice is shown. Figures A and B are bar charts showing the relative expression levels of GA2ox and EUI1 genes in LTP rice. Regardless of alkaline treatment (65 mM sodium bicarbonate, 24 hours) or heat treatment (42℃, relative humidity >90%, 3 hours), the expression of most of these gibberellin metabolism genes was upregulated. Values ​​in Figures A and B represent mean ± standard deviation (n = 3). The same letters indicate no significant difference at p > 0.05, determined by two-way ANOVA and LSD test. *p < 0.05, **p < 0.01, **p < 0.001 indicate significant differences in a two-tailed Student's t-test. ns, no significant difference.

[0061] Figure 6 This study demonstrates how genes ATT1 and ATT2 control the synthesis of active gibberellin. Specifically, under normal conditions, alkaline treatment, and heat treatment, NIL-ATT1 / 2... LTP(NIL-ATT1 LTP / ATT2 LTP NIL-ATT1 BART and NIL-ATT2 BART Statistical analysis of endogenous gibberellin GA1(A) and GA4(B) levels in stems, leaves, and spikes during the heading stage of plants. Alkaline treatment (150 mM sodium bicarbonate) for 7 or 14 days; heat treatment (45℃ and >90% relative humidity) for 2 or 4 days; data are presented as mean ± standard deviation, n = 3. *p<0.05, **p<0.01, ***p<0.001 indicate significant differences in a two-tailed Student's t-test. No significant difference was found in ns.

[0062] Figure 7 Models illustrating the changes in active gibberellin concentrations in rice stems, leaves, and panicles under alkaline and heat stress were presented. The proposed models showed that bioactive GAs (gibberellins) accumulated highest in the panicle, followed by the stem and leaves, while accumulation in the stem, leaves, and panicles was gradually inhibited under alkaline and heat stress conditions.

[0063] Figure 8 Rice NIL-ATT1 / 2 was shown LTP (NIL-ATT1 LTP / ATT2 LTP ), NIL-ATT1 BART and NIL-ATT2 BART Phenotypic and statistical bar graphs of alkali-heat tolerance in near-isogenic lines after treatment with 1 μM GA3 or PAC (paclobutrazol). Among them, AF: NIL-ATT1 / 2 after treatment with 1 μM GA3 or PAC (paclobutrazol) LTP (NIL-ATT1 LTP / ATT2 LTP NIL-ATT1 BART and NIL-ATT2 BART Phenotypic (A, B) and survival statistics (CF) of plants under alkali and heat stress. Alkali treatment: 65 mM sodium bicarbonate for 14 days; heat treatment: 42℃, RH >90% for 28 hours. Scale bar: 10 cm. Data are presented as mean ± standard deviation, n = 3 replicates, each consisting of 24 rice seedlings. The same letter indicates no significant difference. Significant differences were determined by Statix ​​8.0 analysis and post-hoc paired multiple comparison test (LSD < 0.05). Detailed Implementation

[0064] Gibberellins (GA), also known as GA20, are natural plant growth regulators. Gibberellins belong to a class of tetracyclic diterpenoid compounds found in organisms and are a group of important biologically active endogenous plant growth regulators, with over 100 species discovered to date. Commonly found biologically active gibberellins include GA1, GA3, GA8, GA4, and GA7. Different gibberellins promote the growth of different parts of the plant. GA1 is present in many plants and is a widely distributed, active plant hormone that primarily promotes plant growth and development; it has high activity and few side effects. GA4 is also present in many plants, mainly promoting flowering and fruit extension, and its effect is more significant than that of GA3. During the plant growth and development period, the most important gibberellins are GA1 and GA4. Therefore, the application of gibberellins GA1 and GA4 in agricultural and forestry breeding and variety improvement is of great value.

[0065] By employing relevant technologies (including but not limited to CRISPR-Cas9 plant gene editing technology), applying gibberellin synthesis or inhibitors in vitro, or directly applying active gibberellin in vitro to maintain moderate levels of gibberellin activity in rice (and other plants), the tolerance of rice (and other plants) to alkali and heat stress can be enhanced. Therefore, this invention provides a guiding principle for enhancing the tolerance of rice (and other plants) to alkali and heat stress by maintaining a certain level of active gibberellin in plants. Based on this principle, plant gene manipulation techniques, mutant screening, and germplasm resource screening can be combined to develop agricultural agents or plant growth regulators (including but not limited to fertilizers and other agricultural products) that maintain active gibberellin levels in plants to enhance rice's resistance to alkali or heat stress. Therefore, this invention is of great significance for further addressing the effects of alkali and heat stress on plant growth and yield formation.

