Application of OsCML36 gene in improving resistance of rice to sheath blight disease

Abstract

The invention provides application of an OsCML36 gene in improving resistance of rice to sheath blight disease, and belongs to the technical field of gene engineering. The overexpression rice OsCML36 gene is applied to any one of the following applications: (1) the resistance of rice to sheath blight is improved; (2) the agronomic traits of the rice are changed; (3) cultivating transgenic rice with strong sheath blight resistance; (4) cultivating transgenic rice with changed agronomic characters; the nucleotide sequence of the rice OsCML36 gene is as shown in SEQ ID NO. 1. The application of the OsCML36 gene in regulating and controlling the resistance and agronomic traits of the rice sheath blight disease has important significance in analyzing the disease-resistant mechanism of the gene and cultivating rice plants with high disease resistance and high quality.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the application of the OsCML36 gene in improving rice resistance to sheath blight. Background Technology

[0002] CML is a type of Ca that has a structure similar to calmodulin (CaM). 2+ Bound proteins, CML typically contain 1 to 6 "EF-hand" motifs, which are Ca2+ motifs. 2+ Combine important areas to transmit Ca 2+ Signal regulation of disease resistance. In the interaction between plants and pathogens, pathogens often induce the expression of CML genes, promoting plant hypersensitive response (HR) and regulating host disease resistance. For example, the APR134 gene encoding the CML43 protein in tomato and Arabidopsis thaliana is induced by pathogens. Virus-mediated gene silencing technology induces APR134 silencing, reducing Arabidopsis thaliana's resistance to Pseudomonas syringae (…). Pseudomonas syringae pv. tomato Resistance to Pst DC3000 (Pst DC3000) is enhanced by overexpression of this gene, which promotes the HR response induced by Pst DC3000 in Arabidopsis. AtCML8 and AtCML9 are positive regulators of resistance to Pst DC3000 infection in Arabidopsis. AtCML41 in Arabidopsis is a Ca2+ gene containing plasmodesmata. 2+ The binding protein mediates flg22-induced callosity-dependent plasmodesmata closure, actively regulating resistance to Pst DC3000 infection. Furthermore, most CMLs are considered to lack enzymatic or transcriptional activation activity, requiring protein interaction to exert their disease-resistant function. The cotton transcription factor GhMYB108 interacts with the calmodulin GhCML11 to form a positive feedback loop, enhancing cotton's resistance to Verticillium wilt (Pseudomonas aeruginosa). Verticillium dahliae Tomato SlCML55 acts as a negative regulator, modulating tomato's resistance to Phytophthora capsici by inhibiting the SA signaling pathway. Phytophthora capsici Infection; cotton GbCML45 interacts with its homolog GbCML50 via Ca 2+ This method enhances cotton's resistance to Verticillium wilt. Summary of the Invention

[0003] The purpose of this invention is to provide the application of the OsCML36 gene in improving the resistance of rice to sheath blight.

[0004] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides applications for overexpressing the rice OsCML36 gene, wherein the application is any one of the following: (1) Improve rice's resistance to sheath blight; (2) Change the agronomic traits of rice; (3) Develop transgenic rice with strong resistance to sheath blight; (4) Cultivating transgenic rice with altered agronomic traits; The nucleotide sequence of the rice OsCML36 gene is shown in SEQ ID NO.1.

[0005] Preferably, the alteration of agronomic traits of rice is to increase the number of panicles, grain weight, grain length, or grain width of rice plants. The agronomical traits are changed by increasing the number of ears, grain weight, grain length, or grain width.

[0006] This invention provides a method for improving resistance to rice sheath blight by overexpressing the rice OsCML36 gene in rice plants, thereby improving resistance to rice sheath blight; the nucleotide sequence of the rice OsCML36 gene is shown in SEQ ID NO.1.

[0007] This invention provides a method for altering agronomic traits of rice by overexpressing the rice OsCML36 gene in rice plants, thereby increasing the number of panicles, grain weight, grain length, or grain width of rice plants; the nucleotide sequence of the rice OsCML36 gene is shown in SEQ ID NO.1.

