VvHDZ27 gene for improving drought tolerance of grapes and application of VvHDZ27 gene

By cloning and overexpressing the grape VvHDZ27 gene, the activity of antioxidant enzymes in Arabidopsis thaliana and grape was enhanced, solving the technical problem of improving grape drought resistance and achieving an efficient response to drought stress.

CN121931129APending Publication Date: 2026-04-28NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NORTHWEST A & F UNIV
Filing Date
2026-01-28
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

There is limited research on the function of the grape HDZ gene in drought stress response in existing technologies, resulting in limited improvement in grape drought resistance.

Method used

The grape VvHDZ27 gene was cloned and introduced into Arabidopsis thaliana and grape callus tissues via Agrobacterium-mediated genetic transformation. The pCAMBIA2300-35s-3×Flag-VvHDZ27 overexpression vector was constructed to enhance the activity of the antioxidant enzyme CAT and reduce the content of H2O2 and O2·-.

Benefits of technology

It significantly improved the drought resistance of transgenic plants, enhanced their tolerance to drought stress, reduced oxidative damage, and improved the drought-resistant growth capacity of grapes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121931129A_ABST
    Figure CN121931129A_ABST
Patent Text Reader

Abstract

The invention discloses a VvHDZ27 gene for improving the drought tolerance of grapes. The sequence of a coding region of the gene is as shown in SEQ ID No.1; the amino acid sequence of the protein coded by the gene is as shown in SEQ ID No.2. The invention also discloses an application of the VvHDZ27 gene in improving the drought resistance of grapes, and the VvHDZ27 gene is introduced into Arabidopsis thaliana and grape calluses by constructing a pCAMBIA2300-35s-3 * Flag-VvHDZ27 overexpression vector and adopting an agrobacterium-mediated genetic transformation method. The overexpressed VvHDZ27 can significantly improve the survival rate of transgenic arabidopsis thaliana under drought stress and the fresh weight of transgenic calluses. Analysis of a physiological regulation mechanism of the VvHDZ27 gene finds that the VvHDZ27 gene reduces the content of active oxygen in a transgenic plant by improving the activity of antioxidant enzyme CAT, so that oxidative stress induced by drought is inhibited, and the drought resistance of the transgenic plant is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to improving the drought resistance of grapes. VvHDZ27 Genes, and also involve this VvHDZ27 Application of genes in improving the drought resistance of grapes. Background Technology

[0002] Drought is a key environmental factor limiting plant growth and causing a decline in economic yield. In the early stages of drought stress, plants close their stomata to reduce water loss, but this also inhibits CO2 absorption and photosynthesis, triggering excessive accumulation of reactive oxygen species (ROS), which in turn leads to oxidative damage and inhibits plant growth and development. To cope with the adverse effects of drought, plants have evolved a complex defense network that responds synergistically to drought signals at the morphological, physiological, biochemical, and molecular levels to achieve efficient adaptation to arid environments. This mechanism includes promoting the synthesis of osmotic regulators such as proline and soluble sugars to maintain cell water potential and turgor pressure; enhancing the activity of antioxidant enzymes such as superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT), and peroxidase (POD) to balance cellular redox potential; regulating drought signal sensing, transduction, and transcription and translation of related functional genes; and enhancing the expression of stress response proteins, thereby improving the plant's drought resistance.

[0003] Transcription factors (TFs) are a class of protein factors that bind to specific DNA sequences and regulate the expression of downstream genes, playing important regulatory roles in plant growth and development, morphogenesis, and responses to changes in the external environment. To date, several transcription factor families, including ARB, ERF, NAC, and bZIP, have been identified and proven to play a crucial role in regulating plant responses to drought stress.

