High-yield extracellular polysaccharide leavening agent and application thereof

By optimizing the mixed starter culture of Streptococcus salivarius subsp. thermophilus and Lactobacillus delbrueckii subsp. lactis, the problems of unstable viable cell count and low extracellular polysaccharide yield in direct-inoculation starter cultures were solved, resulting in yogurt with high extracellular polysaccharide production, excellent texture and flavor, and avoiding the need for additional additives.

CN121930969APending Publication Date: 2026-04-28TIBET ANGEL ZHUFENG BIOTECHNOLOGY CO LTD +1
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202511931615.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-19
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

The number of live bacteria in the existing direct-inoculation starter culture is unstable, the strains are not clearly defined, and the production of extracellular polysaccharides is low, resulting in poor texture and taste of yogurt. Stabilizers and flavorings need to be added to improve this.

Method used

A high-yield direct-inoculation starter culture for fermenting dairy products was prepared by using a mixed starter culture of *Streptococcus salivarius* subsp. *thermophilus* Jiacha.ST-685 and *Lactobacillus delbrueckii* subsp. *Dangxiong* LBⅧ through optimized activation, fermentation, and drying processes.

Benefits of technology

Fermented dairy products are high in extracellular polysaccharides, possess excellent viscosity and stringiness, require no added stabilizers, have a rich flavor with a fresh fruity aroma, a fast fermentation rate, and a stable texture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The invention belongs to the field of fermentation, and particularly relates to a leavening agent for high-yield exopolysaccharide and application of the leavening agent. The leavening agent comprises streptococcus salivarius subsp. Thermophilus powder and lactobacillus delbrueckii subsp. Lactis powder, and the viable count ratio of the streptococcus salivarius subsp. Thermophilus to the lactobacillus delbrueckii subsp. Lactis is (1-12): (1-5). The invention provides a direct vat set milk-based leavening agent, the leavening agent mainly comprises streptococcus salivarius subsp. Thermophilus Jiacha.ST-685 bacterial powder and lactobacillus delbrueckii subsp. Lactis Dangxiong LB VIII bacterial powder, when the leavening agent is used for preparing a fermented dairy product, the fermented dairy product can generate 600-700 [mu] g / ml of extracellular polysaccharide, and under the condition that no stabilizer or essence is added, the fermentation time is shortened, and the yield of the fermented dairy product is increased. The fermented dairy product has excellent viscosity and wire drawing property, and also has good texture performance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of fermentation, specifically relating to a fermentation agent that produces high levels of extracellular polysaccharides and its applications. Background Technology

[0002] Direct-inoculation starter cultures are high-concentration freeze-dried bacterial powders obtained through freeze-drying. They can be directly added to raw milk for fermentation without activation or large-scale cultivation. Direct-inoculation starter cultures offer advantages such as high activity, low dosage, long shelf life, and effective reduction of bacterial contamination and degeneration. They are suitable for industrial production. Furthermore, using direct-inoculation starter cultures to prepare yogurt is more convenient and produces more stable quality yogurt.

[0003] Chinese patent application CN 117736930 A discloses a direct-inoculation yogurt starter and its preparation method: The invention provides a direct-inoculation yogurt starter and its preparation method, wherein the fermentation strains are composed of Lactococcus lactis, Lactobacillus fermentum and Lactobacillus delbrueckii. However, the starter involves many strains, and the contribution of these strains to the formation of fermentation flavor and the acid production mechanism are unclear, and there are batch-to-batch control differences.

[0004] Chinese patent application CN 117448229 A discloses a direct-inoculation yogurt starter and its preparation method. The starter of this invention includes Lactococcus lactis subsp. lactis HFY14 and Lactobacillus acidophilus LA3. However, the fermentation time using this starter is relatively long, 7-15 hours, which does not meet the time requirements for industrial yogurt production. Summary of the Invention

[0005] The problem with the existing technology is: (1) There are many problems with the direct-inoculation fermentation agent in the prior art, such as the unstable number of live bacteria in the bacterial powder and the unclear properties of the bacterial species.

[0006] (2) When preparing yogurt using direct-inoculation starter in the prior art, the bacteria used for yogurt fermentation have a poor ability to produce extracellular polysaccharide (EPS) and a low content of flavor substances. This results in poor texture properties such as viscosity and taste of the final yogurt. In the prior art, it is usually necessary to add additional ingredients such as stabilizers and flavorings to solve the problem that relying solely on bacterial fermentation is insufficient to achieve the ideal texture and taste.

[0007] To address the aforementioned problems in the existing technology, this invention provides a fermentation agent for producing extracellular polysaccharides and its application, the specific technical solution of which is as follows: Technical Solution 1: A fermentation agent for producing extracellular polysaccharides, characterized in that it comprises powder of *Streptococcus thermophilus* subsp. *salivarius* and powder of *Lactobacillus delbrueckii* subsp. *lactamella*, wherein the ratio of viable counts of *Streptococcus thermophilus* subsp. *salivarius* and *Lactobacillus delbrueckii* subsp. *lactamella* is 1-12:1-5.

[0008] Technical Solution 2: The fermenting agent according to Technical Solution 1 is characterized in that the ratio of viable bacteria of Streptococcus salivarius subsp. thermophilus and Lactobacillus delbrueckii subsp. lactis is 5-12:1-5.

[0009] Technical Solution 3: The fermenting agent according to Technical Solution 1 or 2, characterized in that the viable count of the *Streptococcus thermophilus* subsp. *salivarius* powder is 1 × 10⁻⁶. 10 -2×10 10 CFU / g, and / or the viable count of the *Lactobacillus delbrueckii* subsp. *lactotrichum* powder is 2.5 × 10⁻⁶. 10 -3.5×10 10 CFU / g.

[0010] Technical Solution 4: The fermenting agent according to any one of Technical Solutions 1-3, characterized in that the *Streptococcus salivarius* subsp. *thermophilus* is *Streptococcus salivarius* subsp. *thermophilus* Jiacha.ST-685, with accession number CCTCC NO: M 20231495, and / or the *Lactobacillus delbrueckii* subsp. *delbrueckii* is *Lactobacillus delbrueckii* Dangxiong LBⅧ, with accession number CCTCC NO: M2023396. Preferably, the *Streptococcus salivarius* subspecies *Jiacha.ST-685* carries a gene associated with high extracellular polysaccharide production, wherein the gene associated with high extracellular polysaccharide production includes one or more of the gene sequences shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3. More preferably, the genes associated with high production of extracellular polysaccharides include gene sequences as shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.

[0011] Technical Solution 5: The fermenting agent according to any one of Technical Solutions 1-4, characterized in that the *Streptococcus thermophilus* subsp. powder is prepared by a method comprising the following steps: inoculating *Streptococcus thermophilus* subsp. into a liquid culture medium for activation culture and fermentation culture to obtain *Streptococcus thermophilus* subsp. fermentation broth; then, performing solid-liquid separation and drying of the *Streptococcus thermophilus* subsp. fermentation broth to obtain *Streptococcus thermophilus* subsp. powder. The preparation method of Lactobacillus delbrueckii subsp. lactis powder includes the following steps: Lactobacillus delbrueckii subsp. lactis is inoculated into a liquid culture medium for activation culture and fermentation culture to obtain Lactobacillus delbrueckii subsp. lactis fermentation broth, and then the Lactobacillus delbrueckii subsp. lactis fermentation broth is subjected to solid-liquid separation and drying to obtain Lactobacillus delbrueckii subsp. lactis powder.

[0012] Technical Solution 6: The fermenting agent according to any one of Technical Solutions 1-5, characterized in that the pH value of the liquid culture medium is 6.1-6.5, wherein, based on the total mass of the liquid culture medium, the liquid culture medium comprises: 1-4 wt% glucose, 0.5-3 wt% peptone, 0.5-2 wt% beef extract, 1.3-3.7 wt% yeast extract, 0.2-0.6 wt% anhydrous sodium acetate, 0.1-0.4 wt% ammonium dihydrogen phosphate, 0.005-0.02 wt% magnesium sulfate heptahydrate, 0.001-0.01 wt% manganese sulfate, 0.05-0.25 wt% Tween 80, 0.4-1.2 wt% sodium carbonate, and the remainder is water. Preferably, the yeast extract is one or a combination of yeast extract FM902 and yeast extract FM503. More preferably, when the yeast extract is a combination of yeast extract FM902 and yeast extract FM503, the yeast extract FM902 is 1.0-2.0 wt% and the yeast extract FM503 is 0.3-1.7 wt%. Preferably, the starter culture is a direct-inoculation starter culture, which is used for fermenting dairy products.

[0013] Technical Solution 7: A method for preparing a starter culture according to any one of technical solutions 1-6, characterized in that it includes the following steps: mixing Streptococcus thermophilus subsp. powder and Lactobacillus delbrueckii subsp. lactis powder to obtain a starter culture, wherein the ratio of viable counts of Streptococcus thermophilus subsp. and Lactobacillus delbrueckii subsp. lactis is 1-12:1-5.

[0014] Technical Solution 8: According to the preparation method described in Technical Solution 7, the preparation method of the Streptococcus salivarius thermophilic subsp. powder includes the following steps: (1) Preparation of seed culture: *Streptococcus salivarius* subsp. *thermophilus* was inoculated into liquid culture medium for activation culture to obtain *Streptococcus salivarius* subsp. *thermophilus* seed culture. (2) Preparation of fermentation broth: The seed culture of *Streptococcus salivarius* subsp. *thermophilus* obtained in step (1) is inoculated into a liquid culture medium for fermentation culture to obtain fermentation broth of *Streptococcus salivarius* subsp. *thermophilus*. Preferably, the inoculum amount is 5-15%. (3) Preparation of bacterial sludge: After solid-liquid separation of the fermentation broth of *Streptococcus thermophilus* obtained in step (2), the bacterial precipitate is retained to obtain *Streptococcus thermophilus* bacterial sludge. (4) Preparation of bacterial powder: The *Streptococcus thermophilus* subsp. *sauristatin* bacterial sludge obtained in step (3) is mixed with a freeze-drying protectant at a mass ratio of 1-3:2-1 and then dried to obtain *Streptococcus thermophilus* bacterial powder. Preferably, the freeze-drying protectant comprises, by weight of total ...