[0008] This invention provides a method for breeding transgenic rice with strong resistance to rice sheath blight, wherein the rice OsCML36 gene is overexpressed in rice plants to obtain transgenic rice with strong resistance to rice sheath blight; the nucleotide sequence of the rice OsCML36 gene is shown in SEQ ID NO.1.

[0009] This invention provides a method for breeding transgenic rice with altered agronomic traits, wherein the rice OsCML36 gene is overexpressed in rice plants to obtain transgenic rice with increased panicle number, grain weight, grain length, or grain width; the nucleotide sequence of the rice OsCML36 gene is shown in SEQ ID NO.1.

[0010] This invention provides a rice variety with enhanced resistance to sheath blight, containing the rice OsCML36 gene as shown in SEQ ID NO.1.

[0011] This invention provides a rice seed with enhanced resistance to sheath blight, containing the rice OsCML36 gene as shown in SEQ ID NO.1.

[0012] This invention provides a rice with agronomically modified traits, containing the rice OsCML36 gene as shown in SEQ ID NO.1; the agronomically modified traits are an increase in panicle number, grain weight, grain length, or grain width.

[0013] This invention provides a rice seed with altered agronomic traits, containing the rice OsCML36 gene as shown in SEQ ID NO.1; the agronomic trait alteration is an increase in panicle number, grain weight, grain length, or grain width.

[0014] SEQ ID NO.1: ATGATGAAGCTTGCGCATTTGTTCGGCTCTTCTTCTTCGTCTTCCTCCTCCAAGAAGGAGAACAAGGTGAGCAGCAAGAAGAGGAGGAGCGGCGCCAAGAGCTGCTCCTTCGGCTCCACCACGTCCTCGTCGTCGTTGGCGGC GTCATCATCCGATGATTCCGCCGCCACCACGCCGAGATCCGTGTTGCCGACGTCGGCGGCGGCGTCCTCCTCCGGCACCAAGAAGCCGGCGGCGGCGGCCGTGACGCGGGAGGACCTGGAGGTGGCCCTGCGGAGGATCGTGTCGAGC AAGGAGGAGCTGGCCGGATGCTCGCCGAGGCGGATTACGCCGGGGAGCTCGTGCTGGAGGAGATCGCGGCCGCAGCGGCGGACGAGGGCGAGCTGAAGGAGACGTTCGCGGTGTTCGACGCCGACGGGGACGGGAGGATCTCCGCCG AGGAGCTCCGCGCCGTGCTCGCCTCGCTCGGCGACGAGCTCTGCTCCGTCGACGACTGCCGCCGCATGATCGGCGGCGTGGACACCGACGGCGACGGGTTCGTCTGCTTCGACGAGTTCGCCCGCATGATGATGTGTGGCCGCGCGTGA