[0004] The HDZ gene family is a plant-specific class of transcription factors, composed of two domains: a conserved 60-amino acid motif homeobox and a leucine zipper motif. This family plays crucial regulatory roles in various aspects of plant growth and development, organ differentiation, hormone signaling, and stress response. Based on structural and functional characteristics, the HDZ gene family is divided into four subfamilies (I-IV). The HDZ I subfamily primarily participates in plant responses to abiotic stresses. HDZ induces plant responses to drought stress mainly through pathways such as regulating ABA synthesis and signaling, controlling plant development, and inducing the accumulation of soluble substances and antioxidant enzymes. For example, in peppers… CaHAT1 Genes are key kinases of ABA signaling CaSnRK2.6 Phosphorylation and activation positively regulate the drought resistance of chili peppers. Sunflower HaHB11 Genes mitigate the adverse effects of drought by increasing stem width, the number of vascular bundles, and root elongation. (Arabidopsis thaliana) HB13 Activation of NAC transcription factors during drought stress JUB1 The expression of [certain substances] reduces H2O2 levels and enhances the drought resistance of transgenic Arabidopsis thaliana. (Maize) ZmHDZ9 The transgenic plants exhibited higher SOD and POD activities compared to the control, promoted the accumulation of soluble protein, and improved the drought resistance of the transgenic plants.

[0005] The HDZ gene family is a class of plant-specific transcription factors. Although the drought resistance function of the HDZ family in plants such as Arabidopsis thaliana, sunflower, and pepper has been identified, research on the function of HDZ genes in grapes is limited. Summary of the Invention

[0006] The first objective of this invention is to provide a method to improve the drought resistance of grapes. VvHDZ27 This gene has a biological function that enhances the drought resistance of grapes.

[0007] The second object of the present invention is to provide the following: VvHDZ27 Application of genes in improving the drought resistance of grapes.

[0008] The technical solution adopted in this invention is to improve the drought resistance of grapes. VvHDZ27 The gene, the coding region sequence of which is shown in SEQ ID No. 1, and the amino acid sequence encoded by which the gene is shown in SEQ ID No. 2;

[0009] Another technical solution adopted in this invention is, VvHDZ27 The application of genes to improve the drought resistance of grapes, through the construction of pCAMBIA2300-35s-3×Flag- VvHDZ27 The overexpression vector was introduced into Arabidopsis and grape callus tissues via Agrobacterium-mediated genetic transformation.

[0010] The beneficial effects of this invention are: The present invention VvHDZ27 Genes are induced VvAPX, VvCAT, VvAPX Gene transcription increases the activity of CAT antioxidant enzymes, thereby reducing H2O2 and O2 in transgenic plants. ·- The content of [specific ingredient] can enhance the biological function of improving the drought resistance of transgenic plants. Attached Figure Description

[0011] Figure 1 Phenotypic figures of wild-type (WT) and three transgenic Arabidopsis lines (#18, #20, #22) before drought treatment, 7 days after drought treatment, and 2 days after rehydration. Figure 2 This is a diagram showing the DNA identification results of WT and transgenic Arabidopsis thaliana lines; Figure 3In WT and transgenic lines VvHDZ27 Relative gene expression level graph; Figure 4 This is a graph showing the survival rates of WT and transgenic lines after drought stress; Figure 5 This is a graph showing the WT and H2O2 content of transgenic lines measured after drought stress; Figure 6 The WT and O2 of the transgenic lines were measured after drought stress. - Content chart; Figure 7 This is a graph showing the proline content of WT and transgenic lines measured after drought stress; Figure 8 This is a graph showing the APX enzyme activity of transgenic lines and WT after drought stress. Figure 9 This is a graph showing the SOD enzyme activity of transgenic lines and WT after drought stress. Figure 10 This is a graph showing the POD enzyme activity of transgenic lines and WT after drought stress. Figure 11 This is a graph showing the CAT enzyme activity of transgenic lines and WT after drought stress. Figure 12 Phenotypic diagrams of control and transgenic callus tissue treated with different concentrations of mannitol; Figure 13 It is in the callus tissue of genetically modified grapes VvHDZ27 Relative expression level graph; Figure 14 The images show the fresh weight of transgenic callus cultured for 15 days under different concentrations of mannitol. Figure 15 The graph shows the H2O2 content of transgenic callus treated with 0 and 300 mM mannitol. Figure 16 O2· of transgenic callus treated with 0 and 300 mM mannitol - Content chart; Figure 17 The graph shows the APX enzyme activity of transgenic callus treated with 0 and 300 mM mannitol. Figure 18 This is a graph showing the CAT enzyme activity of transgenic callus treated with 0 and 300 mM mannitol. Figure 19 This is a graph showing the POD enzyme activity of transgenic callus treated with 0 and 300 mM mannitol. Figure 20 This is a graph showing the SOD enzyme activity of transgenic callus treated with 0 and 300 mM mannitol. Figure 21In transgenic callus treated with 0 and 300 mM mannitol VvAPX Relative expression level graph; Figure 22 Transgenic callus treated with 0 and 300 mM mannitol VvCAT Relative expression level graph; Figure 23 In transgenic callus treated with 0 and 300 mM mannitol VvPOD Relative expression level graph; Figure 24 In transgenic callus treated with 0 and 300 mM mannitol VvSOD The relative expression level diagram. Detailed Implementation