[0015] Technical Solution 9: The preparation method according to Technical Solution 7 or 8, characterized in that the preparation method of the Lactobacillus delbrueckii subsp. lactis powder includes the following steps: (1) Preparation of seed culture: Lactobacillus delbrueckii subsp. lactis was inoculated into liquid culture medium for activation culture to obtain Lactobacillus delbrueckii subsp. lactis seed culture. (2) Preparation of fermentation broth: The Lactobacillus delbrueckii seed culture obtained in step (1) was inoculated into a liquid culture medium for fermentation culture to obtain Lactobacillus delbrueckii subsp. lactis fermentation broth. (3) Preparation of bacterial sludge: After solid-liquid separation of the fermentation broth of *Lactobacillus delbrueckii* obtained in step (2), the bacterial precipitate is retained to obtain *Lactobacillus delbrueckii* bacterial sludge. (4) Preparation of bacterial powder: The *Lactobacillus delbrueckii* subsp. *lactamella* bacterial sludge obtained in step (3) is mixed with a freeze-drying protectant at a mass ratio of 1-3:2-1 and then dried to obtain *Lactobacillus delbrueckii* subsp. *lactamella* bacterial powder. Preferably, the freeze-drying protectant comprises, by weight of total weight of the freeze-drying protectant: 10-30 wt% skim milk powder, 7-13 wt% maltodextrin, 3-5 wt% yeast extract, with the remainder being water.

[0016] Technical Solution 10: The preparation method according to any one of Technical Solutions 7-9, characterized in that the sterilization temperature of the freeze-drying protectant is 75-85℃ and / or the sterilization time is 25-45min.

[0017] Technical Solution 11: The preparation method according to any one of Technical Solutions 7-10, characterized in that the inoculum amount of the activation culture is 2-5%, and / or the inoculum amount of the fermentation culture is 7-13%.

[0018] Technical Solution 12: The preparation method according to any one of Technical Solutions 7-11, characterized in that the activation culture includes a first activation culture and a second activation culture, wherein the temperature of the first activation culture is 35-45℃ and / or the activation culture time is 20-36h, and the temperature of the second activation culture is 35-45℃ and / or the activation culture time is 10-18h.

[0019] Technical Solution 13: The preparation method according to any one of Technical Solutions 7-12, characterized in that the fermentation temperature is 35-45℃ and / or the fermentation time is 20-36h.

[0020] Technical Solution 14: The preparation method according to any one of Technical Solutions 7-13, characterized in that the drying method is vacuum freeze-drying, wherein the vacuum freeze-drying includes pre-freezing, primary drying, and secondary drying, wherein the pre-freezing temperature is -45 to -35°C and the pre-freezing time is 3-6 hours. The drying process consists of a first drying stage and a second drying stage. The first drying stage is conducted at a temperature of -25℃ to -15℃ for 15-20 hours at a pressure of 10-15 MPa. The second drying stage is conducted at a temperature of -15℃ to -5℃ for 10-14 hours at a pressure of 8-12 MPa. The secondary drying temperature is -35 to -25℃, the time is 2-6 hours, and the pressure is 3-7 MPa.

[0021] Technical Solution 15: The preparation method according to any one of technical solutions 7-14 is characterized in that it further includes pre-freezing before drying, wherein the pre-freezing temperature is -45 to -35°C and / or the pre-freezing time is 12-24h.

[0022] Technical Solution 16: The preparation method according to any one of Technical Solutions 7-15 is characterized in that the solid-liquid separation is performed by centrifugation, wherein the centrifugation speed is 4500-5500×g and / or the centrifugation temperature is 2-6℃ and / or the centrifugation time is 8-12min.

[0023] Technical Solution 17: A fermented dairy product, characterized in that it is prepared by the following steps: mixing a starter culture obtained by any one of Technical Solutions 1-6 or by any one of Technical Solutions 7-16 with a fermentation substrate to obtain a mixture, fermenting the mixture to obtain a fermented dairy product, wherein, before fermentation, the initial viable count in each mL of the mixture is 0.1-5 × 10⁻⁶. 7 CFU; wherein the fermentation substrate includes one or a combination of raw milk and milk powder. The fermented dairy product contains 600.0-700.0 μg / mL of extracellular polysaccharides.

[0024] Technical Solution 18: The fermented dairy product according to Technical Solution 17, characterized in that the flavor substances in the fermented dairy product include one or more substances selected from the group consisting of nonanal, peachal, 2-phenylacetaldehyde, 2-heptanone, 2-nonanone, 2,3-pentanedione, 3-hydroxy-2-butanone, 2-undecanedione, methylbenzyl alcohol, n-butyric acid, n-hexanoic acid, octanoic acid, isovaleric acid, phenethyl acetate, and butyl acetate. Preferably, in the fermented dairy product, the OVA value of nonanal is 25.5-27.3, and / or the OVA value of peach aldehyde is 0.7-0.9, and / or the OVA value of 2-phenylacetaldehyde is 0.75-0.79, and / or the OVA value of 2-heptanone is 2.6-2.9, and / or the OVA value of 2-nonanone is 16.5-17.3, and / or the OVA value of 2,3-pentanedione is 1.7-2.7, and / or the OVA value of 3-hydroxy-2-butanone is 1.2-2.8, and / or... Or the OVA value of 2-undecanoate is 1.5-1.7, and / or the OVA value of methylbenzyl alcohol is 3.2-4.3, and / or the OVA value of butyric acid is 0.3-0.4, and / or the OVA value of hexanoic acid is 20.1-22.4, and / or the OVA value of octanoic acid is 0.11-0.18, and / or the OVA value of isovaleric acid is 14.1-15.2, and / or the OVA value of phenethyl acetate is 0.35-0.45, and / or the OVA value of butyl acetate is 0.14-0.3. Preferably, the extracellular polysaccharide content in the fermented dairy product is 609.0-700.0 μg / mL; Preferably, the viscosity of the fermented dairy product is 4200-5100 mPa·s; Preferably, the raw milk includes one or more substances selected from the group consisting of raw cow's milk, raw sheep's milk, and raw camel's milk. Preferably, the milk powder includes one or more types of whole milk powder and skim milk powder.

[0025] Technical Solution 19: The fermented dairy product according to Technical Solution 17 or 18, characterized in that it further contains protein powder, sweetener, and light cream. Preferably, the fermentation substrate comprises 4.0-6.0 wt% protein powder, 4.0-6.0 wt% sweetener, and / or 0.1-1.0 wt% light cream, based on 45-55 wt% of the total weight of the fermentation substrate.

[0026] Technical Solution 20: The fermented dairy product according to any one of Technical Solutions 17-19, characterized in that the protein powder comprises one or more substances selected from the group consisting of whey protein powder, milk protein powder and casein powder, preferably, the protein powder is whey protein powder, more preferably, the protein content is 20-50%; And / or the aforementioned light cream, preferably, having a fat content of 30-36%.

[0027] Technical Solution 21: The fermented dairy product according to any one of Technical Solutions 17-20, characterized in that the sweetener comprises one or more substances selected from the group consisting of white sugar, glucose, fructose, erythritol, maltitol, steviol glycosides, sucralose, xylitol, mogrosides, sorbitol, and mannitol. Preferably, the sweetener is white sugar.

[0028] Technical Solution 22: A method for preparing a fermented dairy product according to any one of technical solutions 17-21, characterized in that it includes the following steps: mixing the starter culture and the fermentation substrate to obtain a mixture, fermenting the mixture to obtain a fermented dairy product, wherein, before fermentation, the initial viable count in each mL of the mixture is 0.1-5 × 10⁻⁶. 7 CFU, preferably, has an initial viable count of 4-5 × 10⁻⁵. 7 CFU; wherein the fermentation substrate includes one or a combination of raw milk and milk powder.

[0029] Technical Solution 23: The preparation method according to Technical Solution 22 is characterized in that, when the fermentation substrate is raw milk, it includes the following steps: (1) Based on 45-55 wt% of the total weight of raw milk, add 4.0-6.0 wt% protein powder, 4.0-6.0 wt% sweetener, and 0.1-1.0 wt% light cream to the raw milk, mix, homogenize, sterilize, and cool to obtain a mixture. (2) The mixture obtained in step (1) is mixed with the direct-inoculation yogurt starter to obtain a mixture. The mixture is fermented until the acidity is terminated to obtain a fermented dairy product.

[0030] Technical solution 24: The preparation method according to technical solution 22 or 23 is characterized in that, in step (1), before mixing, the raw milk is homogenized and heated to 60-65°C.

[0031] Technical Solution 25: The preparation method according to any one of Technical Solutions 22-24 is characterized in that the homogenization temperature is 60-65℃ and the homogenization pressure is 20-30MPa (of which the low pressure is 2-7MPa).

[0032] Technical Solution 26: The preparation method according to any one of Technical Solutions 22-25 is characterized in that, when the fermentation substrate is skim milk powder, it includes the following steps: mixing skim milk powder and water evenly, sterilizing and cooling to obtain a mixture, then mixing the mixture with the starter culture and fermenting until the termination acidity is reached to obtain a fermented dairy product.

[0033] Technical Solution 27: The preparation method according to any one of Technical Solutions 22-26 is characterized in that the weight ratio of skim milk powder and water is 10-30:90-70.

[0034] Technical Solution 28: The preparation method according to any one of Technical Solutions 22-27 is characterized in that the fermentation temperature is 40-45℃ and the termination acidity is 70-80°T.

[0035] Technical Solution 29: The preparation method according to any one of Technical Solutions 22-28 is characterized in that the mixing speed is 25-35 r / min and / or the mixing time is 15-30 min.

[0036] Technical solution 30: The preparation method according to any one of technical solutions 22-29, characterized in that the temperature is cooled to 40-45°C.

[0037] Technical Solution 31: The preparation method according to any one of Technical Solutions 22-30 is characterized in that the sterilization temperature is 90-100℃ and / or the sterilization time is 120-350S.

[0038] Technical Solution 32: A fermented dairy product prepared according to any one of Technical Solutions 17-21 or any one of Technical Solutions 22-31 by any one of the preparation methods, characterized in that the fermented dairy product includes yogurt or lactic acid bacteria beverage, preferably, the fermented dairy product is yogurt, more preferably, the type of yogurt includes: low-temperature yogurt, stirred yogurt, set yogurt or drinkable yogurt.

