Application of rice gene bZIP86 or bZIP87 in improvement of efficient utilization of rice nitrogen

By overexpressing rice genes bZIP86 and bZIP87, the expression of nitrogen absorption and assimilation genes was regulated, solving the problem of low nitrogen fertilizer utilization efficiency in rice and achieving efficient nitrogen fertilizer utilization and improved agronomic traits.

CN121915079APending Publication Date: 2026-04-24ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ZHEJIANG UNIV
Filing Date
2025-11-21
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Current technologies show low nitrogen fertilizer utilization efficiency in rice, leading to increased agricultural production costs and environmental pollution. Therefore, it is necessary to cultivate rice germplasm with high nitrogen fertilizer utilization efficiency.

Method used

By overexpressing rice genes bZIP86 and bZIP87, the expression of nitrogen absorption assimilation genes was regulated. A vector was constructed and transferred into rice. Gene modification was carried out using the pCAMBIA1301 vector to inhibit uORF translation and to increase expression abundance by using a deletion fragment in the indica rice promoter region.

Benefits of technology

It significantly improves the efficiency of nitrogen absorption and utilization in rice, improves agronomic traits, reduces agricultural production costs, and reduces environmental pollution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121915079A_ABST
    Figure CN121915079A_ABST
Patent Text Reader

Abstract

The invention discloses application of a rice gene bZIP86 or bZIP87 in improvement of efficient utilization of rice nitrogen. The base sequence of the rice gene bZIP86 is shown as SEQ ID NO. 1; the base sequence of the rice gene bZIP87 is as shown in SEQ ID NO. 4; a rice gene bZIP86 or bZIP87 is connected with a promoter UBI to construct a vector, and the vector is transferred into rice through agrobacterium tumefaciens mediation, so that the efficient utilization of rice nitrogen is improved. The bZIP86 promoter region in the indica rice variety has large fragment loss, which leads to decline of gene expression. The bZIP86 is connected with a japonica rice bZIP86 promoter, a constructed vector is introduced into indica rice R8015, and expression of downstream nitrogen metabolism related genes can be remarkably improved. By creating bZIP86 and bZIP87 overexpression plants, efficient utilization of nitrogen by rice is greatly improved, multiple field experiments further prove that the rice has excellent agronomic characters, and a new angle is provided for rice nutrient efficient breeding. The gene and the operation technology provided by the invention have a remarkable effect in the aspect of improving the high-temperature resistance of the rice, and have very high application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to the application of rice genes bZIP86 or bZIP87 in improving the efficient use of nitrogen in rice. Background Technology

[0002] Nitrogen is a macronutrient essential for plant growth and development. Except for some legumes that can fix nitrogen in root nodules, most plants need to absorb inorganic nitrogen (mainly nitrate and ammonium nitrogen) from the external environment. After nitrate is absorbed into the roots, it is reduced to nitrite by nitrate reductase, and further reduced to ammonium by nitrite reductase. Glutamine synthase and glutamate synthase form the GS-GOGAT cycle, converting glutamine into glutamine.

[0003] Applying nitrogen fertilizer can promote plant growth and development and increase crop yield. However, the amount of nitrogen fertilizer applied in modern agriculture is out of balance with the increase in grain production. Therefore, the phenomenon of high fertilizer application and low efficiency not only increases agricultural production costs but also has negative impacts on sustainable agricultural development and the environment. Excessive nitrogen fertilizer application leads to soil compaction and degradation, which eventually flows into rivers, lakes, and seas, causing eutrophication and polluting water resources.