[0012] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0013] This invention utilizes homologous cloning technology, based on the European grape Cabernet Sauvignon. VvHDZ27 Specific primers were designed based on the CDS sequence, and the first strand of cDNA synthesized by reverse transcription of total RNA from Cabernet Sauvignon leaves was used as a template to amplify the CDS sequence. VvHDZ27 The open reading frame sequence of this gene is 681 bp in length, encoding 226 amino acids, with a predicted molecular weight of 25.35 kDa and a theoretical isoelectric point of 5.12.

[0014] This invention also constructed pCAMBIA2300-35s-3×Flag- VvHDZ27 Overexpression vectors were used and introduced into Arabidopsis and grape callus tissues via Agrobacterium-mediated genetic transformation. The effects of overexpression were investigated. VvHDZ27 Transgenic Arabidopsis and grape callus tissues were compared to wild-type tissues under drought treatment to assess drought resistance. Results showed overexpression... VvHDZ27 It can significantly improve the survival rate of transgenic Arabidopsis thaliana under drought stress and the fresh weight of transgenic callus. Analysis of its physiological regulatory mechanism revealed... VvHDZ27 The gene reduces reactive oxygen species (including H2O2 and O2·) in transgenic plants by increasing the activity of the antioxidant enzyme CAT (catalase). - To reduce the content of ) to inhibit drought-induced oxidative stress and improve the drought resistance of transgenic plants.

[0015] Example 1 In order to VvHDZ27Functional identification was performed using the 35S::VvHDZ27-FLAG::pCAMBIA2300 overexpression construct. The construct was introduced into Agrobacterium tumefaciens GV3101 strain via a freeze-thaw method, and wild-type Arabidopsis thaliana was transformed using the inflorescence dip method, yielding 11 independent transformants. Three overexpression lines (#18, #20, #22) were selected based on transcriptional levels for subsequent drought tolerance testing. Results showed that after two days of rehydration following drought stress, the survival rate of the overexpression lines was significantly higher than that of wild-type WT plants. Under drought conditions, physiological index analysis showed that the transgenic plants contained significantly higher levels of reactive oxygen species (ROS) (H2O2 and O2·p⁻¹). - The accumulation amount has decreased significantly.

[0016] To further understand VvHDZ27 To investigate how to regulate drought resistance in transgenic Arabidopsis thaliana, physiological indicators were measured in Arabidopsis thaliana before and after drought stress. The results showed that the content of the osmotic regulator proline and the activities of key antioxidant enzymes (APX, CAT, and POD) were significantly increased in transgenic Arabidopsis thaliana, indicating that... VvHDZ27 By enhancing the ability to scavenge reactive oxygen species and regulate osmosis, the oxidative damage caused by drought was effectively alleviated, thereby improving the drought resistance of transgenic plants.