[0039] Technical Solution 33: The application of the starter culture obtained by any one of Technical Solutions 1-6 or the preparation method of any one of Technical Solutions 7-16 in the preparation of fermented dairy products. Preferably, the fermented dairy products include yogurt or lactic acid bacteria drinks. More preferably, the fermented dairy products are yogurt. More preferably, the type of yogurt includes one of the following: low-temperature yogurt, stirred yogurt, set yogurt or drinkable yogurt.

[0040] Beneficial effects of this invention: This invention provides a starter culture, which mainly comprises *Streptococcus thermophilus* subsp. Jiacha.ST-685 powder and *Lactobacillus delbrueckii* subsp. *Dangxiong* LB VⅢ powder. When using this starter culture to prepare fermented dairy products, the fermented dairy products can produce 600-700 μg / ml of extracellular polysaccharides, so that the fermented dairy products have excellent viscosity and stringiness, as well as good textural properties, without the addition of any stabilizers and flavorings.

[0041] Fermented dairy products prepared using the starter culture provided by this invention have a high content of fruit flavoring substances such as peach aldehyde and 2-phenylacetaldehyde, which allows them to present a fresh fruit flavor without the need for additional fruit juice, jam or flavoring.

[0042] In the process of preparing fermented dairy products using the starter culture provided by this invention, the acidity can reach 70°T within 5.5 hours, exhibiting an excellent fermentation rate. Simultaneously, the fermented dairy products have a low post-acidification rate, allowing them to maintain excellent texture and naturally fermented flavor characteristics throughout their shelf life. Attached Figure Description

[0043] Figure 1 The results are shown in the figure, which represents the classification and content percentage of volatile flavor compounds.

[0044] Figure 2 The graph shows the volatile flavor compounds of different aroma types and their percentage content.

[0045] Information on microbial strains The *Lactobacillus delbrueckii* subsp. *lactamella* used in the embodiments of this invention ( Lactobacillus delbrueckii subsp. Lactis Dangxiong LBⅧ, deposited on March 23, 2023 at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M 2023396, address: Wuhan University, Wuhan, China, postcode: 430072; telephone: (027)-68754052. This strain has been described in Chinese patent application publication number CN116948884A.

[0046] The thermophilic subsp. salivarius used in the embodiments of this invention ( Streptococcus salivarius subsp. thermophilus Jiacha.ST-685 strain was deposited at the China Center for Type Culture Collection (CCTCC) on August 17, 2023, with accession number CCTCC NO: M 20231495. The depositary address is: Wuhan University, Wuhan, China, Postcode: 430072; Telephone: (027)-68754052. This strain has been described in Chinese patent application with publication number CN118872730A.

[0047] The comparative examples used in this invention Streptococcus salivarius ( subsp. thermophilus Streptococcus salivarius ) 932The strain was deposited on June 5, 2023, at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M 2023902, address: Wuhan University, Wuhan, China, postcode: 430072; telephone: (027)-68754052. This strain has been described in Chinese patent application publication number CN117179054A.

[0048] The comparative examples of this invention used *Lactococcus lactis* subsp. *lactosporum* (Lactococcus lactis) subsp. thermophilus Lactococcus lactis subsp. Strain 954 was deposited on June 5, 2023, at the China Center for Type Culture Collection (CCTCC), accession number CCTCCNO: M 2023904, address: Wuhan University, Wuhan, China, postcode: 430072; telephone: (027)-68754052. This strain has been described in Chinese patent application with publication number CN117179054A. Detailed Implementation

[0049] To address the problems existing in the prior art, this invention provides a direct-inoculation starter culture with high extracellular polysaccharide production. This starter culture is primarily prepared using a fruit-aroma-producing lactic acid bacteria strain independently developed and screened from the Qinghai-Tibet Plateau: *Lactobacillus delbrueckii* subsp. *Dangxiong* LB VⅢ and *Streptococcus salivarius* subsp. *thermophilicus* with genes related to high extracellular polysaccharide production. Fermented dairy products prepared using this direct-inoculation starter culture exhibit high viscosity and stringy properties, and the fermented dairy products achieve textural stability without the need for additional stabilizers. Furthermore, fermented dairy products rich in natural fermented fruit aromas can be prepared without the addition of food industry flavorings, resulting in a unique and refreshing taste, ensuring excellent product stability and flavor.

[0050] It should be noted that the high-yield extracellular polysaccharide refers to the high content of extracellular polysaccharides in dairy products obtained by fermentation with this direct-inoculation starter culture. Specifically, the extracellular polysaccharide content in the fermented dairy products is as high as 600.0-700.0 μg / mL.

[0051] To better understand the above technical solutions, the technical solutions of the present invention will be clearly and completely explained below in conjunction with specific embodiments. It should be noted that the content of the specific embodiments is only a specific implementation and explanation of the technical solutions of the present invention, and should not be construed as a limitation on the scope of protection of the present invention.

[0052] In some specific embodiments, the present invention provides a direct-inoculation fermentation agent comprising Streptococcus thermophilus subsp. powder and Lactobacillus delbrueckii subsp. lactis powder, wherein the live count ratio of Streptococcus thermophilus subsp. and Lactobacillus delbrueckii subsp. lactis is 1-12:1-5.

[0053] Preferably, in some specific embodiments, the live count ratio of *Streptococcus thermophilus* subsp. *salivarius* to *Lactobacillus delbrueckii* subsp. *lactamella* can be 11-12:1-2, 10-12:1-3, 9-12:1-4, 8-12:1-5, 6-12:1-5, 1-2:1-5, 1-3:1-5, 1-4:1-5, 1-5:1-5, 1-6:1-5, 1-7:1-5, 1-8:1-5, 1-9:1-5, 1-10:1-5, 1-11:1-5, 1-12:1-5, or the live count ratio of *Streptococcus thermophilus* subsp. *salivarius* to *Lactobacillus delbrueckii* subsp. *lactamella* can be 12:1, 12:2, 12:3, 12:4, 12:5, 11:1, 11:2, 11:3, 11: 4, 11: 5, 10:1, 10: 2, 10:3, 10: 4, 10: 5, 9:1, 9: 2, 9:3, 9: 4, 9: 5, 8:1, 8: 2, 8:3, 8: 4, 8: 5, 7:1, 7: 2, 7:3, 7: 4, 7: 5, 6:1, 6: 2, 6:3, 6: 4, 6: 5, 5:1, 5:2, 5:3, 5: 4, 5: 5, 4:1, 4: 2, 4:3, 4: 4, 4: 5, 3:1, 3: 2, 3:3, 3: 4, 3: 5, 2:1, 2: 2, 2:3, 2:4, 2: 5, 1:1, 1: 2, 1:3, 1: 4 or 1: 5, or the ratio of viable counts of Streptococcus thermophilus subsp. and Lactobacillus delbrueckii subsp. lactis within a numerical range defined by any two of the above specific values ​​as endpoints.

[0054] In some specific embodiments, the *Streptococcus salivarius* subsp. *thermophilus* is *Streptococcus salivarius* Jiacha.ST-685, with accession number CCTCC NO: M 20231495, and / or the *Lactobacillus delbrueckii* subsp. *delbrueckii* is *Lactobacillus delbrueckii* Dangxiong LBⅧ, with accession number CCTCC NO: M2023396.

[0055] In some specific embodiments, the present invention provides a fermented dairy product prepared by the following steps: mixing the direct-inoculation starter culture and the fermentation substrate to obtain a mixture, fermenting the mixture to obtain the fermented dairy product, wherein, before fermentation, the initial viable count in each mL of the mixture is 0.1-5 × 10⁻⁶. 7 CFU; wherein the fermentation substrate includes one or a combination of raw milk and milk powder. The fermented dairy product contains 600.0-700.0 μg / mL of extracellular polysaccharides.

[0056] Preferably, in some specific embodiments, the extracellular polysaccharide content in the fermented dairy product may be 600.0 μg / mL, 605.0 μg / mL, 610.0 μg / mL, 615.0 μg / mL, 620.0 μg / mL, 625.0 μg / mL, 630.0 μg / mL, 635.0 μg / mL, 640.0 μg / mL, 645.0 μg / mL, or 650.0 μg / mL. The extracellular polysaccharide content in the fermented dairy product is 655.0 μg / mL, 660.0 μg / mL, 665.0 μg / mL, 670.0 μg / mL, 675.0 μg / mL, 680.0 μg / mL, 685.0 μg / mL, 690.0 μg / mL, 695.0 μg / mL, or 700.0 μg / mL, or contains a value within the range of any two of the above specific values ​​as endpoints.

[0057] In some specific embodiments, the raw materials used in preparing the liquid culture medium of the present invention include beef extract, peptone, and yeast extract. These substances primarily function as organic nitrogen sources in the culture medium, providing the necessary nitrogen for microbial growth during fermentation. Common organic nitrogen sources such as yeast extract and yeast peptone decompose in the culture medium, releasing amino acids and small peptides, which then become nitrogen sources required for microbial growth. In other words, when using yeast peptone and yeast extract as common organic nitrogen sources to prepare the culture medium, the present invention does not particularly limit their source; they can be commercially available or prepared using conventional methods. Beef extract, whether commercially available or prepared by conventional methods, with a total nitrogen content (based on solids) ≥ 13.0% and an alcohol-soluble nitrogen content (based on alcohol-soluble substances) ≥ 6.0%; peptone, whether commercially available or prepared by conventional methods, with a total nitrogen content ≥ 14.5% and an amino nitrogen content ≥ 2.5%, can be used in this invention; yeast extract, whether commercially available or prepared by conventional methods, with a total nitrogen content ≥ 9.0 wt% and an amino nitrogen content ≥ 3.0 wt%, can be used in this invention.

[0058] The trace elements contained in the yeast extract powder (model: FM902) used in the examples are as follows: vitamin B1 2-3 ppm, vitamin B2 41-24 ppm, vitamin B5 80-82 ppm, vitamin B6 10-12 ppm, vitamin B7 5-7 ppm, vitamin B9 24-26 ppm, vitamin B12 0.20-0.22 (ug / 100g), choline 3015.0-3016.0 ppm, inositol 2015.0-2016.0 ppm, and niacin 317.0-318.0 ppm.