[0066] As used in this article, "alkali stress tolerance" can also be referred to as "alkali stress resistance," "alkali stress tolerance," "alkali resistance," or "alkali resistance." "Heat stress tolerance" can also be referred to as "heat stress resistance," "heat stress tolerance," "heat resistance," or "heat resistance." When both "alkali stress tolerance" and "heat stress tolerance" are present, it is simply referred to as "alkali-heat stress tolerance," "alkali / heat stress tolerance," or "alkali-heat stress tolerance," etc.

[0067] We used genetic engineering techniques to construct near-isogenic lines (NILs) for the genes ATT1 and ATT2, specifically for the African wild rice BART (O. Barthii) and the Asian cultivated rice LTP (Lontab, one of the Green Revolution varieties (GRVs)). These included NIL-ATT1. BART NIL-ATT2 BART NIL-ATT1 LTP and NIL-ATT2 LTPThen, experiments were conducted under alkaline and heat stress conditions. The study observed the responses of genes ATT1 and ATT2 to alkaline and heat stress; that is, the expression of genes ATT1 and ATT2 was inhibited by alkaline and heat stress, and alkaline and heat stress did not change the expression sites of ATT1 and ATT2. The experiment also observed the response of the concentrations of active gibberellins GA1 and GA4 to alkaline and heat stress, showing that alkaline and heat stress reduced the concentrations of active gibberellins GA1 and GA4 in rice stems, leaves, and panicles. Furthermore, the experiment also observed that the growth phenotype and survival rate of near-isogenic lines were affected by alkaline and heat stress.

[0068] Therefore, we conducted targeted supplementation experiments on near-isogenic lines, including improving the function or expression level of ATT1 and ATT2 genes through genetic engineering technology, and maintaining a moderate concentration of active gibberellin by adding exogenous active gibberellin to the plants, so that the level of active gibberellin in the plants was basically restored to the level under no alkali stress and no heat stress, and finally the near-isogenic lines (NIL) were made alkali-heat stress tolerant.

[0069] The above research results confirm the feasibility of the technical solution of the present invention. That is, by modifying the function or expression level of ATT1 and ATT2 genes through genetic engineering technology, or by applying active gibberellin or active gibberellin synthesis inhibitors in vitro to maintain a moderate concentration of active gibberellin, the tolerance of rice to alkali stress and heat stress can be enhanced.

[0070] As used herein, the terms “(alkali / heat stress tolerance) increase,” “enhancement,” or “improvement” can mean an increase of at least 10% relative to a reference level (such as Green Revolution Variety (GRV) rice / initial rice), for example, an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or any increase between 10% and 100%, or an increase of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times relative to a reference level.

[0071] In the description of the technical solutions of this invention, the term "and / or" used in terms such as "A and / or B" or "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0072] On the other hand, the advantage of using ATT1 and ATT2 gene expression levels to determine whether plants, such as rice, possess tolerance to alkali / heat stress lies in the fact that it is possible to pre-assess the potential of candidate plant varieties to tolerate alkali and / or heat stress, even in the laboratory. Since the entire life cycle of crops like rice is typically one year or six months, examining their biological traits and phenotypes through field cultivation under normal circumstances would inevitably consume a significant amount of time and resources, as well as substantial land and labor costs. In contrast, gene identification can be completed in the laboratory, with gene sequencing performed in a short period, such as on seedlings within a few weeks, or even just on seeds. This significantly improves efficiency and greatly saves time, space, and labor costs, resulting in substantial economic benefits.

[0073] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0074] Example

[0075] The examples involve the addition amount, content and concentration of various substances, and unless otherwise specified, the percentage content refers to the mass percentage content.

[0076] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-30°C).

[0077] Materials and general methods

[0078] The gene sequencing and primer synthesis in this embodiment were outsourced to Sangon Biotech (Shanghai) Co., Ltd.