[0015] Compared with the prior art, the present invention has the following beneficial effects: This invention successfully constructed OE-OsCML36 transgenic rice plants and studied their resistance to rice sheath blight. The results showed that OE-OsCML36 transgenic rice plants exhibited a higher level of resistance compared to wild-type rice. This indicates that overexpression of the OsCML36 gene can improve rice resistance to sheath blight. This invention also found that OE-OsCML36 transgenic rice plants, compared to wild-type rice, increased the number of panicles, grain weight, grain length, and grain width, indicating that overexpression of the OsCML36 gene can alter agronomic traits in rice, improving rice quality and yield. The application of the OsCML36 gene in regulating rice sheath blight resistance and agronomic traits discovered in this invention is of great significance for elucidating the disease resistance mechanism of genes and cultivating highly resistant and high-quality rice plants. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0017] Figure 1 The structural map of the recombinant plasmid in Example 1; Figure 2 The results of colony PCR identification in Example 1; Figure 3 The image shows a gel electrophoresis diagram of the OE-OsCML36 transgenic rice plant in Example 1; where M is the marker, N is the negative control, and 1-5 are OE-OsCML36 transgenic rice plants. Figure 4 The results of disease resistance in OE-OsCML36 transgenic rice in Example 2 are shown below; where A represents the state of leaves and leaf sheaths of wild-type and OE-OsCML36 transgenic rice after inoculation with rice sheath blight pathogen; B represents the statistical results of leaf lesion area of ​​wild-type and OE-OsCML36 transgenic rice; C represents the relative expression level of OsCML36 gene in wild-type and OE-OsCML36 transgenic rice; D represents the results of Western blotting to identify the protein expression level of OE-OsCML36 rice, with flag-tags used to determine protein expression in different OE lines; asterisks indicate the significance of differences between different components (…). : p <0.05, : p <0.01, : p <0.001); Figure 5 The results of the comparison of agronomic traits between OE-OsCML36 transgenic rice and wild rice (WT) in Example 3 are shown below; where A represents the growth status of rice at 20 and 40 days of age, B represents the comparison of rice grain length and width, C represents the comparison of plant height, D represents the comparison of panicle number, E represents the comparison of 100-grain weight, F represents the comparison of grain length, and G represents the comparison of grain width; ns indicates no significant difference, and asterisks indicate the significance of differences between different components (…). : p <0.05, : p <0.01, : p <0.001). Detailed Implementation

[0018] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0019] Example 1: Obtaining and Identifying Transgenic Rice

[0020] 1. Constructing gene expression vectors

[0021] The coding sequence of OsCML36 (SEQ ID NO.1) was cloned into the pBWA(V)HS-3flag vector with a 35S promoter to obtain the recombinant plasmid pBWA(V)HS-riceCML36-3×flag-2. Figure 1 ).

[0022] 2. Agrobacterium-mediated transformation

[0023] The recombinant plasmid obtained above was introduced into rice Shennong 9816 via Agrobacterium tumefaciens GV3101 (Video, Shanghai, China) mediated transformation. The specific transformation method is as follows: (1) Take GV3101 competent cells that have been frozen at -80℃ and place them on ice to thaw for 30 min; (2) Add 5 µL of recombinant plasmid to 50 µL of GV3101 competent cells, mix gently with pipette tip, stand on ice for 5 min, freeze quickly in liquid nitrogen for 5 min, water bath at 37 ℃ for 5 min, and ice bath for 5 min. (3) Add 700 µL of liquid LB and place in a 28°C constant temperature incubator to shake and revive the cells; (4) The bacterial culture was centrifuged at 6000 rpm for 2 min to collect the bacterial cells. 80 µL of liquid LB was left and spread on a plate containing Rif+Kan (Rif: 50 mg / L and Kan: 100 mg / L). The plate was then placed in a constant temperature incubator at 28℃ for 48 h. (5) After the bacteria in the plate have grown to a certain size, pick the bacteria and transfer them to liquid LB containing Rif+Kan for 48 h of shaking. Then, identify them by colony PCR and 1% agarose gel electrophoresis. The total PCR reaction system is 20 μL, containing 1 μL of bacterial culture, 10 μL of 2×KeyPo Master Mix (Novozymes, China, No. PK511-01), 1 μL each of forward and reverse primers (10 μM), and 7 μL of dd-H2O. The reaction program is as follows: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 8 min. The primer sequences used are shown in SEQ ID NO.2 and SEQ ID NO.3. The identification results are as follows. Figure 2 As shown, positive Agrobacterium tumefaciens with pBWA(V)HS-riceCML36-3×flag-2 was obtained; F: AACACGGGGGACTTTGCAACatggcgtcttcgtcgtcatcgtc (SEQ ID NO.2) R: CCGTCGTGGTCTTTGTAATCgcagaggccggtctcgag (SEQ ID NO.3) (6) Positive Agrobacterium tumefaciens was introduced into the callus of Shennong 9816 and screened in a medium of hygromycin (Yisheng, Shanghai, China) at a concentration of 50 mg / L to finally obtain stable transformed rice plants.