[0017] To further verify VvHDZ27 To enhance drought resistance, this invention constructs an overexpression... VvHDZ27 (OE-VvHDZ27) and RNAi-mediated VvHDZ27 The RNAi-VvHDZ27 vector was used to genetically transform grape callus tissue along with its corresponding empty vector. Drought stress was simulated using mannitol at concentrations of 100, 300, and 500 mM, and indicators were measured several weeks later. Results showed that under 300 mM mannitol stress, the fresh weight of OE-VvHDZ27 callus tissue was significantly higher than the control, increasing by 44.13%; while the fresh weight of the RNAi-VvHDZ27 line was 26.99% lower than the control. At a high concentration of 500 mM mannitol, growth was significantly inhibited in all lines, but the OE line maintained relatively good growth. Regarding ROS accumulation, under 300 mM mannitol stress, the OE-VvHDZ27 line showed significantly higher levels of H2O2 and O2·p-O2. - The contents of [specific compounds] decreased by 6.48% and 9.21% compared to the control; conversely, the contents of both [specific compounds] increased by 24.86% and 11.68% in the RNAi-VvHDZ27 line, respectively. These results indicate that overexpression [specific compounds]... VvHDZ27 It can significantly enhance growth capacity under drought conditions and alleviate oxidative damage caused by drought stress, while silencing this gene makes callus tissue more sensitive to drought, further confirming that... VvHDZ27 Positively regulates drought tolerance in grapes.

[0018] To further explore and evaluate VvHDZ27 The antioxidant capacity was assessed, and based on the previous step, the activities of key antioxidant enzymes and the expression levels of their encoding genes in transgenic callus were determined. The results showed that 300 mM mannitol stress significantly induced the activity of catalase (CAT) compared to 0 mM mannitol. Notably, under these conditions, the CAT activity of OE-VvHDZ27 callus was uniquely and significantly higher than that of the OE-vector control line, exceeding it by 27.24%. Conversely, compared to the RNAi-vector control line, the CAT activity of the RNAi-HDZ27 line was significantly reduced by 16.02%, indicating that... VvHDZ27 The regulation of the antioxidant enzyme system likely primarily affects the CAT enzyme. Further analysis of CAT gene expression, consistent with enzyme activity results, revealed that CAT transcription levels in OE-VvHDZ27 callus tissue were significantly upregulated under 300 mM mannitol treatment, increasing by 163.75% compared to the control, while downregulated in the RNAi-VvHDZ27 line, decreasing by 51.70% compared to the control. This indicates that VvHDZ27 confers strong drought tolerance in grape homologous systems by positively regulating VvCAT expression and enzyme activity.

[0019] This invention clones from Cabernet Sauvignon grapes VvHDZ27 The gene was transformed into Arabidopsis and grape callus tissue via Agrobacterium-mediated genetic transformation. Analysis of the drought resistance of the transgenic lines revealed overexpression. VvHDZ27 The transgenic Arabidopsis thaliana showed significantly improved survival rates in callus tissue, suggesting that this gene plays an important role in regulating the grape's response to drought stress. Further investigation was conducted... VvHDZ27 The study of gene functions that regulate grape drought resistance and their possible mechanisms of action provides a theoretical basis for improving grape drought resistance and developing new water-saving and stress-resistant varieties through molecular breeding, and has important application value for the sustainable development of the grape industry.

[0020] Example 2 'Cabernet Sauvignon' grapes VvHDZ27 The coding region sequence and the specific steps for experimental verification of its improved drought resistance are as follows: A. In the preliminary research and analysis, 31 genome-wide genes were identified through a genome-wide search. VvHDZ Genes. These gene systems are named according to their chromosomal location. VvHDZ1 to VvHDZ31 They are divided into four distinct subfamilies (I–IV) according to the established Arabidopsis classification system. (Regarding grapes...) VvHDZ Cis-acting elements in gene promoters and grapes under drought stress VvHDZ Analyze gene expression patterns and screen for... VvHDZ27Genes have potential importance in grape drought stress adaptation. Based on this, a gene was amplified from 'Cabernet Sauvignon' using PCR. VvHDZ27 The full-length cDNA of the gene is shown in SEQ ID No. 1, and the amino acid sequence encoded by the gene is shown in SEQ ID No. 2. B. See also Figures 1-3 In order to VvHDZ27 Functional identification was performed by transforming the VvHDZ27 overexpression vector into wild-type Arabidopsis thaliana (Col-0) using the Agrobacterium-mediated inflorescence dipping method. Three homozygous overexpression lines (#18, #20, #22) were selected for drought tolerance analysis. Under normal growth conditions, the transgenic lines showed no significant difference in phenotype from the wild-type (WT). However, after 7 days of drought stress followed by 2 days of rehydration, the survival rate of the transgenic lines ( Figure 4 The H2O2 content in the leaves of transgenic lines was significantly higher than that in WT, and the survival rate of line #20 was 1150% higher than that of WT. Physiological index measurements showed that after drought stress, the H2O2 content in the leaves of transgenic lines was significantly higher than that in WT. Figure 5 ) and O2· - ( Figure 6 The content of ) was significantly lower than that of WT. These results confirm that VvHDZ27 By enhancing the ability to scavenge reactive oxygen species, the drought resistance of transgenic Arabidopsis thaliana was effectively improved.