[0079] The molecular biology experiments in this embodiment, including plasmid construction, enzyme digestion, competent cell preparation, and transformation, were mainly conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook and DW. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. For example, the methods for competent cell transformation and competent cell preparation were both performed according to Chapter 1, page 96 of *Molecular Cloning: A Laboratory Manual* (3rd Edition). Specific experimental conditions could be determined through simple experiments if necessary.

[0080] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0081] Molecular biology methods, including gene editing technology, and methods for constructing transgenic plants are operated using techniques commonly used in the field.

[0082] Example 1: Identification of alkali- and heat-stress phenotypes

[0083] For alkali tolerance phenotype identification, rice seedlings at the one-leaf-one-heart stage were transferred to a nutrient solution containing 65 mM sodium bicarbonate for 7 to 14 days, with the alkaline treatment solution being changed multiple times during the treatment period. When yellowing, curling, and wilting of the rice leaves were observed, the alkali treatment was stopped, and the seedlings were replaced with a normal nutrient solution and cultured for another 7 to 14 days. Photographs were then taken, and the survival rate was calculated. Because seedling growth is affected by various factors such as light, temperature, seed quality, and germination conditions, the duration of each alkali treatment may vary. To ensure the accuracy of the experiment, 24 seeds were sown in each biological replicate, and three biological replicates were set up. For heat stress tolerance phenotype identification, rice seedlings at the one-leaf-one-heart stage were also placed in a heat treatment chamber at 42°C and 90% humidity for 20 to 30 hours, with the treatment time adjusted according to specific conditions. After heat treatment, seedlings recovered growth for 7 to 14 days, after which photographs were taken, and the survival rate was calculated. Similar to the identification of alkali stress phenotypes, 24 seeds were sown in each biological replicate group, and 3 biological replicates were set up.

[0084] Example 2: Real-time quantitative PCR

[0085] Leaves from 12-day-old rice seedlings or tissues (roots, stems, panicles, and leaves) during the booting stage were selected as experimental materials. To investigate the effects of different alkaline or heat stresses on rice gene expression, the seedlings were divided into two groups: one group was treated with alkali (65 mM sodium bicarbonate solution for 24 hours), and the other group was treated with heat (42°C at a relative humidity greater than 90% for 3 hours). After treatment, RNA was extracted from both treated and untreated rice tissues using the SteadyPure Universal RNA Extraction Kit II, following the instructions. To analyze the post-transcriptional mRNA levels of relevant genes, reverse transcription was performed using the qPCR RT Master Mi kit to convert RNA into cDNA. Subsequently, quantitative RT-PCR analysis of the cDNA was performed using a Real-Time PCR system and SYBR Green Master Mix. In the experimental design, each sample was subjected to three biological replicates to ensure data reliability and reproducibility. In data analysis, we selected the ACTIN gene of rice as an internal reference gene to correct for differences in gene expression among samples.

[0086] Real-time quantitative PCR conditions include:

[0087] (1) 20 μl reaction system: 6 μl ddH2O; 1 μl DNA template; 10 μl SYBR Green Master Mix; 1.5 μl 5 pmol / μl primer F / R;

[0088] (2) PCR amplification program: 94℃ pre-denaturation for 30 s sec; 94℃ denaturation for 30 sec, 50-60℃ annealing for 1 min, 72℃ extension for 45 sec, 40 cycles; 72℃ incubation for 10 min. Results were analyzed using QIAquant 96 Software and the ΔΔCt method was employed.

[0089] Primers used for RT-PCR include:

[0090] The 5' oligonucleotide primer sequence for ATT1 is as follows:

[0091] 5'-CTCTCCTTCGGCTTCCAC-3',

[0092] The 3' primer sequence is as follows:

[0093] 5'-GCGACAGCTCCTTCATCTC-3'.

[0094] The 5' oligonucleotide primer sequence for ATT2 is as follows:

[0095] 5'-GGCTTCTTCCTGGTGGTTAA-3',

[0096] The 3' primer sequence is as follows:

[0097] 5'-CTTCATCTCCAGCCGATGAGTA-3'.

[0098] The 5' oligonucleotide primer sequence for OsGA2ox1 is as follows:

[0099] 5'-CTGACAAATGGGAGGCTGATA-3',

[0100] The 3' primer sequence is as follows:

[0101] 5'-GGGTGGTGATGCGAAGTAT-3'.

[0102] The 5' oligonucleotide primer sequence for OsGA2ox2 is as follows:

[0103] 5'-GATCGGTTGACGGAATCCTTAT-3',

[0104] The 3' primer sequence is as follows:

[0105] 5'-CCTCACTGCCTCCACATAATC-3'.