[0004] Therefore, cultivating rice germplasm with high nitrogen fertilizer utilization efficiency is key to resolving the conflict between environment and resources in agricultural production. This invention identifies two factors that positively regulate nitrogen utilization efficiency in rice. bZIP86 and bZIP87 By regulating the expression of nitrogen absorption assimilation genes, agronomic traits can be improved. Summary of the Invention

[0005] This invention provides rice genes bZIP86 or bZIP87 Application in improving nitrogen-efficient utilization in rice, rice genes bZIP86 The base sequence is shown in SEQ ID NO.1; rice gene bZIP87 The base sequence is shown in SEQ ID NO.2; bZIP86 The transcript sequence is shown in SEQ ID NO.3. bZIP87 The transcript sequence is shown in SEQ ID NO.4.

[0006] Rice genes bZIP86 or bZIP87 The transcript sequence was linked to the promoter UBI to construct a vector, which was then transferred into rice via Agrobacterium-mediated transformation to improve the efficient nitrogen utilization of rice.

[0007] The carrier is pCAMBIA1301.

[0008] The rice gene mentioned bZIP86The transcript sequence contains two coding regions, mORF and uORF. The bZIP86 mORF is shown in SEQ ID NO.5, and its encoded protein amino acid sequence is shown in SEQ ID NO.6. The bZIP86 uORF is shown in SEQ ID NO.7, and its encoded protein amino acid sequence is shown in SEQ ID NO.8.

[0009] The rice gene mentioned bZIP86 The uORF sequence regulates and inhibits the protein level of mORF translation.

[0010] The rice gene mentioned bZIP87 The transcript sequence has two coding regions, namely mORF and uORF. The bZIP87 mORF is shown in SEQ ID NO.9, and its encoded protein amino acid sequence is shown in SEQ ID NO.10. bZIP87 uORF is shown in SEQ ID NO.11, and its encoded protein amino acid sequence is shown in SEQ ID NO.12. The rice gene described herein... bZIP87 The uORF sequence regulates and inhibits the protein level of mORF translation.

[0011] The present invention relates to bZIP86 The gene is located on rice chromosome 5 and is numbered Os05g0129300 (RAP number) or LOC_Os05g03860 (MSU number). bZIP86 The full-length DNA sequence is 3374 bp, containing a 2000 bp promoter sequence and one exon, as shown in SEQ ID NO.1. The full-length transcript is 1374 bp, as shown in SEQ ID NO.3. bZIP86 The transcript has two coding region sequences: the mORF sequence is shown in SEQ ID NO.5, and its encoded protein is shown in SEQ ID NO.6; the uORF sequence is shown in SEQ ID NO.7, and its encoded protein is shown in SEQ ID NO.8. bZIP87 The gene is located on chromosome 12 and is numbered Os12g0560900 (RAP number) or LOC_Os12g37410 (MSU number). bZIP87 The full-length DNA sequence is 3296 bp, containing a 2000 bp promoter sequence and one exon, as shown in SEQ ID NO.2. The full-length transcript is 1452 bp, as shown in SEQ ID NO.4. bZIP87The transcript has two coding region sequences: the mORF sequence is shown in SEQ ID NO.9, and its encoded protein is shown in SEQ ID NO.10; the uORF sequence is shown in SEQ ID NO.11, and its encoded protein is shown in SEQ ID NO.12.

[0012] This invention utilizes gene overexpression bZIP86 or bZIP87 It showed significantly higher nitrogen absorption and assimilation than the control ZH11, which could significantly improve agronomic traits.

[0013] although bZIP86 or bZIP87 The single-mutant variety showed no difference from the wild type. The double-mutant variety showed no significant difference from the wild type at low nitrogen (0N) levels, but exhibited growth defects, stunted growth, and reduced fresh weight at high nitrogen levels.

[0014] bZIP86 and bZIP87 can positively regulate the expression of nitrogen metabolism-related genes, thereby increasing nitrogen uptake and utilization. Overexpression of these materials can significantly improve the expression levels of downstream genes.