[0059] The trace elements contained in the yeast extract powder (model: FM902) used in the examples are as follows: potassium 32766.00-32768.00 mg / kg, sodium 5840.00-5842.00 mg / kg, calcium 537.00-539.00 mg / kg, magnesium 2033.00-2035.00 mg / kg, zinc 158.0-160.0 mg / kg, and iron 58.00-60.00 mg / kg.

[0060] The yeast extract (model: FM902) used in the examples contained 22.00-24.00% free amino acids and 58.00-60.00% hydrolyzed amino acids.

[0061] The free amino acid content is as follows, based on the weight of the yeast extract: free aspartic acid 1.2-1.4%, free threonine 1.6-1.8%, free serine 0.9-1.1%, free glutamic acid 3.4-3.6%, free glycine 0.6-0.8%, free alanine 3.1-3.3%, free cysteine ​​0.05-0.1%, free valine 1.0-2.0%, free methionine 0.5-1.0%, free isoleucine 1.0-2.0%, free leucine 2.0-3.0%, free tyrosine 1.0-2.0%, free phenylalanine 1.0-2.0%, free lysine 1.0-2.0%, free histidine 0.1-0.5%, free arginine 1.0-2.0%, and free proline 0.5-1.0%.

[0062] The hydrolyzed amino acid content is as follows, based on the weight of the yeast extract: hydrolyzed aspartic acid 6.00-7.00%, hydrolyzed threonine 2.00-4.00%, hydrolyzed serine 2.00-3.00%, hydrolyzed glutamic acid 10.00-12.00%, hydrolyzed glycine 2.00-4.00%, hydrolyzed alanine 5.00-1.00%, hydrolyzed cysteine ​​0.10-0.30%, and hydrolyzed valine 2%. 0.00-4.00%, hydrolyzed methionine 0.8-0.9%, hydrolyzed isoleucine 3.00-4.00%, hydrolyzed leucine 4.00-5.00%, hydrolyzed tyrosine 2.00-3.00%, hydrolyzed phenylalanine 2.00-3.00%, hydrolyzed lysine 4.00-5.00%, hydrolyzed histidine 1.00-2.00%, hydrolyzed arginine 3.00-4.00%, hydrolyzed proline 2.00-3.00%.

[0063] To better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0064] Unless otherwise stated, all reagents / instruments used in the embodiments of this invention are conventional commercially available products. Information on the sources of the experimental reagents / instruments used in this invention is shown in Table 1.

[0065]

[0066] The trace elements contained in the yeast extract powder (model: FM902) used in the examples are as follows: vitamin B1 2.6 ppm, vitamin B2 41.6 ppm, vitamin B5 81.3 ppm, vitamin B6 11.5 ppm, vitamin B7 5.79 ppm, vitamin B9 25.1 ppm, vitamin B12 0.21 (ug / 100g), choline 3017.0 ppm, inositol 2016.0 ppm, and niacin 318.0 ppm.

[0067] The trace elements contained in the yeast extract powder (model: FM902) used in the examples are as follows: potassium 32767.33 mg / kg, sodium 5841.92 mg / kg, calcium 538.71 mg / kg, magnesium 2034.06 mg / kg, zinc 159.69 mg / kg and iron 59.28 mg / kg.

[0068] The yeast extract (model: FM902) used in the examples contained 23.3% free amino acids and 59.16% hydrolyzed amino acids.

[0069] The free amino acid content is as follows, based on the weight of the yeast extract: free aspartic acid 1.3%, free threonine 1.7%, free serine 1.0%, free glutamic acid 3.5%, free glycine 0.7%, free alanine 3.2%, free cysteine ​​0.1%, free valine 1.8%, free methionine 0.5%, free isoleucine 1.3%, free leucine 2.4%, free tyrosine 1.1%, free phenylalanine 1.0%, free lysine 1.3%, free histidine 0.3%, free arginine 1.5%, and free proline 0.6%.

[0070] The hydrolyzed amino acid content is as follows: based on the weight of the yeast extract, hydrolyzed aspartic acid 6.56%, hydrolyzed threonine 2.99%, hydrolyzed serine 2.88%, hydrolyzed glutamic acid 10.75%, hydrolyzed glycine 2.94%, hydrolyzed alanine 5.10%, hydrolyzed cysteine ​​0.21%, hydrolyzed valine 3.63%, hydrolyzed methionine 0.84%, hydrolyzed isoleucine 3.02%, hydrolyzed leucine 4.32%, hydrolyzed tyrosine 2.10%, hydrolyzed phenylalanine 2.07%, hydrolyzed lysine 4.69%, hydrolyzed histidine 1.30%, hydrolyzed arginine 3.54%, and hydrolyzed proline 2.22%.

[0071] Whole genome sequencing analysis of the strain Whole-genome sequencing and COG annotation of *Streptococcus salivarius* subspecies *Jiacha.ST-685* revealed three unique gene sequences associated with high extracellular polysaccharide production, as shown below: (1) Gene sequence related to high production of extracellular polysaccharides: ST685_01040 (gene sequence encoding cps1C protein, SEQ ID NO:1), with COG ID number COG2244 in COG. This gene encodes Polysaccharide biosynthesis protein, cps1C protein (abbreviated as cps1C protein), which directly participates in the synthesis of bacterial extracellular polysaccharides and is a key component in the polysaccharide synthesis pathway.

[0072] (2) Gene sequence related to high production of extracellular polysaccharides: ST685_01041 (gene sequence encoding GT1 family protein, SEQ ID NO:2), with COG0438 in COG. This gene encodes Glycosyl transferases group 1 (GT1 family) protein. These proteins are key enzymes in the polysaccharide synthesis process, responsible for transferring glycosyl groups to polysaccharide chains to synthesize complex polysaccharide structures.

[0073] (3) Gene sequence related to high production of extracellular polysaccharides: ST685_01045 (gene sequence encoding GT2 family protein, SEQ ID NO:3), with COG1215 in COG. This gene encodes Glycosyltransferase, group 2 family (abbreviated as GT2 family) protein. These proteins participate in the modification and elongation process of polysaccharide synthesis, further affecting the structure and function of polysaccharides.

[0074] It's important to note that COG stands for "Orthologous Protein Cluster." By comparing protein sequences from different species, COGs are clustered together based on a common ancestor. Each COG represents a conserved functional unit, and this classification allows for the inference of the function of unknown proteins. For example, in microbial genome research, COG annotation is often used to determine the role of genes in biological processes such as metabolism, transport, and signal transduction.

[0075] The sequence of SEQ ID NO:1 is shown below: The sequence of SEQ ID NO:2 is shown below: The sequence of SEQ ID NO:3 is shown below: ATGAAACCACTTTTAACTGTTGTAATTCCAGTTTATAATGTCGAAAAGTATTTAAAACGTTGTGTAGAAAGCGTTCTTGTCCAAGAGTGGAATAATTATGATATTTTACTTGTAGATGATGGAAGTATTGATAGTTCTCCTCAAATCTGTGATGATTACGTTAAAGCTTATGACTTTATCTCAGTAATTCATAAAGAAAATGGAGGGCTTTCTGAAGCTCGTAACACAGGTATTTCTAATGCTGAGGGAGAATATGTTTATTTCCTAGATTCAGATGATTGGATTGAACCGAATACCTTTAGTGATTTAGCTGAGGTTATTGAATCAGATCAGTATGATATTATTTCTTTCAATCAAGAATTTGTAAAGAGTGAACATGATATTATAAAATCCGATTCAAAACGGATTAAACGATTAACTGGAAAAGAAGCTCTTATAGATATGTTTTCTTATGGATTTATTACTGGTTTTGCCACTGATAAGATATATCGAAAAGCATTGTTCACTAAGAATACTATCCAGTTTCCAGTTGGCAAGTATTATGAGGACCTTGGTACCAATTACAAACTCTTTCTTTCTGCTAAGAAGGTCTACGCGACGAATCAAAAGTACTACCATTATCTAATCGATAATCCAGATGCAATTACCAAATCATGGAATGAGCAGAAGTTTAGTGATATGTTTGAATTTTATAAAGATATTTTCTATTCTGATTTTGTTGGTTCTCAATTGAATCAAGAAGAAATACAAATTTTACAGCTATATTATGTGAATGGCTTGACTCATATCTTGGCAAGTTTATATAAATCTAAATTAGATAAAAAATATATAGACATTACTAATAAAGTAAAACAAGAATTAGTTAAGAATAGTATTTCTCTTTCTCAAATGAAAGACCAACCAAATAAGTTAAAATATATACTGTTTAGACTTAAATTGTTAAAACTAGCCTTCAGTATACAAAATGTTTTTTGA Example 1 Example 1 provides a method for preparing a direct-inoculation fermentation agent, the specific method of which is as follows: (1) Preparation of seed culture: The *Streptococcus salivarius* subsp. *thermophilus* Jiacha.ST-685 and *Lactobacillus delbrueckii* subsp. *Dangxiong* LBⅧ preserved in glycerol tubes were inoculated into MRS liquid medium for activation culture. The activation culture steps were as follows: *Streptococcus salivarius* subsp. *thermophilus* Jiacha.ST-685 and *Lactobacillus delbrueckii* subsp. *Dangxiong* LBⅧ were inoculated into MRS liquid medium at an inoculation rate of 3% and cultured at 37°C for 24 h. Then, they were inoculated into MRS liquid medium at an inoculation rate of 3% and cultured at 37°C for 12 h to complete the activation culture, thus obtaining the seed culture of *Streptococcus salivarius* subsp. *thermophilus* Jiacha.ST-685 and the seed culture of *Lactobacillus delbrueckii* subsp. *Dangxiong* LBⅧ, respectively.

[0076] The preparation method of MRS liquid culture medium is as follows: Based on the total mass of the MRS liquid culture medium, the raw materials for preparing the MRS liquid culture medium include: 2 wt% glucose, 1 wt% peptone, 1 wt% beef extract, 1.6 wt% yeast extract FM902, 0.7 wt% yeast extract FM503, 0.45 wt% anhydrous sodium acetate, 0.2 wt% ammonium dihydrogen phosphate, 0.01 wt% magnesium sulfate heptahydrate, 0.005 wt% manganese sulfate, 0.1 wt% Tween 80, 0.5 wt% sodium carbonate, and the remainder is water. After mixing the above raw materials for preparing the MRS liquid culture medium, the pH value is adjusted to 6.2, and sterilized at 0.1 MPa and 121℃ for 20 min to obtain the MRS liquid culture medium.