[0106] The 5' oligonucleotide primer sequence for OsGA2ox3 is as follows:

[0107] 5'-GGCCAACAGCCTAAAGTCTA-3',

[0108] The 3' primer sequence is as follows:

[0109] 5'-CTGTGGCAATGGTGCAATC-3'.

[0110] The 5' oligonucleotide primer sequence for OsGA2ox4 is as follows:

[0111] 5'-GCTGCAGGTGATGACGAA-3',

[0112] The 3' primer sequence is as follows:

[0113] 5'-GCCCTCCGAAGTAGATCATTG-3'.

[0114] The 5' oligonucleotide primer sequence for OsGA2ox5 is as follows:

[0115] 5'-CCTACCACACGCTCATCATC-3',

[0116] The 3' primer sequence is as follows:

[0117] 5'-CCATGATCTGCTTCCTGTACTC-3'.

[0118] The 5' oligonucleotide primer sequence for OsGA2ox6 is as follows:

[0119] 5'-CATACAGGGCCTTCACCTTC-3',

[0120] The 3' primer sequence is as follows:

[0121] 5'-AGTTTGGGAGGCCAATCTTT-3',

[0122] The 5' oligonucleotide primer sequence for OsGA2ox7 is as follows:

[0123] 5'-CTAACGAACGGGAGGTTCAG-3',

[0124] The 3' primer sequence is as follows:

[0125] 5'-CCGAAGAAGACCATGGACAC-3'.

[0126] The 5' oligonucleotide primer sequence for OsGA2ox8 is as follows:

[0127] 5'-TTGACGAATGGGAGGTTCAG-3',

[0128] The 3' primer sequence is as follows:

[0129] 5'-CGAAGTAGATCACCGACAGC-3'.

[0130] The 5' oligonucleotide primer sequence for OsGA2ox9 is as follows:

[0131] 5'-AGATACTCCGTCGCCTACTT-3',

[0132] The 3' primer sequence is as follows:

[0133] 5'-CGAAGGTGAACGCCTTGTA-3'.

[0134] The 5' oligonucleotide primer sequence for OsGA2ox10 is as follows:

[0135] 5'-TGAGATCTCTTTGCGTGATGG-3',

[0136] The 3' primer sequence is as follows:

[0137] 5'-AATTCTACCACCTGGCTGTAAG-3'.

[0138] The 5' oligonucleotide primer sequence for EUI1 is as follows:

[0139] 5'-CATCATCGAGCCGGAGTTC-3',

[0140] The 3' primer sequence is as follows:

[0141] 5'-GGGTGCAGTAGATGTGTCAA-3'.

[0142] Example 3: GUS staining

[0143] Transgenic ProATT1::GUS and ProATT2::GUS rice plants (ZH11 background) were cultured and grown under normal conditions until the jointing stage. These plants were then divided into two groups for heat treatment: one group underwent 1- or 3-day sodium bicarbonate treatment (150 mM sodium bicarbonate solution), and the other group underwent 1- or 3-day high-temperature treatment (45°C, maintained at 45°C, relative humidity greater than 90%). After treatment, roots, stems, leaves, and panicles were collected. These tissues were stained using a Coolaber GUS staining kit (SL7160). Samples were first immersed in GUS staining buffer under vacuum for 30 minutes, then incubated at 37°C for 4 to 10 hours. Afterward, chlorophyll was removed using 75% ethanol until complete destaining, and the samples were photographed for recording.

[0144] Example 4: Determination of active gibberellins GA1 and GA4

[0145] near-isogenic line NIL-ATT1 / 2 LTP (NIL-ATT1 LTP / ATT2 LTP NIL-ATT1 BART and NIL-ATT2 BART After reaching the jointing stage under normal conditions, some rice plants were subjected to alkaline treatment with a 150 mM sodium bicarbonate solution for 7 or 14 days. Other plants underwent heat treatment at 45°C and relative humidity exceeding 90% for 2 or 4 days. Rice stems (the terminal internodes), leaves (the penultimate leaf), and panicles 5-10 cm long were collected before and after treatment and immediately frozen in liquid nitrogen. Subsequently, the levels of endogenous gibberellins (GA1, GA4) in these stems, leaves, and panicles were measured by the CAS Center for Excellence in Molecular Plant Sciences-Core Facility Center.