[0015] Complete amplification was obtained by PCR bZIP86 and bZIP87 The cDNA sequence, containing the 5' UTR sequence, was ligated to the overexpression vector pCAMBIA1301-UBI via homologous recombination at the Sma I restriction site. Primer design is as follows: bZIP86 OEF: TAGAGGATCCGGTACCACCCTTCCCCCATCCGTCTAATTGC; bZIP86 OE R: CAGTTCTAGATCGATTCCCGAACTGGAAGGCGTCGGCCATG. bZIP87 OE F:TAGAGGATCCGGTACCACCCTCCCCCTTCTTCCCCTCATCC; bZIP87 OE R: CAGTTCTAGATCGATTCCCGTACTGGAGCATGTGCGCGG.

[0016] This invention discovers bZIP86 and bZIP87The 5' end of each gene contains an upstream open reading frame (uORF) region, which inhibits the translation of the gene's own major open reading frame (mORF). This invention discovered that the promoter region of the bZIP86 gene exhibits indica stem differentiation, with most indica rice varieties containing a large deletion of approximately 1500 bp. The presence of this 1500 bp fragment contributes to increasing the expression abundance of bZIP86. Amplifying this fragment from japonica rice ZH11 and transforming it into indica rice Hui8015 significantly increased the expression levels of downstream nitrogen-related genes.

[0017] Gene bZIP86 The promoter region exhibits indica stem differentiation, and most indica rice varieties contain a large deletion of approximately 1500 bp, named the InDel sequence, as shown in SEQ ID NO.13. The presence of this 1500 bp sequence contributes to increasing the expression abundance of bZIP86. Amplifying this fragment from japonica rice ZH11 to construct the InDel pro::bZIP86 vector, and transforming it into indica rice Zhonghui 8015, significantly increased the expression levels of downstream nitrogen-related genes.

[0018] Multiple field trials have shown that overexpression materials can significantly improve agronomic traits and increase yield.

[0019] The present invention provides a carrier incorporating the above-described design.

[0020] This invention provides Escherichia coli and Agrobacterium containing the above-mentioned carriers.

[0021] Compared with the prior art, the present invention has the following advantages: This invention, through phenotypic analysis, nitrogen content determination, and expression levels of genes related to nitrogen absorption and utilization, has demonstrated that bZIP86 and bZIP87 can regulate the efficient absorption and utilization of nitrogen in rice. This invention also discovered... bZIP86 and bZIP87 Both genes contain uORF structures, which inhibit mORF at the translational level. bZIP86 There is a large segment missing from the promoter between indica and japonica rice varieties, and this segment positively promotes... bZIP86 The expression level of [a specific gene] can be adjusted, thereby further regulating the expression levels of downstream nitrogen-related genes. This invention achieves this by creating [a specific gene]. bZIP86 and bZIP87 Overexpression significantly improved the efficient nitrogen utilization of rice, and multiple field trials have further confirmed its excellent agronomic traits, providing a new perspective for efficient nutrient breeding of rice. Attached Figure Description

[0022] Figure 1 for bzip86 / 87The diagram shows the nitrogen absorption and assimilation growth defect phenotype of the double-transformed genus. (a) Under 0 N level conditions, neither the single-transformed nor the double-transformed genus differed from the wild type; under 1 N level conditions, the single-transformed genus showed no difference from the wild type, while the double-transformed genus exhibited slow growth and stunted plants. (b) Statistical analysis showed that the double-transformed genus significantly reduced plant height and fresh weight, while root length showed no difference. (c) Field soil cultivation experiments also demonstrated the deficiency in nitrogen absorption and utilization of the double-transformed genus. Under four different nitrogen levels, the double-transformed genus was significantly lower than the wild type in agronomic traits such as plant height, tiller number, and yield.

[0023] Figure 2 Figure 1 shows the total nitrogen content determination of mutants and overexpression materials. (a) At the 0.2N level, there was no significant difference in nitrogen content between the double mutant and wild-type plants. At the 1N level, nitrogen content was significantly lower in the double mutant, both in root tissue and aboveground parts. (b) In the overexpression plants, nitrogen content was significantly higher than in the wild type, especially at high nitrogen levels. (c) Stable isotope uptake measurements showed that the double mutant plants had significantly lower uptake of both nitrate and ammonium nitrogen than the wild type.