[0077] (2) Preparation of fermentation broth: The seed culture of *Streptococcus salivarius* subsp. *thermophilus* Jiacha.ST-685 and the seed culture of *Lactobacillus delbrueckii* subsp. *Dangxiong* LBⅧ obtained in step (1) were inoculated into 2L of the MRS liquid culture medium at an inoculation rate of 10% and cultured at 37°C for 24h to obtain fermentation broth of *Streptococcus salivarius* subsp. *thermophilus* Jiacha.ST-685 and fermentation broth of *Lactobacillus delbrueckii* subsp. *Dangxiong* LBⅧ.

[0078] (3) Preparation of bacterial sludge: The fermentation broth of Streptococcus salivarius subsp. Jiacha.ST-685 and the fermentation broth of Lactobacillus delbrueckii subsp. Dangxiong LBⅧ obtained in step (2) were centrifuged at 5000×g and 4℃ for 10min, respectively. The supernatant was discarded and the bacterial precipitate was retained. The bacterial precipitate was washed twice with sterile physiological saline to obtain bacterial sludge of Streptococcus salivarius subsp. Jiacha.ST-685 and bacterial sludge of Lactobacillus delbrueckii subsp. Dangxiong LBⅧ.

[0079] (4) Preparation of bacterial powder: (4.1) Preparation of Streptococcus salivarius subsp. thermophilicus Jiacha.ST-685 bacterial powder: The bacterial sludge of Streptococcus salivarius subsp. thermophilicus Jiacha.ST-685 was mixed evenly with a sterile freeze-drying protectant at a mass ratio of 3:2. After pre-freezing in a -30℃ freezer for 12 hours, it was vacuum freeze-dried for 48 hours to obtain Streptococcus salivarius subsp. thermophilicus Jiacha.ST-685 bacterial powder (viable count of 1.5 × 10⁻⁶). 10 CFU / g), Vacuum freeze drying includes pre-freezing, primary drying, and secondary drying. The pre-freezing temperature is -45℃, and the pre-freezing time is 5 hours. The drying process consists of a first drying stage and a second drying stage. The first drying stage is conducted at a temperature of -20℃ for 20 hours at a pressure of 12 MPa, while the second drying stage is conducted at a temperature of -10℃ for 12 hours at a pressure of 10 MPa. The secondary drying temperature was -30℃, the time was 4 hours, and the pressure was 5 MPa. The preparation method of the freeze-drying protectant is as follows: based on the weight of the freeze-drying protectant, 25wt% skim milk powder, 25wt% trehalose and 50wt% water are mixed and heated in a water bath at 80℃ for 30 minutes to obtain the freeze-drying protectant.

[0080] (4.2) Preparation of Lactobacillus delbrueckii subsp. lactis Dangxiong LBⅧ bacterial powder: Lactobacillus delbrueckii subsp. lactis Dangxiong LBⅧ bacterial sludge was mixed with sterile freeze-drying protectant at a mass ratio of 1:1. The mixture was pre-frozen in a -30℃ freezer for 12 hours and then vacuum freeze-dried for 48 hours to obtain Lactobacillus delbrueckii subsp. lactis Dangxiong LBⅧ bacterial powder (viable count 3×10⁻⁶). 10 CFU / g), Vacuum freeze drying includes pre-freezing, primary drying, and secondary drying. The pre-freezing temperature is -45℃, and the pre-freezing time is 5 hours. The drying process consists of a first drying stage and a second drying stage. The first drying stage is conducted at a temperature of -20℃ for 20 hours at a pressure of 12 MPa, while the second drying stage is conducted at a temperature of -15℃ for 12 hours at a pressure of 10 MPa. The secondary drying temperature was -30℃, the time was 4 hours, and the pressure was 5 MPa. The preparation method of the freeze-drying protectant is as follows: 5 wt% skim milk powder, 10 wt% maltodextrin, 4 wt% yeast extract FM503 and 81 wt% water are heated in a water bath at 80°C for 30 min to obtain the freeze-drying protectant.

[0081] (5) Preparation of direct-inoculation starter culture: The powder of Streptococcus salivarius subsp. thermophilicus Jiacha.ST-685 and the powder of Lactobacillus delbrueckii subsp. lactis Dangxiong LBⅧ were mixed according to the ratio of viable bacteria to obtain the direct-inoculation starter culture. The ratio of viable bacteria of Streptococcus salivarius subsp. thermophilicus Jiacha.ST-685 and Lactobacillus delbrueckii subsp. lactis Dangxiong LBⅧ per g of direct-inoculation starter culture was 12:1.

[0082] Example 2 Example 2 provides a method for preparing a direct-inoculation starter culture, which differs from Example 1 in that the ratio of viable bacteria of Streptococcus salivarius subsp. thermophilus Jiacha.ST-685 and Lactobacillus delbrueckii subsp. lactis Dangxiong LBⅧ per gram of direct-inoculation starter culture is 1:1.

[0083] Example 3 Example 3 provides a method for preparing a direct-inoculation starter culture, which differs from Example 1 in that the ratio of viable bacteria of Streptococcus salivarius subsp. thermophilus Jiacha.ST-685 and Lactobacillus delbrueckii subsp. lactis Dangxiong LBⅧ per gram of direct-inoculation starter culture is 1:5.

[0084] Comparative Example 1 The method for preparing a direct-inoculation fermentation agent provided in Comparative Example 1 differs from that in Example 1 in that: the powder of Streptococcus salivarius subsp. thermophilicus Jiacha.ST-685 is replaced with powder of Streptococcus salivarius subsp. thermophilicus 932.

[0085] The preparation method of Streptococcus salivarius subsp. thermophilus 932 bacterial powder is as follows: (1) Preparation of seed culture: The 932 strain preserved in glycerol tubes was inoculated into MRS liquid medium for activation culture. The activation culture steps were as follows: Streptococcus salivarius subsp. thermophilus 932 was inoculated into MRS liquid medium at a 3% inoculation rate and cultured at 40°C for 24 h, followed by inoculation into MRS liquid medium at a 3% inoculation rate and cultured at 40°C for 12 h, thus completing the activation culture and obtaining the seed culture of Streptococcus salivarius subsp. thermophilus 932. The MRS liquid medium was the same as in Example 1.

[0086] (2) Preparation of fermentation broth: The seed liquid of Streptococcus thermophilus subsp. 932 obtained in step (1) was inoculated into 2L of the MRS liquid medium at an inoculation rate of 10% and cultured at 40℃ for 24h to obtain the fermentation broth of Streptococcus thermophilus subsp. 932.

[0087] (3) Preparation of bacterial sludge: The fermentation broth of Streptococcus thermophilus subsp. 932 obtained in step (2) was centrifuged at 5000×g and 4℃ for 10min. The supernatant was discarded and the bacterial precipitate was retained. The bacterial precipitate was washed twice with sterile physiological saline to obtain bacterial sludge of Streptococcus thermophilus subsp. 932.

[0088] (4) Preparation of bacterial powder: The bacterial sludge of Streptococcus thermophilus subsp. 932 was mixed with sterile freeze-drying protectant at a mass ratio of 3:2. After pre-freezing in a -30℃ freezer for 12 hours, it was vacuum freeze-dried for 48 hours to obtain Streptococcus thermophilus subsp. 932 bacterial powder (viable count of 3.5 × 10⁻⁶). 10 CFU / g), The parameters for vacuum freeze drying are the same as in Example 1. The preparation method of the freeze-drying protectant is as follows: based on the weight of the freeze-drying protectant, 25wt% skim milk powder, 25wt% trehalose and 50wt% water are mixed and heated in a water bath at 80℃ for 30 minutes to obtain the freeze-drying protectant.

[0089] Comparative Example 2 The method for preparing a direct-inoculation starter culture provided in Comparative Example 2 differs from that in Example 1 in that Lactobacillus delbrueckii subsp. lactis LBⅧ powder is replaced with Lactococcus lactis subsp. lactis 954 powder.

[0090] The preparation method of Lactococcus lactis subsp. 954 bacterial powder is as follows: (1) Preparation of seed culture: The 932 strain preserved in glycerol tubes was inoculated into MRS liquid medium for activation culture. The activation culture steps were as follows: Lactococcus lactis subsp. lactis 954 was inoculated into MRS liquid medium at a 3% inoculation rate and cultured at 38°C for 24 h, followed by inoculation into MRS liquid medium at a 3% inoculation rate and cultured at 38°C for 12 h, thus completing the activation culture and obtaining the Lactococcus lactis subsp. lactis 954 seed culture. The MRS liquid medium was the same as in Example 1.

[0091] (2) Preparation of fermentation broth: The seed liquid of Lactococcus lactis subsp. 954 obtained in step (1) was inoculated into 2L of the MRS liquid medium at an inoculation rate of 10% and cultured at 40℃ for 24h to obtain the fermentation broth of Lactococcus lactis subsp. 954.

[0092] (3) Preparation of bacterial sludge: The fermentation broth of Lactococcus lactis subsp. 954 obtained in step (2) is centrifuged at 5000×g and 4℃ for 10min. The supernatant is discarded and the bacterial precipitate is retained. The bacterial precipitate is washed twice with sterile physiological saline to obtain Lactococcus lactis subsp. 954 bacterial sludge.

[0093] (4) Preparation of bacterial powder: Lactococcus lactis subsp. lactis 954 bacterial mud and sterile freeze-drying protectant were mixed evenly at a mass ratio of 3:2, pre-frozen in a -30℃ freezer for 12 hours, and then vacuum freeze-dried for 48 hours to obtain Lactococcus lactis subsp. lactis 954 bacterial powder (viable count of 3×10⁻⁶). 10 CFU / g), The parameters for vacuum freeze drying are the same as in Example 1. The preparation method of the freeze-drying protectant is as follows: based on the weight of the freeze-drying protectant, 20wt% skim milk powder, 25wt% trehalose and 55wt% water are mixed and heated in a water bath at 80℃ for 30 minutes to obtain the freeze-drying protectant.