[0021] C. In order to further understand VvHDZ27 To investigate how to regulate drought resistance in transgenic Arabidopsis thaliana, this study measured physiological indicators in Arabidopsis thaliana before and after drought stress. The results showed that the content of proline, an osmotic regulator, in transgenic Arabidopsis thaliana (…) Figure 7 ) and the key antioxidant enzyme APX ( Figure 8 SOD ( Figure 9 ), POD ( Figure 10 ) and CAT ( Figure 11 The activity of ) was significantly increased, indicating VvHDZ27 By enhancing the ability to scavenge reactive oxygen species and regulate osmosis, the oxidative damage caused by drought was effectively alleviated, thereby improving the drought resistance of transgenic plants.

[0022] D. See also Figures 12-13Four types of transgenic grape callus were obtained: control 1 (35S:FLAG), OE-VvHDZ27 (35S:VvHDZ27-FLAG), control 2 (35S:RNAi), and RNAi-VvHDZ27 (35S:VvHDZ27-RNAi). To verify drought resistance in a grape homology system, grape callus overexpressing (OE-VvHDZ27) and with RNAi interference (RNAi-VvHDZ27) were obtained. Under drought stress simulated by 300 mM mannitol, the OE lines showed significantly better growth than the control, with a significant increase in fresh weight. Figure 14 RNAi lines showed inhibited growth and significantly reduced fresh weight. At a high concentration of 500 mM mannitol, all lines exhibited significantly inhibited growth, but the OE line maintained relatively good growth. Figure 12 Regarding the accumulation of reactive oxygen species (ROS), under 300 mM mannitol stress, the levels of H2O2 and O2· in the OE-VvHDZ27 strain were significantly higher. - The contents of these two components decreased by 6.48% and 9.21% respectively compared to the control; conversely, the contents of these two components increased by 24.86% and 11.68% respectively in the RNAi-VvHDZ27 strain. Figure 15 , 16 These results indicate overexpression VvHDZ27 It can significantly enhance growth capacity under drought conditions and alleviate oxidative damage caused by drought stress, while silencing this gene makes callus tissue more sensitive to drought, further confirming that... VvHDZ27 Positively regulates drought tolerance in grapes.

[0023] E. For further investigation and evaluation VvHDZ27 The antioxidant capacity was assessed, and based on the previous step, the activities of key antioxidant enzymes and the expression levels of their encoding genes in transgenic callus were determined. The results showed that, compared with 0 mM mannitol, 300 mM mannitol stress significantly induced the activities of ascorbate peroxidase (APX) and catalase (CAT). Figure 17 , 18 Notably, under 300 mM mannitol conditions, the CAT activity of OE-VvHDZ27 callus was unique and significantly higher than that of the OE-vector control, exceeding it by 27.24%. Conversely, compared to the RNAi-vector control, the CAT activity of the RNAi-HDZ27 line was significantly reduced by 16.02%. Figure 18 This indicates VvHDZ27It can regulate the antioxidant enzyme system, possibly mainly acting on the CAT enzyme. Further analysis of CAT gene expression, consistent with enzyme activity results, showed that under 300 mM mannitol treatment, CAT transcription levels in OE-VvHDZ27 callus were significantly upregulated, increasing by 163.75% compared to the control, while in the RNAi-VvHDZ27 line, they were downregulated, decreasing by 51.70% compared to the control. Figure 22 This indicates that... VvHDZ27 Through positive regulation VvCAT The expression and enzyme activity of these enzymes confer strong tolerance to drought stress in grape homology systems.