[0024] 3. Identification

[0025] Rice DNA extraction was performed using the FastPure Plant DNA Isolation Mini Kit (Novozymes, No. DC104-01), as follows: 100 mg of rice sample was ground into powder, 400 μL of Buffer A1 and 4 μL of RNase A (10 mg / mL) were added, and the mixture was vortexed and incubated at 65°C for 10 min. 130 μL of Buffer A2 was added, and the mixture was incubated on ice for 5 min. The supernatant was collected by centrifugation. 1.5 times the amount of supernatant in Buffer A3 was added, and the mixture was mixed by pipetting and centrifugation at 12000 rpm for 60 s. 600 μL of Buffer AW was added, and the mixture was centrifuged at 12000 rpm for 60 s. The previous step was repeated once. 50 μL of preheated Elution Buffer was added, and the mixture was incubated at room temperature for 2 min. The mixture was then centrifuged at 12000 rpm for 2 min to obtain rice DNA.

[0026] Using the obtained transgenic rice DNA as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3. The total PCR reaction system was 20 μL, containing 1 μL DNA, 10 μL 2×KeyPo Master Mix (Novozymes, China, No. PK511-01), 1 μL each of forward and reverse primers (10 μM), and 7 μL dd-H2O. The reaction program was as follows: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 8 min.

[0027] Fragment size was identified by 1% agarose gel electrophoresis. The target bands were detected in tissues from five rice plants. The results showed that the target fragment in the transgenic rice was consistent with the theoretical results. The OsCML36 target band in the five transgenic rice plants was identified as 588 bp by 1% agarose gel electrophoresis. Figure 3 This indicates that OE-OsCML36 transgenic rice was successfully obtained.

[0028] Example 2: Identification of resistance in transgenic rice

[0029] PDA medium was spread using sterilized bark measuring 1 cm × 1 cm, followed by the introduction of rice sheath blight pathogens. R. soalni AG1-IA was inoculated into PDA medium covered with bark and cultured until the bark was covered with mycelium. When the rice entered the tillering stage, the medium covered with mycelium was used... R. solani Leaf sheaths and leaves of wild-type (Shennong 9816, WT) rice and OE-OsCML36 transgenic rice were inoculated with 1 cm × 1 cm bark. Leaf inoculation was observed 48 h after inoculation and leaf sheath inoculation was observed 7 dpi. Disease symptoms were photographed at 7 dpi for leaf sheath inoculation and at 48 hpi for leaf inoculation. The leaf area of ​​diseased leaves was measured using Image Pro Plus. This experiment evaluated three independent T0 generation transgenic lines, totaling five plants. Plant protein extraction, concentration determination, relative gene expression level determination, and immunoblotting analysis were performed. The steps are as follows: 1. Extraction of plant protein After sampling the rice, it was thoroughly ground in liquid nitrogen using a pestle. Proteins were then extracted from the plant samples using RIPA plant lysis buffer (Shanghai, China). The specific operational steps are as follows: (1) Add 10 µL of phenylmethanesulfonyl fluoride (PMSF) a few minutes before using RIPA lysis buffer to make the final concentration of PMSF 1 mM; (2) Grind the sample into powder in a mortar, take 50 mg of powdered sample and mix with 1 mL of extraction buffer containing 1 mM PMSF, vortex immediately to fully dissolve the sample; (3) Place the mixed sample in ice for 20 minutes, vortexing it once every 5 minutes; (4) In Centrifuge at 12000 rpm for 20 min at C, and collect the supernatant as crude protein extract.