[0024] Figure 3 The diagram illustrates the influence of the bzip86 / 87 double mutant on nitrogen uptake and assimilation using transcriptome data. (a) Transcriptome sequencing was performed on aboveground and root tissues from both the double mutant and wild-type plants at the 1N level. (b) KEGG analysis of differentially expressed genes showed enrichment of nitrogen metabolism pathways in both aboveground and belowground samples. (c) Quantitative PCR validation was performed on nitrogen uptake and assimilation-related genes; these genes showed significantly lower expression levels in the double mutant compared to the wild-type. bZIP86 or bZIP87 Both can promote gene expression.

[0025] Figure 4 Suppressing uORF structure bZIP86 and bZIP87 The translated figure shows that nitrogen treatment (ab) can induce bZIP86 and bZIP87 Transcription level. (c) Both genes have uORF structures in their 5'UTR regions. To further investigate the effect of uORF on mORF translation level, a mutant uORF was constructed and linked to the reporter gene LUC, and then transferred into rice protoplasm. (d) Changes in uORF do not affect bZIP86 and bZIP87 The transcriptional level was reduced, but the protein level (enzyme activity) of the reporter gene was significantly suppressed, while the mutant uORF did not affect the protein level. (fg) Further results were obtained bZIP86 Two types of overexpression stable transgenic materials, mbZIP86 (Only mORF, not uORF) and tbZIP86(Possesses both uORF and mORF). They have the same transcriptional level but differ significantly at the protein level; the presence of the uORF structure leads to a decrease in mbZIP86 protein levels. (hi) and bZIP86 resemblance, bZIP87 uORF also inhibits the translation of the downstream mbZIP87 protein.

[0026] Figure 5 for bZIP86 A diagram showing the natural variation of the promoter region, where (a) the promoter region of Indica rice R8015 (R8015) has a large deletion of approximately 1500 bp compared to Japonica rice ZH11. (b) Rice genome databases show that this fragment is present in the vast majority of Japonica rice varieties, while it is absent in Indica rice varieties. (c) Further validation was achieved by PCR amplification in 12 Japonica and 12 Indica rice varieties. (d) Quantitative qPCR experiments showed that this fragment promotes… bZIP86 Transcription. (e.g.) Transformation of InDel pro::tbZIP86 into indica rice R8015 significantly increased the expression of downstream nitrogen-related genes.

[0027] Figure 6 This is a diagram of a nitrogen gradient field experiment in Changxing, Zhejiang Province, where (a, c) represents 2023. bZIP86 and bZIP87 Agronomic traits of overexpressed materials in a nitrogen gradient field (with low, medium, and high nitrogen gradients) in Changxing, Zhejiang. (b, d) 2024, bZIP86 and bZIP87 Overexpression was performed by planting two different transgenic lines, allowing for a more comprehensive examination of agronomic traits. Detailed Implementation

[0028] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Experimental methods in the following examples, unless otherwise specified, were performed according to conventional procedures. The molecular biology and biochemical methods involved in the examples are all known techniques, primarily referring to *Current Protocols in Molecular Biology* by Ausubel, and *Molecular Cloning: A Laboratory Manual*, 4th ED. by Green MR and Sambrook J. Unless otherwise specified, all experimental materials used in the examples are commercially available products.