[0146] Example 5: RT-PCR and ChiP-PCR detection after treatment with gibberellin and paclobutrazol

[0147] near-isogenic line NIL-ATT1 LTP NIL-ATT1 BART and NIL-ATT2 LTP NIL-ATT2 BARTAfter 6 days of hydroponics, GA3 or paclobutrazol (PA) was added to the hydroponic culture medium at a final concentration of 1 μM, and the treatment lasted for 6 days. Some seedlings underwent alkali treatment (65 mM sodium bicarbonate for 24 hours), while others underwent heat treatment (42℃, RH>90%, for 3 hours). RT-PCR and ChiP-PCR were then performed according to the above procedures.

[0148] Results and Discussion

[0149] 1. Gene ATT1 is highly expressed in leaves, while ATT2 is highly expressed in stems and ears. Alkali stress and heat stress inhibit the expression of genes ATT1 and ATT2, but do not change the expression pattern of ATT1 and ATT2. At the same time, they promote the expression of active gibberellin metabolism genes GA2 oxidase and EUII.

[0150] Phenotypic identification of NIL-ATT1 under alkaline and thermal stress BART (Carrying the ATT1 gene locus of African wild rice) or NIL-ATT2 BART The alkali and heat tolerance of the line carrying the ATT2 gene locus of African wild rice was significantly lower than that of the corresponding near-isogenic line NIL-ATT1. LTP (Carrying the ATT1 gene locus of Asian cultivated rice) or NIL-ATT2 LTP (Carrying the ATT2 gene locus in Asian cultivated rice) Figure 1 ATT1 (LOC_Os01g66100) encodes GA20 oxidase 2 (GA20OX2), and ATT2 (LOC_Os03g63970) encodes GA20 oxidase 1 (GA20OX1). Further experimental analysis revealed that ATT1 is mainly expressed in leaves, while ATT2 is mainly expressed in stems and ears, and that alkaline stress and heat stress do not alter the expression sites of ATT1 and ATT2. Figure 2 , Figure 3 Before alkali and heat treatment, ATT1 is in NIL-ATT1 BART The expression level of [a substance] was significantly higher than that of NIL-ATT1. LTP ATT2 in NIL-ATT2 BART The expression level in [the cell] was significantly lower than that in NIL-ATT2. LTP ( Figure 4 Following alkaline-heat stress, the expression levels of ATT1 and ATT2 were significantly reduced, but ATT1 expression was significantly lower in NIL-ATT1. BART The expression level of [a specific substance] is still significantly higher than that of NIL-ATT1. LTP ATT2 in NIL-ATT2 BART The expression level in [the cell] is still significantly lower than that in NIL-ATT2. LTP ( Figure 4Furthermore, we found that the expression of GA catabolism genes OsGA2oxs and EUI1 was mostly upregulated under alkaline and heat stress. Figure 5 ).

[0151] 2. Alkali and heat stress inhibit the synthesis of active gibberellins, and maintain moderate levels of active gibberellins in rice through the ATT1 and ATT2 genes, thereby enhancing the alkali-heat tolerance of rice.

[0152] ATT1 and ATT2 are a pair of homologous genes encoding GA20 oxidase, both involved in gibberellin synthesis. GA20 oxidase can synthesize GA20 through both the early 13-hydroxylation pathway (GA1 pathway) and the non-13-hydroxylation pathway (GA4 pathway). 53 Convert to GA 20 And GA9, further via GA3 oxidase, generates biologically active gibberellins GA1 and GA4. Therefore, for NIL-ATT1 / 2 LTP (NIL-ATT1 LTP / ATT2 LTP ), NIL-ATT1 BART and NIL-ATT2 BART The contents of active gibberellins GA1 and GA4 in the stems, leaves, and ears of the three materials were determined (note that LTP and NIL-ATT1 should be distinguished). LTP and NIL-ATT2 LTP While genomically identical, LTP was used instead of NIL-ATT1 to save experimental costs. LTP and NIL-ATT2 LTP The results showed that under normal conditions as well as under alkaline and heat stress, NIL-ATT1 BART The bioactive GA level is high, while NIL-ATT2 BART The level is low, compared to NIL-ATT1 LTP / NIL-ATT2 LTP This is true in all three tissues (stem, leaf, and spike). Figure 6 Furthermore, we found that the accumulation of bioactive GA was most abundant in the spike compared to the stem and leaves, which is inconsistent with the tissue expression patterns of ATT1 and ATT2. Figure 2 , Figure 6 , Figure 7 Furthermore, alkali stress and heat stress reduced the concentration of active gibberellins in stems, leaves, and spikes. Figure 6 , Figure 7 Therefore, compared to its near-isogenic line NIL-ATT1 BART (highest level of active gibberellin content) and NIL-ATT2 BART (Minimum level of active gibberellin content), NIL-ATT1LTP / NIL-ATT2 LTP Maintaining moderate levels of active gibberellin at the whole-body level (including stems, leaves, and spikes) demonstrated the strongest tolerance to alkali and heat stress. Figure 1 , Figure 6 Therefore, ATT1 and ATT2 can regulate rice alkali-heat tolerance by modulating the synthesis of active gibberellins.