[0094] Comparative Example 3 The method for preparing a direct-inoculation starter provided in Comparative Example 3 differs from that in Example 1 in that the direct-inoculation starter contains only powder of Streptococcus salivarius subsp. thermophilus Jiacha.ST-685.

[0095] Comparative Example 4 The method for preparing a direct-inoculation starter culture provided in Comparative Example 4 differs from that in Example 1 in that the direct-inoculation starter culture contains only Lactobacillus delbrueckii subsp. lactis powder.

[0096] Comparative Example 5 The method for preparing a direct-inoculation starter provided in Comparative Example 5 differs from that in Example 1 in that the direct-inoculation starter contains only Streptococcus salivarius thermophilus subsp. 932 bacterial powder.

[0097] Comparative Example 6 The method for preparing a direct-inoculation starter provided in Comparative Example 6 differs from that in Example 1 in that the ratio of viable bacteria of Streptococcus salivarius subsp. thermophilus 932 and Lactobacillus delbrueckii subsp. Dangxiong LB VⅢ is 5:1.

[0098] Application Example 1: The direct-inoculation starter cultures of Examples 1-3 and Comparative Examples 1-6 were used to prepare yogurt in a raw milk system. The specific preparation method is shown below: (1) Raw milk that meets the requirements of GB 19301 is standardized by conventional impurity removal methods so that the milk protein content in the raw milk is 3.0g / 100g. Then, the raw milk is homogenized at 60℃ and 25MPa (of which the low pressure is 5MPa). The homogenized raw milk is placed in a fermentation tank and heated to 65℃ based on the total mass of the homogenized raw milk.

[0099] (2) Under the condition of shear speed of 50 r / min, add 6.0 wt% of white sugar, 0.1 wt% of whey protein powder and 1 wt% of light cream to 50 wt% of the total mass of homogenized raw milk (wherein, white sugar, whey protein powder and light cream need to be mixed evenly before adding raw milk), and stir at 30 r / min for 15 min to obtain a mixture. Then add the remaining homogenized raw milk to the mixture and stir at 30 r / min for 10 min to obtain the target mixture. (3) The target mixture obtained in step (2) is homogenized and then sterilized to obtain a sterilized target mixture, wherein the homogenization temperature is 60℃ and the homogenization pressure is 25MPa (of which the low pressure is 5MPa). The sterilization temperature is 95℃ and the sterilization time is 300 seconds.

[0100] (4) After cooling the sterilized target mixture to 42°C, add the direct-inoculation fermentation agent of Examples 1-3 and Comparative Examples 1-6 respectively (each mL of the sterilized target mixture contains a total viable count of 5 × 10⁻⁶). 7 The mixture was stirred at 30 r / min for 15 min and then fermented at 42°C until the acidity reached 70°T, thus obtaining the yogurts made from raw milk in Examples 1-3 and Comparative Examples 1-6.

[0101] (5) Stir the yogurt obtained in step (4) at a speed of 30 r / min for 15 min and then cool it to 25°C. Then, quantitative filling and sealing are carried out in an aseptic environment. The filling temperature is 15°C. The filled yogurt is refrigerated at 4°C.

[0102] Technical Effect Evaluation 1: The fermentation rate and post-acidification of yogurts made from raw milk in Examples 1-3 and Comparative Examples 1-6 were tested. The specific testing methods are as follows: 1. Method for detecting the fermentation speed of yogurt: After inoculation with direct-inoculation starter culture, fermentation was carried out at 42°C. The time required for the acidity to reach 70°T was recorded. The results are shown in Table 2.

[0103]

[0104] As shown in Table 2, the results show that, compared with Comparative Examples 1-6, the yogurt fermentation speed of Examples 1-3 is relatively fast, at 5.0-5.5 hours, meaning that fermentation can be completed within 5.5 hours. It can be seen that the yogurt prepared by the direct-inoculation starter provided in Examples 1-3 has a relatively fast fermentation speed.

[0105] 2. Method for detecting post acidification of yogurt: Place the yogurt obtained in step (6.3) in a constant temperature chamber at 4°C and detect the changes in yogurt acidity on days 0, 7, 14 and 21.

[0106] It should be noted that post-acidification refers to the process by which the starter culture in yogurt obtained after the fermentation process has been terminated (acidity reaches 70°T) continues to metabolize lactose and produce acid in the yogurt during the low-temperature (4°C) cooling stage.

[0107] The specific methods for determining the acidity of yogurt on days 0, 7, 14, and 21 are as follows: Remove the yogurt from the 4°C constant temperature incubator, stir well, and weigh 10g (accurate to 0.001g) of yogurt sample into a 150mL conical flask; add 20mL of freshly boiled and cooled distilled water to room temperature and mix well. Then, titrate with 0.1mol / L sodium hydroxide standard solution to a pH of 8.3, and record the volume of sodium hydroxide standard titration solution consumed (denoted as V). Perform a blank experiment with the corresponding mass of distilled water (10g), and record the volume of sodium hydroxide standard titration solution consumed (denoted as V0). Calculate the acidity of the yogurt sample according to formula (1) below, and express it as the arithmetic mean of two independent determinations obtained under repeatability conditions. The results are shown in Table 3.

[0108] (Formula 1) X represents the acidity of the yogurt sample, in °T; C represents the molar concentration of the sodium hydroxide standard solution, expressed in moles per liter (mol / L). V represents the volume of sodium hydroxide standard solution consumed during titration, in milliliters (mL). V0 represents the volume of sodium hydroxide standard solution consumed in the blank experiment, in milliliters (mL). 100 indicates a 100g yogurt sample; M represents the mass of the yogurt sample, in grams (g). 0.1 represents the molar concentration of sodium hydroxide as defined by acidity theory, in units of moles per liter (mol / L).

[0109]

[0110] As shown in Table 3, the results show that, compared with Comparative Examples 1-6, the yogurt of Examples 1-3 has a relatively low degree of post-acidification. When stored at 4°C for 21 days, the acidity of the yogurt increased by 35-39°T, that is, the acidity of the yogurt increased by ≤50°T. It can be seen that the yogurt prepared by the direct-inoculation starter provided in Examples 1-3 has a relatively low degree of post-acidification.

[0111] Technical Effect Evaluation 2: The viscosity and shelf-life (21 days) stability of yogurts made from raw milk in Examples 1-3 and Comparative Examples 1, 2, 4, 5, and 6 were tested. The specific testing methods are as follows: 1. Method for detecting the viscosity of yogurt: Take 500 mL of yogurt (the temperature of the yogurt itself is 20℃) into a beaker, and use an SNB-1 digital viscometer to detect the viscosity using an L3 rotor at a speed of 20 rpm / min and a range of 6000 mPa·s. The results are shown in Table 5.

[0112] 2. Method for testing the shelf-life stability of yogurt (accelerated centrifugation test): Place the yogurt in an environment of 25℃ for rewarming treatment so that the temperature of the yogurt is consistent with the room temperature. Weigh 50g of yogurt sample into a 50mL centrifuge tube and centrifuge at 3500rpm and 25℃ for 10min. Then retain the supernatant, i.e. whey. Calculate the whey separation rate according to the formula (2) below. Repeat three times and take the average value. The whey separation rate scoring criteria are shown in Table 4 and the results are shown in Table 5.

[0113] (Formula 2) m1 represents the mass of whey, in grams (g). m represents the mass of the yogurt sample, in grams (g).

[0114] The whey separation rate scoring criteria are shown in Table 4 below:

[0115]

[0116] As shown in Table 5, the results show that, compared with Comparative Examples 1, 2, 4, 5 and 6, the whey content of the yogurt in Examples 1-3 is low, specifically 1.35-1.98%, that is, the whey separation rate is ≤2%, and the viscosity is 4200-5100 mPa·s. This indicates that the direct-inoculation starter provided by the present invention has the function of high production of extracellular polysaccharides, and the yogurt made using the direct-inoculation starter has high viscosity and good stability during the shelf life.

[0117] Technical Effect Evaluation 3: The content of volatile flavor compounds in the yogurts made from raw milk in Examples 1-3 and Comparative Examples 1-6 was detected using the following specific methods: 1. Method for detecting the content of volatile flavor compounds in yogurt: The yogurt was subjected to qualitative and relative quantitative analysis using a gas chromatography-mass spectrometry (GC-MS) instrument (model: 7890B / 5977B MSD, Agilent Technologies). The relative concentrations of each volatile flavor compound were calculated using the internal standard method (internal standard: o-dichlorobenzene), and the percentage of each volatile flavor compound relative to the total relative concentration of volatile flavor compounds was calculated. The results are shown below. Lactis And Table 7, Figure 1 As shown in Table 8, the detection parameters for the content of volatile flavor compounds are shown in Table 6 below:

[0118] The classification and mass content percentage of volatile flavor compounds are shown in Table 7 below:

[0119] The volatile flavor compounds and their mass percentages for each aroma type are shown in Table 8 below:

[0120] It should be noted that the relative content of volatile flavor compounds obtained by GC-MS needs to be evaluated. Generally, the aroma activity value (OAV value) is used to assess the influence of each volatile flavor compound on the aroma of the sample. It is generally believed that volatile compounds with OAV ≥ 1 have a greater impact on the overall aroma of the sample, and the larger the OAV value, the greater the contribution to the overall flavor of the product. Volatile compounds with OAV ≤ 1 play an important role in modifying the flavor of the sample.

[0121] The OAV value was calculated according to the formula (3) below based on the relative concentration of each volatile flavor substance. Five batches of experiments were repeated. Each experiment was sampled and sent to GC-MS for testing. The average OAV value of the volatile flavor substances was obtained. The results are shown in Table 9.

[0122] (Formula 3) OAV stands for aroma activity of volatile flavor compounds; C represents the relative concentration of volatile flavor compounds (ug / kg); OT stands for the sensory threshold of volatile flavor compounds (ug / kg).