[0030] 2. Detection of soluble protein concentration

[0031] The concentration of soluble protein was determined using the Braford Protein Assay Kit (Shanghai, China). The specific procedure is as follows: (1) Prepare protein standard solutions with concentrations of 0 mg / mL, 0.125 mg / mL, 0.25 mg / mL, 0.5 mg / mL, 0.75 mg / mL, 1 mg / mL and 1.5 mg / mL before determining the protein concentration; (2) Add 5 µL of protein standard solutions of different concentrations to a 96-well enzyme-free plate; (3) Take 5 µL of different samples and add them to a 96-well plate; (4) Add 250 µL of G250 staining solution to each well in sequence and react at 28°C in the dark for 10 min; (5) Measure the absorbance of each sample at A595 using an ELISA reader; (6) Obtain the standard curve based on the measured absorbance and calculate the protein concentration of each sample.

[0032] 3. Determination of relative gene expression levels

[0033] Rice RNA was extracted using Trizol reagent (Invitrogen, NO. 15596026), and the specific extraction method is as follows: (1) Weigh 100 mg of leaf tissue, transfer the sample that has been thoroughly ground with liquid nitrogen to a 1.5 mL pre-cooled clean centrifuge tube, quickly add 1 mL of Trizol in a chemical fume hood, vortex rapidly to disperse the sample, and then place it at room temperature for 5 min. (2) Add 200µL of chloroform, immediately invert for 15s, and let stand at room temperature for 3min; (3) Centrifuge at 12000 rpm for 15 min at 4℃; (4) After centrifugation, the sample forms a three-phase aqueous system. The uppermost aqueous phase contains RNA. Carefully transfer 500µL of the upper aqueous phase to a 1.5mL centrifuge tube and add an equal volume of isopropanol. Vortex and mix thoroughly, then let stand at room temperature for 10min. (5) Centrifuge at 4℃ and 12000 rpm for 10 min; (6) Discard the supernatant, add 1 mL of 75% ethanol, vortex to mix, and centrifuge at 7500 rpm for 5 min at 4°C. (7) Discard the supernatant, place the centrifuge tube on sterile absorbent paper to fully absorb the waste liquid, and air dry for 15 minutes; (8) Resuspend the RNA pellet in 30 µL ddH2O and place on ice for 20 min to fully dissolve the RNA. Reverse transcription of the extracted total RNA was performed using the HiScript III RT SurperMix for qPCR kit (Vazyme, Nanjing, China). The specific procedure was as follows: For each RNA sample concentration, add 4 µL of 4×gDNA wiper Mix and RNase-free ddH2O to a volume of 16 µL, gently mix with a pipette, and incubate at 42°C for 2 min; add 4 µL of 5×HiScript III qRTSurperMix, gently mix with a pipette, and incubate at 37°C for 15 min, then at 85°C for 5 sec. Real-time quantitative PCR (qRT-PCR) was performed using the Q711 real-time quantitative PCR system (Vazyme Biotechnology, Nanjing, China).

[0034] The quantitative PCR reaction system consisted of 20 μL, containing 1 μL of reverse transcription product, 10 μL of ChamQ Universal SYBRqRCR Master Mix, 0.4 μL of each primer (10 μM), and 8.2 μL of dd-H2O. The reaction conditions included three steps (Step 1: Reps1 95℃ 30 s; Step 2: Reps40 95℃ 10 s, 60℃ 30 s; Step 3: Reps1 95℃ 15 s, 60℃ 60 s, 95℃ 15 s). Primers were designed using Primer Premier 5. The forward primer is shown in SEQ ID NO.4, and the reverse primer is shown in SEQ ID NO.5. Forward primer: AGGAGAACAAGGTGAGCAGC Reverse primer: CGAACGTCTCCTTCAGCTCG 4. Immunoblot analysis Proteins were detected by electrophoresis on a sodium dodecyl sulfate-polyacrylamide gel. Denaturation was required before detection, as follows: 150 μg of protein was added to a specific ratio of 5× non-denaturing staining solution (Beyotime, Shanghai, China), and denatured in boiling water at 95℃ for 10 min, then placed on ice. The 5× SDS electrophoresis buffer was prepared with the following reagents: 15.1 g Tris-HCl (pH 6.8), 94 g glycine, and 5 g SDS. Distilled water was added to bring the volume to 1000 mL, resulting in a final working concentration of 1×.