[0153] 3. Applying 0.1 μM GA3 or PAC in vitro during the seedling stage to maintain moderate gibberellin activity levels in rice enhances its tolerance to alkali and heat stress.

[0154] We treated NIL-ATT1 / 2 with 1 μM GA3 or paclobutrazol. LTP (NIL-ATT1 LTP / ATT2 LTP NIL-ATT1 BART and NIL-ATT2 BART Then, alkali-heat tolerance was assessed. The results showed that after treatment with 1 μM GA3 gibberellin, NIL-ATT2... BART The survival rate of alkali-heat treatment was significantly higher than that of NIL-ATT1 / 2. LTP (NIL-ATT1 LTP / ATT2 LTP ) and NIL-ATT1 BART After treatment with 1 μM paclobutrazol, NIL-ATT1 BART The survival rate of alkali-heat treatment was significantly higher than that of NIL-ATT1 / 2. LTP (NIL-ATT1 LTP / ATT2 LTP ) and NIL-ATT2 BART ( Figure 8 These experimental results indicate that NIL-ATT1 BART High levels of active gibberellin and NIL-ATT2 BART Low levels of active gibberellin are the cause of its sensitivity to alkali-heat stress, as indicated by NIL-ATT1. BART In vitro application of gibberellin inhibitors (which can reduce the level of active gibberellins) or NIL-ATT2 BART In vitro application of GA3 (which can increase the level of active gibberellin) can enhance rice's tolerance to alkali and heat. Therefore, maintaining a moderate level of active gibberellin in rice by applying 0.1 μM GA3 or PAC (paclobutrazol) can enhance the rice's tolerance to alkali and heat stress.

[0155] The embodiments described above are merely preferred embodiments for fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention.

Claims

1. A method for increasing the tolerance of plants to alkali stress and / or heat stress, characterized in that, The process includes the following steps: regulating the level of active gibberellins in the plant by maintaining the level of active gibberellins in the plant at a moderate level, where the moderate level refers to the level / content of active gibberellins in the Green Revolution plant under normal growth conditions, i.e., without environmental stress.

2. The method as described in claim 1, characterized in that, The active gibberellins refer to gibberellins GA1 and GA4.

3. The method as described in claim 1, characterized in that, The methods for regulating the level of active gibberellins in plants are selected from the following group: 1) Endogenous regulation, adjusting the expression level or activity of gibberellin 20 oxidase in plants to maintain the active gibberellin in the plant at the aforementioned moderate level; and / or 2) Exogenous regulation: When the level / content of active gibberellin in the plant is lower than the intermediate level, active gibberellin, or active gibberellin synthesis inhibitor, or active gibberellin synthesis promoter is applied to the plant itself or its planting soil / culture solution to maintain the active gibberellin in the plant at the intermediate level.

4. The method as described in claim 3, characterized in that, The endogenous regulatory mechanism 1) is selected from the following methods: 1-1) When the content of active gibberellin in the plant is significantly lower than the aforementioned intermediate level, the plant is overexpressed with the gene encoding gibberellin 20 oxidase. 1-2) When the content of active gibberellin in the plant is significantly higher than the aforementioned intermediate level, the expression of the gene encoding gibberellin 20 oxidase in the plant is inhibited, or Using gene editing technology, the gene encoding gibberellin 20 oxidase in plants was replaced with an allele that partially lacks the function of gibberellin synthesis.