[0123]

[0124] As shown in Tables 7, 8, and 9, Figure 2 and Figure 1 As shown, Figure 2 The graph shows the classification and content percentage of volatile flavor compounds. Figure 1 Figure 2The results are shown in Table 9, which presents the volatile flavor compounds and their proportions for different aroma types. As shown in Table 9, in terms of OAV values, compared to Comparative Examples 1-5, the yogurts of Examples 1 and 2 produce a richer variety of volatile flavor compounds, with relatively higher OAV values ​​for fruity volatile flavor compounds, contributing significantly to the overall flavor and giving the yogurt a unique aroma. Regarding the classification and proportion of volatile flavor compounds, compared to Comparative Examples 1-6, the yogurts of Examples 1-3 produce relatively higher levels of esters, ketones, and acids, and relatively lower levels of alcohols. Esters are not only important flavor contributors to yogurt but can also mask undesirable flavors, including astringency and bitterness. Most esters are typically described as having floral and fruity aromas, providing ideal flavors for yogurt. Different ketones contribute differently to the flavor of yogurt, mainly exhibiting oily or floral / fruity aromas. As the main flavor compounds in yogurt, they are products of lactic acid bacteria's decomposition and metabolism of sugars and amino acids. Acids are mainly manifested in the mouthfeel and also have certain physiological functions.

[0125] Technical Effect Evaluation 4: Sensory evaluation was conducted on the yogurts made from raw milk in Examples 1-3 and Comparative Examples 1-6. The specific sensory evaluation methods are as follows: Fifteen dairy professionals who had received sensory training were randomly selected as sensory evaluators. The scoring criteria are shown in Table 10 below. The average scores given by the 15 sensory evaluators for the aroma, texture, and taste of the yogurt were calculated, and the scores for the three indicators were added together to obtain the total score. The higher the score, the better the overall sensory evaluation effect of the yogurt in terms of aroma, texture, and taste. The results are shown in Table 11.

[0126]

[0127]

[0128] As shown in Table 11, the results indicate that, compared to Comparative Examples 1-6, the yogurts of Examples 1-3 scored 2-4 points for fruit aroma, 2-5 points for fat aroma, 4-6 points for milk aroma, 8-9 points for texture, and 8-9 points for taste. This means they scored higher in aroma and texture, indicating that the yogurts of Examples 1-3 not only had excellent consistency and texture but also a pleasant aroma. Furthermore, compared to Comparative Examples 1-6, the yogurts of Examples 1-3 showed a significant difference in taste scores. The fruit aroma and taste of the yogurts of Examples 1-3 were more prominent, while the milk and fat aromas were more mellow.

[0129] Application Example 2: The direct-inoculation starter cultures of Examples 1-3 and Comparative Examples 1-6 were used to prepare yogurt in a skim milk powder system. The specific preparation method is shown below: 10g of skim milk powder was mixed with 90g of distilled water at 50℃ and allowed to hydrate at 50℃ for 30 minutes to obtain a mixture. Then, based on the weight of the mixture, 6.0wt% of white sugar, 0.1wt% of whey protein powder, and 1wt% of light cream were added and homogenized (homogenization pressure 25 MPa, including a low pressure of 5 MPa). The mixture was then sterilized at 95℃ for 300 seconds and cooled to 42℃. Next, the direct-inoculation starter culture of Examples 1-3 and Comparative Examples 1-6 was added respectively (each mL of the sterilized mixture contained 5 × 10⁶ viable bacteria). 7 The mixture was stirred at 30 r / min for 15 min and then fermented at 42°C until the acidity reached 70°T, thus obtaining the yogurts made from skim milk powder as raw material as described in Examples 1-3 and Comparative Examples 1-6.

[0130] Technical Effect Evaluation 1: The extracellular polysaccharide content of the skim milk powder yogurts in Examples 1-3 and Comparative Examples 1-6 was detected using the following specific methods: 1. Standard Curve Construction: A standard curve was prepared using sucrose as the standard. The reagents listed in Table 9 were added sequentially to colorimetric tubes. Then, 2 mL of purified water and 0 mL, 0.2 mL, 0.4 mL, 0.6 mL, 0.8 mL, and 1 mL of a 100 μg / mL sucrose standard solution were added to the colorimetric tubes, respectively. Next, 1 mL of 6% phenol solution was added, and finally 5 mL of 98% concentrated sulfuric acid was added, followed by dilution to 10 mL with water. After cooling, the absorbance at 490 nm was measured, with three replicates per group. The standard curve was plotted with sucrose content (μg / L) on the x-axis and absorbance (A490) on the y-axis. The resulting standard curve was: Y = 159X - 0.9813, R... 2 =0.998, where Y represents the extracellular polysaccharide content in μg and X represents the absorbance.

[0131]

[0132] 2. Determination of extracellular polysaccharide content in yogurt prepared from skim milk powder: Mix 5g of yogurt sample with 5mL of H2O, incubate at 75℃ for 5min, then centrifuge at 10000r / min for 10min, retain the supernatant, dilute 1mL of the supernatant to 100mL with water to obtain a constant solution. Take 1mL of the constant solution into a colorimetric tube, add 1mL of 6% phenol solution, and finally add 5mL of 98% concentrated sulfuric acid and dilute to 10mL with water. Measure the absorbance at 490nm (X). n The results are shown in Table 13. Simultaneously, 1 mL of 6% phenol solution was added to the colorimetric tube, followed by 5 mL of 98% concentrated sulfuric acid, and the volume was brought to 10 mL with water as a blank control.

[0133]

[0134] It should be noted that extracellular polysaccharides are large, bioactive molecules secreted by bacteria outside the cell. They have a significant impact on the viscosity, rheological properties, and texture of yogurt. Increased yogurt viscosity can effectively prevent the yogurt gel from breaking down and whey from separating, and can also effectively increase the residence time of yogurt in the oral cavity.

[0135] As shown in Table 13, the results indicate that when the direct-inoculation starter cultures of Examples 1-3 are used to prepare yogurt in a skim milk powder system, the extracellular polysaccharide content of the yogurt is 609.0-700.0%. Compared to Comparative Examples 1, 2, 4, 5, and 6, the direct-inoculation starter culture of Examples 1-3, when used to prepare yogurt in a skim milk powder system, exhibits higher concentrations of extracellular polysaccharides (ECPs) due to the presence of gene sequences associated with high extracellular polysaccharide production by *Streptococcus thermophilus* subsp. *Jiacha.ST-685. This results in superior viscosity for the yogurt. Comparative Examples 1, 4, 5, and 6 did not contain *Streptococcus thermophilus* subsp. *Jiacha.ST-685, leading to lower ECP concentrations in the yogurt. Furthermore, although Comparative Example 2 included *Streptococcus thermophilus* subsp. *Jiacha.ST-685, and while the ECP content in the yogurt prepared in Comparative Example 2 was higher than in the other comparative examples, it did not contain specific *Lactobacillus delbrueckii* subsp. *Dangxiong*. The mixing of LBⅧ resulted in a significantly lower extracellular polysaccharide content in the yogurt prepared in Comparative Example 2 compared to Examples 1-3. Therefore, only by combining a specific ratio of Streptococcus salivarius subsp. thermophilus Jiacha.ST-685 and Lactobacillus delbrueckii subsp. lactis Dangxiong LBⅧ can the synergistic effect of these two bacteria during fermentation further activate the relevant genes in Streptococcus salivarius subsp. thermophilus, producing more extracellular polysaccharides, thereby producing yogurt with higher viscosity.

[0136] The above embodiments are only for further explanation and understanding of the technical solution of the present invention, and are not intended to limit the present invention. Any improvements made by those skilled in the art on this basis that do not highlight substantive features or make significant progress should fall within the protection scope of the present invention.

Claims

1. A fermentation agent for producing extracellular polysaccharides, characterized in that, It includes powders of Streptococcus thermophilus subsp. saliva and Lactobacillus delbrueckii subsp. lactis, wherein the live count ratio of Streptococcus thermophilus subsp. saliva and Lactobacillus delbrueckii subsp. lactis is 1-12:1-5.

2. The fermenting agent according to claim 1, characterized in that, The ratio of viable counts of Streptococcus thermophilus subsp. and Lactobacillus delbrueckii subsp. lactis was 5-12:1-5.

3. The fermenting agent according to claim 1 or 2, characterized in that, The viable count of the Streptococcus thermophilus subsp. saliva powder is 1×10⁻⁶. 10 -2×10 10 CFU / g, and / or the viable count of the *Lactobacillus delbrueckii* subsp. *lactotrichum* powder is 2.5 × 10⁻⁶. 10 -3.5×10 10 CFU / g.

4. The fermenting agent according to any one of claims 1-3, characterized in that, The aforementioned *Streptococcus salivarius* subsp. *thermophilus* is *Streptococcus salivarius* Jiacha.ST-685, with accession number CCTCC NO: M 20231495, and / or the aforementioned *Lactobacillus delbrueckii* subsp. *delbrueckii* is *Lactobacillus delbrueckii* Dangxiong LBⅧ, with accession number CCTCC NO: M 2023396. Preferably, the *Streptococcus salivarius* subspecies *Jiacha.ST-685* carries a gene associated with high extracellular polysaccharide production, wherein the gene associated with high extracellular polysaccharide production includes one or more of the gene sequences shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:

3. More preferably, the genes associated with high production of extracellular polysaccharides include gene sequences as shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:

3.

5. The fermenting agent according to any one of claims 1-4, characterized in that, The aforementioned *Streptococcus thermophilus* subsp. powder is prepared by a method comprising the following steps: inoculating *Streptococcus thermophilus* subsp. into a liquid culture medium for activation and fermentation to obtain *Streptococcus thermophilus* subsp. fermentation broth; then, performing solid-liquid separation and drying of the *Streptococcus thermophilus* subsp. fermentation broth to obtain *Streptococcus thermophilus* subsp. powder. The preparation method of Lactobacillus delbrueckii subsp. lactis powder includes the following steps: Lactobacillus delbrueckii subsp. lactis is inoculated into a liquid culture medium for activation culture and fermentation culture to obtain Lactobacillus delbrueckii subsp. lactis fermentation broth, and then the Lactobacillus delbrueckii subsp. lactis fermentation broth is subjected to solid-liquid separation and drying to obtain Lactobacillus delbrueckii subsp. lactis powder.

6. The fermenting agent according to any one of claims 1-5, characterized in that, The pH of the liquid culture medium is 6.1-6.