[0029] This invention provides a method for transforming a vector into the rice variety ZH11 using Agrobacterium, and then screening to obtain genetically modified rice plants. The specific method is as follows: (1) Constructing engineered bacteria: rice genes are transformed into the vector into the rice variety ZH11. bZIP86 or bZIP87The pCAMBIA1301 vector was constructed by ligating it to the UBI promoter. Complete vector was obtained by PCR amplification. bZIP86 and bZIP87 The cDNA sequence, containing the 5' UTR sequence, is ligated to the overexpression vector pCAMBIA1301-UBI via homologous recombination at the SmaⅠ restriction site. Primer design is as follows: bZIP86 OE F: TAGAGGATCCGGTACCACCCTTCCCCCATCCGTCTAATTGC; bZIP86 OE R: CAGTTCTAGATCGATTCCCGAACTGGAAGGCGTCGGCCATG. bZIP87 OE F:TAGAGGATCCGGTACCACCCTCCCCCTTCTTCCCCTCATCC; bZIP87 OE R: CAGTTCTAGATCGATTCCCGTACTGGAGCATGTGCGCGG.

[0030] The constructed vector was transformed into Agrobacterium strain EHA105 by freeze-thaw method. The positive Agrobacterium was obtained by screening with kanamycin and rifampin. (2) Transformation of rice callus and obtaining transgenic positive seedlings: EHA105 infected rice callus and co-cultured in a 22℃ culture room for 3 days. After washing away Agrobacterium with carboxybenzyl solution, the rice callus was placed on a screening medium containing appropriate antibiotics for culture. After 3-4 weeks of culture, resistant callus was obtained and differentiated into seedlings. (3) Identification of positive plants: Positive plants were identified by Western spectroscopy, and two independent transformation lines were selected for subsequent experiments.

[0031] I. bzip86 / 87 Dual mutations affect nitrogen uptake and assimilation Hydroponics were performed in Kimura culture media under different nitrogen conditions. The formula is as follows: KH2PO4 (24.8 g / L), KNO3 (18.5 g / L), K2SO4 (15.9 g / L), MgSO4·7H2O (135.06 g / L), Na2SiO3·9H2O (341.04 g / L), FeSO4-EDTA (FeSO4·7H2O 5.56 g / L, Na2-EDTA·2H2O 7.445 g / L). These are 1000× stock solutions for each macroelement, and each component is prepared separately. 1000× stock solution for microelements: Na6Mo7O 24The following trace elements were added together to prepare a trace element mixed mother liquor: ·4H₂O (0.098 g / L), H₃BO₃ (2.86 g / L), CuSO₄·5H₂O (0.08 g / L), MnCl₂·4H₂O (1.81 g / L), and ZnSO₄·7H₂O (0.22 g / L). To set different nitrogen concentrations, 1M NH₄Cl and 1M KNO₃ were mixed to form a 1000× nitrogen source mother liquor. The required working solution was added to each mother liquor according to volume ratio, and the pH was adjusted to 5 with hydrochloric acid. Calcium nitrate was replaced with calcium chloride, and ammonium sulfate was not added.

[0032] The bzip86 or bzip87 single mutant showed no significant difference from wild-type plants under 0N or 1N conditions, suggesting functional similarity between the two genes. At the 0N level, the double mutant was consistent with the wild type; at the 1N level, double mutant plants grew slowly and had reduced fresh weight. Field soil culture experiments also showed that the double mutant exhibited deficiencies in nitrogen uptake and utilization. Under four different nitrogen levels, the double mutant was significantly lower than the wild type in agronomic traits such as plant height, tiller number, and yield. Figure 1 ).

[0033] Meanwhile, multiple nitrogen concentration gradients were established between 0N and 1N. As nitrogen concentration increased, the differences between the double-mutant plants and the control became more significant. Figure 2 ).

[0034] Nitrogen content was determined in the double mutant and overexpression materials. After one week of culture at 0.2N and 1N levels, root tissues and aerial parts were harvested and their fresh weight measured. The samples were dried, ground into powder, and approximately 1 mg was weighed for analysis using a Thermo Finnigan MAT DELTA plus XP isotope ratio mass spectrometry (TELTA). At the 0.2N level, there was no significant difference in nitrogen content between the double mutant and wild-type plants. At the 1N level, nitrogen content was significantly lower in both root tissues and aerial parts in the double mutant. In the overexpression plants, nitrogen content was significantly higher than in the wild-type, especially at high nitrogen levels. Figure 3 ab).