[0024] Example 3: VvHDZ27 Drought resistance analysis of transgenic Arabidopsis thaliana Using Agrobacterium-mediated inflorescence dipping method, VvHDZ27 Overexpression vectors were transformed into wild-type Arabidopsis thaliana (Col-0). After resistance screening and molecular identification, three homozygous overexpression lines (#18, #20, #22) were obtained. Under normal growth conditions, the transgenic lines showed no significant phenotypic difference from the wild-type (WT) lines. To assess drought resistance, both the transgenic lines and WT lines were subjected to drought treatment: watering was stopped for 7 days and then re-watered for 2 days, and survival rates were recorded. The results showed that the survival rate of the transgenic lines was significantly higher than that of WT lines, with #18, #20, and #22 showing survival rates 550%, 1150%, and 500% higher than WT, respectively. Figure 3 Further analysis of physiological indicators following drought stress revealed that H2O2 content decreased to 36.58%, 25.18%, and 21.32% of WT in samples #18, #20, and #22, respectively. Figure 4 O2· - The contents decreased by 55.22%, 46.09%, and 49.81%, respectively. Figure 5 These results collectively demonstrate that VvHDZ27 significantly improves the drought tolerance of transgenic Arabidopsis thaliana by reducing ROS accumulation.

[0025] Example 4: VvHDZ27 Antioxidant enzyme analysis of transgenic Arabidopsis thaliana To further understand VvHDZ27 How to regulate the drought resistance of transgenic Arabidopsis thaliana? Physiological indicators of Arabidopsis thaliana before and after drought stress were measured. Results showed that the content of proline, an osmotic regulator, in transgenic Arabidopsis thaliana (…) Figure 7 ) and the key antioxidant enzyme APX ( Figure 8 SOD ( Figure 9 ), POD ( Figure 10 ) and CAT ( Figure 11 The activity of ) was significantly increased, indicating VvHDZ27By enhancing the ability to scavenge reactive oxygen species and regulate osmosis, the oxidative damage caused by drought was effectively alleviated, thereby improving the drought resistance of transgenic plants.

[0026] Example 5: VvHDZ27 Analysis of drought resistance in transgenic grape callus To verify in grape homology system VvHDZ27 To investigate the function, grape callus lines overexpressing (OE-VvHDZ27) and with RNAi interference (RNAi-VvHDZ27) were constructed, along with an empty vector control. Drought stress was simulated using different concentrations of mannitol (0, 100, 300, and 500 mM), and phenotypes and physiological parameters were observed and measured after several weeks of culture.

[0027] Under 300 mM mannitol stress, the fresh weight of OE-VvHDZ27 callus was significantly higher than that of the control, increasing by 44.13%; while the fresh weight of RNAi-VvHDZ27 was 26.99% lower than that of the control. Figure 14 At a high concentration of 500 mM mannitol, the growth of all lines was significantly inhibited, but the OE line maintained a relatively good growth status. Figure 12 Regarding the accumulation of reactive oxygen species (ROS), under 300 mM mannitol stress, the levels of H2O2 and O2· in the OE-VvHDZ27 strain were significantly higher. - The contents of these two components decreased by 6.48% and 9.21% respectively compared to the control; conversely, the contents of these two components increased by 24.86% and 11.68% respectively in the RNAi-VvHDZ27 strain. Figure 15 16). These results indicate overexpression VvHDZ27 It can significantly enhance growth capacity under drought conditions and alleviate oxidative damage caused by drought stress, while silencing this gene makes callus tissue more sensitive to drought, further confirming that... VvHDZ27 Positively regulates drought tolerance in grapes.