[0035] For protein gel preparation, a one-step PAGE gel rapid preparation kit (Omni-Easy™-PG213, Shanghai Yamei Biomedical Technology Co., Ltd.) was used. The specific procedures are as follows (two 1.0 mm gels were prepared simultaneously, thus doubling the volume): (1) Take equal volumes of 5.4 mL of the lower layer gel solution and the lower layer gel buffer solution, and add 120 µL of modified coagulant at the same time, and mix well; (2) Quickly add the mixed lower layer of adhesive to the glass plate until the distance between the liquid surface and the upper edge of the glass plate is 0.5cm, then stop adding the lower layer of adhesive liquid and cover the lower layer of adhesive with water. (3) After 15 minutes, pour off the top layer of water; (4) Take equal volumes of 1.5 mL of upper layer gel solution and colored upper layer gel buffer solution, add 30 µL of modified coagulant, and mix well; (5) Quickly add the contents to the glass plate, insert the comb, and wait 15 minutes before removing the comb to proceed with electrophoresis.

[0036] Add a measured amount of protein to the wells of the protein gel, including 7 μL of marker. For empty wells, add 10 mL of 1×Cracking Buffer. When adding the sample, be careful to remove air bubbles and impurities from the wells to avoid affecting the experiment. Electrophoresis conditions are a constant voltage of 200 V, a current of approximately 85 mA, and an electrophoresis time of approximately 30 min.

[0037] The protein gel was transferred using a wet transfer method, with the following procedures: The protein gel was gently removed from the glass plate using a skid. A PVDF membrane (Great White Shark, Beijing, China) suitable for the protein gel was pre-cut and immersed in methanol with shaking for 1 min. It was then transferred to 1× Transfer Buffer (prepared with 12.11 g Tris hydrochloride, 57.6 g glycine, and 3.2 L distilled water to a final concentration of 20% methanol). The membrane was placed in the transfer apparatus, followed by the gel, ensuring the gel corresponds to black and the membrane to white. Transfer was performed at a constant voltage of 60 V for 100 min. An ice pack was placed in the machine during the transfer process to prevent transfer failure due to excessive voltage. Simultaneously, another piece of protein gel was stained with Coomassie Brilliant Blue staining solution, ensuring the staining solution fully covered the gel. The gel was then placed on a horizontal shaker and slowly shaken for 1 h. The staining solution was recovered, and the gel was then destained in distilled water sufficient to cover the gel for 12 h, continuously changing the destaining solution until the blue background disappeared.

[0038] The membrane was blocked and reacted with the antibody as follows: After transfer, the membrane was removed and placed in a container with Western blotting buffer. It was then slowly incubated on a shaker for 60 min. The blocked membrane was then transferred to a shaker containing primary antibody (GFP antibody) (Beyotime, Shanghai, China) and incubated for 120 min. 1×TTBS was added, and the membrane was washed for 10 min after primary antibody incubation. This washing was repeated once. The membrane was then transferred to a dilution buffer containing secondary antibody (HRP-labeled mouse antibodies) (Beyotime, Shanghai, China) and incubated for 45 min. After incubation, the membrane was washed with 1×TTBS for 10 min. This washing was repeated three times. Finally, the membrane was developed in ECL (Beyotime, Shanghai, China) chromogenic buffer for 2 min, and the results were observed.

[0039] The results are as follows Figure 4 As shown, the leaves and leaf sheaths of OE-OsCML36 transgenic rice exhibit higher resistance levels than the wild type. Figure 4 (A). The area of ​​leaf lesions in rice was 0.178% lower than that of the wild type. Figure 4 (B); The relative expression level of the rice OsCML36 gene in OE-OsCML36 transgenic rice plants was significantly higher than that in wild-type plants (B). Figure 4 The results (C) indicate that when rice is attacked by R. solani strain, the transcription level of calmodulin OsCML36, a calmodulin protein in the "plant-pathogen interaction" pathway, increases sharply. Western blot results show that protein expression in OE-OsCML36 plants was detected using Flag antibody, and a protein fragment of 22.9 kDa was detected, which is consistent with the expected results.