5. The method as described in claim 4, characterized in that, Method 1-1) is selected from the following methods: (1-1-1) The gene encoding gibberellin 20 oxidase was cloned into a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, namely a gibberellin 20 oxidase gene overexpression vector. Plants were transformed by Agrobacterium-mediated transformation to obtain transgenic plants overexpressing gibberellin 20 oxidase. (1-1-2) By using gene editing technology, the gene encoding gibberellin 20 oxidase is cloned into a plant chromosome to obtain transgenic plants that overexpress gibberellin 20 oxidase; and / or (1-1-2) The gene encoding gibberellin 20 oxidase in plants is placed under the regulation of an enhanced promoter. Methods 1-2) are selected from the following methods: (1-2-1) Knock out the gene encoding gibberellin 20 oxidase in plant chromosomes; (1-2-2) Down-regulate the expression level of the gene encoding gibberellin 20 oxidase in the chromosomes of wild-type plants; (1-2-3) Replace the gibberellin 20 oxidase coding gene in plant chromosomes with a mutant of the gibberellin 20 oxidase coding gene that has lost or downregulated function; and / or (1-2-4) Block, inhibit or interfere with the expression of the gene encoding gibberellin 20 oxidase in plant chromosomes.

6. The method as described in claim 1, characterized in that, The plant is selected from the group consisting of: rice, wheat, corn, soybean, barley, oats, rye, sorghum, cotton, vegetables, tobacco, and cruciferous plants, with rice being the preferred plant.

7. The use of active gibberellins as biomarkers in identifying plant tolerance to alkaloid stress and / or heat stress. The use of active gibberellins as biomarkers in the creation of plant germplasm resistant to alkali stress and / or heat stress, and in the breeding of plant varieties resistant to alkali stress and / or heat stress; The use of genes ATT1 (MSU ID LOC_Os01g66100) and ATT2 (MSU ID LOC_Os03g63970) as biomarkers in identifying plant tolerance to alkali stress and / or heat stress. The use of genes ATT1 and ATT2 as biomarkers in creating alkali- and / or heat-tolerant plant germplasm and in breeding alkali- and / or heat-tolerant plant varieties; and Active gibberellins are used as biomarkers for developing pesticides or plant growth regulators that maintain the level of active gibberellins in plants.

8. A method for identifying plant varieties with tolerance to alkali stress and / or heat stress, characterized in that, Includes the following steps: The content of active gibberellin in plant tissues, such as rice, was determined. When the plant was under alkaline stress and / or heat stress, if the content of active gibberellin in the plant tissues was significantly higher or significantly lower than the intermediate level, it indicated that the plant variety was at risk of being intolerant to alkaline stress and / or heat stress. Conversely, when plants are in alkaline and / or heat stress environments, if the content of active gibberellins in plant tissues, such as rice, remains essentially at the moderate level or is not significantly lower than the moderate level, it suggests that the plant, such as rice, has a tendency to be tolerant to alkaline and / or heat stress.

9. A method for identifying plant varieties with tolerance to alkali stress and / or heat stress, characterized in that, Includes the following steps: The expression levels of genes ATT1 and / or ATT2 in plants such as rice were measured. When plants are in alkaline stress and / or heat stress growing environments, if the expression levels of genes ATT1 and / or ATT2 are significantly higher than or significantly lower than the intermediate level, it suggests that the plant variety is at risk of being intolerant to alkaline stress and / or heat stress. Conversely, when plants are in alkaline and / or heat stress environments, if the expression levels of genes ATT1 and / or ATT2 remain at or are not significantly lower than the aforementioned moderate levels, it suggests that the plant has a tendency to tolerate alkaline and / or heat stress.

10. A kit for performing the identification method as described in claim 9, characterized in that, The following PCR primers are included for amplifying genes ATT1 and ATT2: Forward primer RT-PCR-ATT1-F: CCTCCTTCGGCTTCCAC (SEQ ID NO:1), Reverse primer RT-PCR-ATT1-R: GCGACAGCTCCTTCATCTC (SEQ ID NO:2); Forward primer RT-PCR-ATT2-F: GGCTTCTTCCTGGTGGTTAA (SEQ ID NO:3), Reverse primer RT-PCR-ATT2-R: CTTCATCTCCAGCCGATGAGTA (SEQ ID NO:4).