[0028] Example 6: VvHDZ27 Positive regulation of VvCAT expression and enzyme activity like Figures 17-24 As shown, for further exploration and evaluation VvHDZ27 The antioxidant capacity was assessed, and based on the previous step, the activities of key antioxidant enzymes and the expression levels of their encoding genes in transgenic callus were determined. The results showed that, compared with 0 mM mannitol, 300 mM mannitol stress significantly induced the activities of ascorbate peroxidase (APX) and catalase (CAT). Figure 17- 18). Notably, under these conditions, the CAT activity of OE-VvHDZ27 callus was unique and significantly higher than that of the OE-vector control line, exceeding it by 27.24%. Conversely, compared with the RNAi-vector control line, the CAT activity of the RNAi-HDZ27 line was significantly reduced by 16.02% ( Figure 18 This indicates VvHDZ27 It can regulate the antioxidant enzyme system, possibly mainly acting on the CAT enzyme. Further analysis of CAT gene expression, consistent with enzyme activity results, showed that under 300 mM mannitol treatment, CAT transcription levels in OE-VvHDZ27 callus were significantly upregulated, increasing by 163.75% compared to the control, while in the RNAi-VvHDZ27 line, they were downregulated, decreasing by 51.70% compared to the control. Figure 22 This indicates that... VvHDZ27 By positively regulating the expression and enzyme activity of VvCAT, strong tolerance to drought stress was conferred in the grape homology system.

[0029] sequence list <110> Northwest A&F University <120> The VvHDZ27 gene for improving drought resistance in grapes and its application <160> 2 <170> Editseq DNASTAR 7.1.0.44 <210> 1 <211> 678 <212> DNA <213> Malus domestica <400> 1 ATGATGGAGAGCAGAGGGTGTTCGGCAGAAGAAGCAGGAGAGGAGGGGGAGCAGCTGACC60 AGGAAGAAGA GCAGGAACAA GAAGAGGTTC AGTGACGAGC AAGTTCAGTA TCTGGAGTCT120 ATTTTCGAGT CGGATAGTAA GCTTGAGGCG AGGAAGAAGG AGGAGCTGGC GGTGGAGCTT180 GGGATGCAGC CGAGACAGGT TGCTATATGG TTTCAGAACA AGAGAGCGAG GTGGAAGTCG240 AAACAGATAG AGCACGACTA CAAAGCACTC AGAGCTAGCT ACGATGCTTT AACGTCTCGG300 TTCGAGTCCT TGAAGGAGGA GAAACAGTCT TTACTCACAC AGTTGCAGAA GCTGGTGAT360 CTGATGGAAA AACCTGGTGA TGGGGTGGGA AGCGGTTTCG GAGGAAACAG CAGTACTGAT420 GGGGGATCAG ACACCGGAGA TGATGCAAAA TTGAGCTACT TAGAAGGTGG CCTGGACCAC480 AGATTAGTCA AGTGCTCAGA CGATGATAAG AGCCGAAGTG CAGGCTACTT TGGCCACCAA540 GAAGGGCCTG AGCTTCTCGA CAAATGTGAA AATGCAGATA TTTCCTTGAA ATCAACCGGA600 AAATGGTTCG GTTTCGCCTC AGGCGGCTTC CATGATCAGT CATGTACCAT TTCACAGTTG660 TGGGACTTCT GGAGTAGT678 <210> 2 <211> 226 <212> PRT <213> Malus domestica <400> 2 MMESRGCSAE EAGEEGEQLT RKKSRNKKRF SDEQVQYLES IFESDSKLEA KKEELAVELG60 MQPRQVAIWF QNKRARWKSK QIEHDYKALR ASYDALTSRF ESLKEEKQSL LTQLQKLGDL120 MEKPGDGVGS GFGGNSSTDG GSDTGDDAKL SYLEGGLDHR LVKCSDDDKS RSAGYFGHQE180 GPELLDKCEN ADISLESTGK WFGFASGGFH DQSCTISQLW DFWSS 226

Claims

1. Improve the drought resistance of grapes VvHDZ27 Genes, characterized by, The VvHDZ27 The coding region sequence of the gene is shown in SEQ ID No.

1.

2. As described in claim 1 VvHDZ27 Gene-encoded proteins are characterized by, The amino acid sequence of the protein is shown in SEQ ID No.

2.

3. As described in claim 1 VvHDZ27 Application of genes in improving the drought resistance of grapes.

4. The application as described in claim 3, characterized in that, By constructing pCAMBIA2300-35s-3×Flag- VvHDZ27 The overexpression vector was introduced into Arabidopsis and grape callus tissues via Agrobacterium-mediated genetic transformation.