[0040] Example 3: Determination of agronomic traits in transgenic rice

[0041] This example compares the agronomic traits (plant height, panicle number, grain weight, grain length, and grain width) of OE-OsCML36 transgenic rice with those of wild rice (Shennong 9816, WT). The results are as follows: Figure 5 As shown, compared with WT, there was no significant difference in the growth of 20-day-old and 40-day-old OE-OsCML36 transgenic rice plants. Figure 5 (Image A, where the top image shows 20-day-old rice plants and the bottom image shows 40-day-old rice plants); the plant height of OE-OsCML36 transgenic rice ranges from 65.4 cm to 82.5 cm, with an average of around 70 cm.) Figure 5 The average number of panicles in OE-OsCML36 transgenic rice was 9.7, significantly higher than that in WT (6.7). Figure 5 The 100-grain weight of OE-OsCML36 transgenic rice increased by 0.14 g compared to the WT (D); Figure 5 In the medium E region, the average kernel length and average kernel width increased by 0.47 cm and 0.23 cm respectively compared to the WT region. Figure 5 (B, F, G). It can be seen that the rice OsCML36 gene has a positive regulatory effect on the growth and development of rice plants and can significantly change the agronomic traits of rice.

[0042] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of overexpression of the rice OsCML36 gene, characterized in that, The application is any one of the following: (1) Improve rice's resistance to sheath blight; (2) Change the agronomic traits of rice; (3) Develop transgenic rice with strong resistance to sheath blight; (4) Cultivating transgenic rice with altered agronomic traits; The nucleotide sequence of the rice OsCML36 gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The changes in agronomic traits of rice refer to increasing the number of panicles, grain weight, grain length, or grain width of rice plants. The agronomical traits are changed by increasing the number of ears, grain weight, grain length, or grain width.

3. A method for improving resistance to rice sheath blight, characterized in that, Overexpression of the rice OsCML36 gene in rice plants enhances rice resistance to sheath blight; the nucleotide sequence of the rice OsCML36 gene is shown in SEQ ID NO.

1.

4. A method for altering agronomic traits of rice, characterized in that, Overexpression of the rice OsCML36 gene in rice plants can increase the number of panicles, grain weight, grain length, or grain width of rice plants; the nucleotide sequence of the rice OsCML36 gene is shown in SEQ ID NO.

1.

5. A method for breeding transgenic rice with strong resistance to sheath blight, characterized in that, The rice OsCML36 gene was overexpressed in rice plants to obtain transgenic rice with strong resistance to sheath blight; the nucleotide sequence of the rice OsCML36 gene is shown in SEQ ID NO.

1.

6. A method for cultivating transgenic rice with altered agronomic traits, characterized in that, The rice OsCML36 gene is overexpressed in rice plants to obtain transgenic rice with increased panicle number, grain weight, grain length, or grain width; the nucleotide sequence of the rice OsCML36 gene is shown in SEQ ID NO.

1.

7. A type of rice with enhanced resistance to sheath blight, characterized in that, It contains the rice OsCML36 gene as shown in SEQ ID NO.

1.

8. A type of rice seed with enhanced resistance to sheath blight, characterized in that, It contains the rice OsCML36 gene as shown in SEQ ID NO.

1.

9. A type of rice with altered agronomic traits, characterized in that, Contains the rice OsCML36 gene as shown in SEQ ID NO.1; the agronomical trait change is an increase in panicle number, grain weight, grain length, or grain width.

10. A rice seed with altered agronomic traits, characterized in that, Contains the rice OsCML36 gene as shown in SEQ ID NO.1; the agronomical trait change is an increase in panicle number, grain weight, grain length, or grain width.

Images