[0035] To determine whether there are differences in nitrate uptake and transport rates between the mutant and wild type, stable isotopes were used. 15 The tracer detection method for N. First, rice seedlings were cultured in normal Kimura nutrient solution for 7 days, then transferred to a solution containing 5 mM... 15 N-KNO3 (98% atom) 15 N-KNO3, Macklin) or 5 mM 15 N2- (NH4)2SO4 (10% atom) 15N2-(NH4)2SO4 (Aladdin) was absorbed for 3 hours, and samples were taken from both above-ground and below-ground parts. During sampling, the plant roots were first rinsed in 0.1 mM CaSO4 solution for 30 seconds, then rinsed in pure water for 30 seconds, drained, and placed in an oven. Following the above method for total nitrogen determination, the roots were ground into powder, and 1 mg was weighed to determine the 15N stable isotope content in the sample. Figure 3 c).

[0036] At the 1N level, transcriptome sequencing was performed on the aboveground parts and roots of both the double-splastic and wild-type plants. KEGG analysis of differentially expressed genes revealed enrichment of nitrogen metabolism pathways in both aboveground and belowground samples. Quantitative PCR was used to validate nitrogen uptake and assimilation-related genes; these genes showed significantly lower expression levels in the double-splastic plant compared to the wild-type. bZIP86 or bZIP87 Both can promote gene expression. Figure 4 ).

[0037] The above results indicate that bZIP86 and bZIP87 Positive regulation of nitrogen absorption and utilization in rice.

[0038] two 、 uORF structure inhibits the translation of bZIP86 and bZIP87. bZIP86 and bZIP87 uORF structures were present in the 5'UTR region. To further investigate the effect of uORF on mORF translation levels, two mutant uORFs were constructed, altering the start codon ATG-AAA or directly deleting ATG. These mutants were ligated to the reporter gene LUC, transformed into rice protoplasm, and incubated for 12 hours. Cells were then collected by centrifugation. 100 μL of lysis buffer was added, and the cells were incubated on ice for 20 min. The cells were then centrifuged at 15000 g for 10 min at pre-chilled 4°C, and 60 μL of the supernatant was carefully transferred to a new centrifuge tube. The assay was performed according to the Promrga Dual-Luciferase Reporter Assay System kit instructions. The results showed that the uORF alteration did not affect the transcription levels of bZIP86 and bZIP87, but significantly inhibited the protein level (enzyme activity) of the reporter gene. The mutant uORF, however, did not affect the protein level.

[0039] Further gains bZIP86 Two types of overexpression stable transgenic materials, mbZIP86 (UBI::mbZIP86-FLAG, only has mORF, does not carry uORF) and tbZIP86(UBI::tbZIP86-FLAG, possessing both uORF and mORF). They exhibit the same transcriptional levels but show significant differences at the protein level; the presence of the uORF structure leads to a decrease in mbZIP86 protein levels. Compared to... bZIP86 resemblance, bZIP87 uORF also inhibits the translation of the downstream mbZIP87 protein.