5. The liquid culture medium, by total mass, comprises: 1-4 wt% glucose, 0.5-3 wt% peptone, 0.5-2 wt% beef extract, 1.3-3.7 wt% yeast extract, 0.2-0.6 wt% anhydrous sodium acetate, 0.1-0.4 wt% ammonium dihydrogen phosphate, 0.005-0.02 wt% magnesium sulfate heptahydrate, 0.001-0.01 wt% manganese sulfate, 0.05-0.25 wt% Tween 80, 0.4-1.2 wt% sodium carbonate, and the remainder is water. Preferably, the starter culture is a direct-inoculation starter culture, which is used for fermenting dairy products.

7. A method for preparing a fermenting agent according to any one of claims 1-6, characterized in that, The process includes the following steps: mixing Streptococcus thermophilus subsp. powder and Lactobacillus delbrueckii subsp. lactis powder to obtain a starter culture, wherein the live count ratio of Streptococcus thermophilus subsp. powder to Lactobacillus delbrueckii subsp. lactis is 1-12:1-5.

8. The preparation method according to claim 7, characterized in that, The preparation method of the Streptococcus salivarius thermophilic subsp. powder includes the following steps: (1) Preparation of seed culture: *Streptococcus salivarius* subsp. *thermophilus* was inoculated into liquid culture medium for activation culture to obtain *Streptococcus salivarius* subsp. *thermophilus* seed culture. (2) Preparation of fermentation broth: The seed culture of *Streptococcus salivarius* subsp. *thermophilus* obtained in step (1) is inoculated into a liquid culture medium for fermentation culture to obtain fermentation broth of *Streptococcus salivarius* subsp. *thermophilus*. Preferably, the inoculum amount is 5-15%. (3) Preparation of bacterial sludge: After solid-liquid separation of the fermentation broth of *Streptococcus thermophilus* obtained in step (2), the bacterial precipitate is retained to obtain *Streptococcus thermophilus* bacterial sludge. (4) Preparation of bacterial powder: The *Streptococcus thermophilus* subsp. *sauristatin* bacterial sludge obtained in step (3) is mixed with a freeze-drying protectant at a mass ratio of 1-3:2-1 and then dried to obtain *Streptococcus thermophilus* bacterial powder. Preferably, the freeze-drying protectant comprises, by weight of total ...

9. The preparation method according to claim 7, characterized in that, The preparation method of the Lactobacillus delbrueckii subsp. lactis powder includes the following steps: (1) Preparation of seed culture: Lactobacillus delbrueckii subsp. lactis was inoculated into liquid culture medium for activation culture to obtain Lactobacillus delbrueckii subsp. lactis seed culture. (2) Preparation of fermentation broth: The Lactobacillus delbrueckii seed culture obtained in step (1) was inoculated into a liquid culture medium for fermentation culture to obtain Lactobacillus delbrueckii subsp. lactis fermentation broth. (3) Preparation of bacterial sludge: After solid-liquid separation of the fermentation broth of *Lactobacillus delbrueckii* obtained in step (2), the bacterial precipitate is retained to obtain *Lactobacillus delbrueckii* bacterial sludge. (4) Preparation of bacterial powder: The *Lactobacillus delbrueckii* subsp. *lactamella* bacterial sludge obtained in step (3) is mixed with a freeze-drying protectant at a mass ratio of 1-3:2-1 and then dried to obtain *Lactobacillus delbrueckii* subsp. *lactamella* bacterial powder. Preferably, the freeze-drying protectant comprises, by weight of total weight of the freeze-drying protectant: 10-30 wt% skim milk powder, 7-13 wt% maltodextrin, 3-5 wt% yeast extract, with the remainder being water.

10. The preparation method according to any one of claims 7-9, characterized in that, The inoculum size for the activation culture is 2-5%, and / or the inoculum size for the fermentation culture is 7-13%. Preferably, the activation culture includes a first activation culture and a second activation culture, wherein the temperature of the first activation culture is 35-45℃ and / or the activation culture time is 20-36h, and the temperature of the second activation culture is 35-45℃ and / or the activation culture time is 10-18h.

11. The preparation method according to any one of claims 7-10, characterized in that, The sterilization temperature of the freeze-drying protectant is 75-85℃, and / or the sterilization time is 25-45 min. Preferably, the fermentation temperature is 35-45℃ and / or the fermentation time is 20-36 hours. More preferably, the drying method is vacuum freeze-drying, wherein vacuum freeze-drying includes pre-freezing, primary drying, and secondary drying. The pre-freezing temperature is -45 to -35°C, and the pre-freezing time is 3-6 hours. The drying process consists of a first drying stage and a second drying stage. The first drying stage is conducted at a temperature of -25℃ to -15℃ for 15-20 hours at a pressure of 10-15 MPa. The second drying stage is conducted at a temperature of -15℃ to -5℃ for 10-14 hours at a pressure of 8-12 MPa. The secondary drying temperature is -35 to -25℃, the time is 2-6 hours, and the pressure is 3-7 MPa.

12. The preparation method according to any one of claims 7-11, characterized in that, Pre-freezing is also included before drying, in which, The pre-freezing temperature is -45 to -35°C, and / or the pre-freezing time is 12-24 hours.

13. The use of the starter culture of any one of claims 1-6, or the starter culture prepared by the preparation method of any one of claims 7-12, in the preparation of fermented dairy products, preferably, the fermented dairy product includes yogurt or lactic acid bacteria beverage, preferably, the fermented dairy product is yogurt, more preferably, the type of yogurt includes: One of the following: low-temperature yogurt, stirred yogurt, set yogurt, or drinkable yogurt.

14. A fermented dairy product, characterized in that, It is prepared by the following steps: mixing the starter culture according to any one of claims 1-6, or the starter culture prepared by any one of claims 7-12, with a fermentation substrate to obtain a mixture, fermenting the mixture to obtain a fermented dairy product, wherein, before fermentation, the initial viable count in each mL of the mixture is 0.1-5 × 10⁻⁶. 7 CFU; wherein the fermentation substrate includes one or a combination of raw milk and milk powder. The fermented dairy product contains 600.0-700.0 μg / mL of extracellular polysaccharides.

15. The fermented dairy product according to claim 14, characterized in that, The flavor compounds in the fermented dairy products include one or more substances selected from the group consisting of nonanal, peachal, 2-phenylacetaldehyde, 2-heptanone, 2-nonanone, 2,3-pentanedione, 3-hydroxy-2-butanone, 2-undecanedione, methylbenzyl alcohol, n-butyric acid, n-hexanoic acid, octanoic acid, isovaleric acid, phenethyl acetate, and butyl acetate. Preferably, the fermented dairy product contains 609.0-700.0 μg / mL of extracellular polysaccharides. Preferably, the raw milk includes one or more substances selected from the group consisting of raw cow's milk, raw sheep's milk, and raw camel's milk. Preferably, the milk powder includes one or more types of whole milk powder and skim milk powder.

16. The fermented dairy product according to claim 14 or 15, characterized in that, It also contains protein powder, sweeteners, and heavy cream. Preferably, the fermentation substrate comprises 4.0-6.0 wt% protein powder, 4.0-6.0 wt% sweetener, and / or 0.1-1.0 wt% light cream, based on 45-55 wt% of the total weight of the fermentation substrate.

17. The fermented dairy product according to any one of claims 14-16, characterized in that, The protein powder includes one or more substances selected from the group consisting of whey protein powder, milk protein powder, and casein powder. Preferably, the protein powder is whey protein powder; more preferably, the protein content is 20-50%. And / or the cream has a fat content of 30-36%. And / or the sweetener comprises one or more substances selected from the group consisting of white sugar, glucose, fructose, erythritol, maltitol, steviol glycosides, sucralose, xylitol, mogrosides, sorbitol and mannitol, preferably, the sweetener is white sugar.

18. A method for preparing a fermented dairy product according to any one of claims 14-17, characterized in that, The process includes the following steps: mixing the starter culture and the fermentation substrate to obtain a mixture; fermenting the mixture to obtain a fermented dairy product; wherein, prior to fermentation, the initial viable cell count in each mL of the mixture is 0.1-5 × 10⁻⁶. 7 CFU; wherein the fermentation substrate includes one or a combination of raw milk and milk powder.

19. The preparation method according to claim 18, characterized in that, When the fermentation substrate is raw milk, the following steps are included: (1) Based on 45-55 wt% of the total weight of raw milk, add 4.0-6.0 wt% protein powder, 4.0-6.0 wt% sweetener, and 0.1-1.0 wt% light cream to the raw milk, mix, homogenize, sterilize, and cool to obtain a mixture. (2) The mixture obtained in step (1) is mixed with the direct-inoculation yogurt starter to obtain a mixture. The mixture is fermented until the acidity is terminated to obtain a fermented dairy product.

20. The preparation method according to claim 18 or 19, characterized in that, In step (1), before mixing, the raw milk is homogenized and heated to 60-65°C.

21. The preparation method according to any one of claims 18-20, characterized in that, The homogenization temperature is 60-65℃, and the homogenization pressure is 20-30MPa (of which the low pressure is 2-7MPa).

22. The preparation method according to any one of claims 18-21, characterized in that, When the fermentation substrate is skim milk powder, the process includes the following steps: mixing skim milk powder and water evenly, sterilizing and cooling to obtain a mixture; then mixing the mixture with the starter culture and fermenting until the final acidity is reached to obtain a fermented dairy product. Preferably, the weight ratio of skim milk powder to water is 10-30:90-70. Preferably, the fermentation temperature is 40-45℃ and the termination acidity is 70-80°T.

23. The fermented dairy product according to any one of claims 14-17, or the fermented dairy product prepared by the preparation method according to any one of claims 18-22, characterized in that, The fermented dairy product includes yogurt or lactic acid bacteria beverage. Preferably, the fermented dairy product is yogurt. More preferably, the type of yogurt includes one of the following: low-temperature yogurt, stirred yogurt, set yogurt, or drinkable yogurt.

Citation Information

Patent Citations

  • Lactobacillus delbrueckii subsp. Lactis with high biofilm formation and strong stress resistance and application thereof

    CN116948884A

  • Selenium-rich lactic acid bacteria beverage and preparation method thereof

    CN117179054A

  • Jelly-flavored direct vat set yoghurt starter and preparation method thereof

    CN117448229A

  • Direct vat set yoghurt starter and preparation method thereof

    CN117736930A

  • Fermented walnut milk with calming and memory improving effects and preparation method thereof

    CN118872730A