[0040] three bZIP86 Natural variation in promoter regions like Figure 5 As shown, the promoter region of Indica rice variety R8015 (R8015) contains a large deletion of approximately 1500 bp compared to that of Japonica rice variety ZH11. Rice genome databases indicate that this fragment is present in the vast majority of Japonica rice varieties, while it is absent in Indica varieties, demonstrating a clear differentiation between Indica and Japonica rice. Further validation was achieved through PCR amplification in 12 Japonica and 12 Indica rice varieties. The 1500 bp Identify F fragment is: CTTGACAGCTTCCTTTCTCCAATGG, and the 1500 bp Identify R fragment is: GGCGTTAACTCATCTGTCAATGTG. Quantitative qPCR experiments showed that the presence of this fragment promotes the transcription of bZIP86. This fragment was amplified from Japonica rice ZH11: 1500 bp F fragment: ATATCGAATTCCTGCAGCCCTCTTTGTGACAACATTTAAC; 1500 bp R fragment: CCTCGACTAGTGGATCCCCCGTACTACCCCTTGGAAAGTTAC. The recombinant ligation vector pGreen0800-35Smini was used. Based on this, fragments carrying 35Smini were amplified: 1500-35Smini F: ACGACGGCCAGTGCCAAGCTTTCTTTGTGACAACATTTAAC; 1500-35Smini R: CGACATGGGTGGTACCGGATCCGACTAGCTTCAGCGTGTCC. This fragment was recombined with the UBI::tbZIP86OE vector (with the UBI promoter removed by enzyme digestion) to form the vector 1500-35Smini::tbZIP86. After transformation with Agrobacterium, 1500bp-35Smini::tbZIP86 was transformed into indica rice R8015. Although plant height decreased, the expression levels of downstream nitrogen-related genes were significantly increased.

[0041] Four 、 Multiple field trials have shown bZIP86 and bZIP87 Overexpression can significantly improve agronomic traits. like Figure 6 As shown, in 2023, bZIP86 and bZIP87 Agronomic traits of overexpressed materials in a nitrogen gradient field (with low, medium, and high nitrogen gradients) in Changxing, Zhejiang Province. (2024) bZIP86 and bZIP87 Overexpression was performed using two different transgenic lines, allowing for a more comprehensive examination of key agronomic traits. Field trial results showed that... bZIP86 and bZIP87 It helps improve the efficient use of nitrogen in rice and has significant breeding value.

Claims

1. Rice genes bZIP86 or bZIP87 Its application in improving nitrogen efficiency in rice is characterized by, Rice genes bZIP86 The base sequence is shown in SEQ ID NO.1; Rice genes bZIP87 The base sequence is shown in SEQ ID NO.2; Rice genes bZIP86 The transcript sequence is shown in SEQ ID NO.3; Rice genes bZIP87 The transcript sequence is shown in SEQ ID NO.4; Rice genes bZIP86 or bZIP87 The transcript sequence was linked to the promoter UBI to construct a vector, which was then transferred into rice via Agrobacterium-mediated transformation to improve the efficient nitrogen utilization of rice.

2. The application according to claim 1, characterized in that, The carrier is pCAMBIA1301.

3. The application according to claim 1, characterized in that, The rice gene mentioned bZIP86 The transcript has two coding region sequences: the mORF sequence is shown in SEQ ID NO.5, and its encoded protein is shown in SEQ ID NO.6; the uORF sequence is shown in SEQ ID NO.7, and its encoded protein is shown in SEQ ID NO.

8.

4. The application according to claim 4, characterized in that, The uORF sequence of the rice gene bZIP86 regulates and inhibits the protein level of mORF translation of the rice gene bZIP86.

5. The application according to claim 1, characterized in that, The rice gene mentioned bZIP87 The transcript has two coding region sequences: the mORF sequence is shown in SEQ ID NO.9, and its encoded protein is shown in SEQ ID NO.10; the uORF sequence is shown in SEQ ID NO.11, and its encoded protein is shown in SEQ ID NO.

12.

6. The application according to claim 5, characterized in that, The uORF sequence of the rice gene bZIP87 regulates and inhibits the protein level of mORF translation of the rice gene bZIP87.

7. Application of rice gene bZIP86 in improving nitrogen efficiency in rice, characterized by: Specifically, it includes: There is a difference in the InDel sequence between indica rice and japonica rice in the bZIP86 promoter region, as shown in SEQ ID NO.

13. This InDel sequence fragment was amplified from japonica rice, the InDel pro::bZIP86 vector was constructed, and it was transformed and introduced into indica rice to improve the expression level of downstream nitrogen-related genes.